chore: simplified organizational structurelaptop

260 files changed, 0 insertions, 39871 deletions

diff --git a/sys/base/arg.c b/sys/base/arg.c
deleted file mode 100644
index 269043e..0000000
--- a/sys/base/arg.c
+++ /dev/null
@@ -1,71 +0,0 @@
-#include <u.h>
-#include <base.h>
-
-// NOTE: this utf8 bit is copied from libunicode to remove the hard dependency just for ARG_BEGIN.
-
-#define UTFmax   4
-#define RuneSync 0x80u
-#define RuneSelf 0x80u
-#define RuneErr  0xFFFDu
-#define RuneMax  0x10FFFFu
-#define RuneMask 0x1FFFFFu
-
-#define Bit(i) (7-(i))
-/* N 0's preceded by i 1's e.g. T(Bit(2)) is 1100 0000 */
-#define Tbyte(i) (((1 << (Bit(i)+1))-1) ^ 0xFF)
-/* 0000 0000 0000 0111 1111 1111 */
-#define	RuneX(i) ((1 << (Bit(i) + ((i)-1)*Bitx))-1)
-enum
-{
-    Bitx  = Bit(1),
-    Tx    = Tbyte(1),
-    Rune1 = (1 << (Bit(0)+0*Bitx)) - 1,
-
-    Maskx = (1 << Bitx) - 1, /* 0011 1111 */
-    Testx = Maskx ^ 0xff,    /* 1100 0000 */
-
-    SurrogateMin = 0xD800,
-    SurrogateMax = 0xDFFF,
-    Bad = RuneErr,
-};
-
-
-int
-arg·bytetorune(uint32* r, byte* s)
-{
-    int c[4], i;
-    uint32 l;
-
-    c[0] = *(ubyte*)(s);
-    if(c[0] < Tx) {
-        *r = c[0];
-        return 1;
-    }
-
-    l = c[0];
-    for(i = 1; i < UTFmax; i++) {
-        c[i]  = *(ubyte*)(s+i);
-        c[i] ^= Tx;
-        if (c[i] & Testx) goto bad;
-
-        l = (l << Bitx) | c[i];
-        if(c[0] < Tbyte(i + 2)) {
-            l &= RuneX(i + 1);
-            if (i == 1) {
-                if (c[0] < Tbyte(2) || l <= Rune1)
-                    goto bad;
-            } else if (l <= RuneX(i) || l > RuneMax)
-                goto bad;
-            if (i == 2 && SurrogateMin <= l && l <= SurrogateMax)
-                goto bad;
-
-            *r = l;
-            return i + 1;
-        }
-    }
-bad:
-    *r = RuneErr;
-    return 1;
-}
-
-char *argv0;
diff --git a/sys/base/bufio/dump.c b/sys/base/bufio/dump.c
deleted file mode 100644
index 0b527e2..0000000
--- a/sys/base/bufio/dump.c
+++ /dev/null
@@ -1,66 +0,0 @@
-// -----------------------------------------------------------------------
-// reader
-
-#if 0
-rune
-bufio·getrune(io·Buffer *buf)
-{
-    ubyte b;
-    int   i;
-    byte  str[UTFmax+1];
-    rune  r;
-
-    // NOTE: I'm worried about the sign here...
-    b = bufio·getbyte(buf);
-    if (b < RuneSelf) {
-        buf->runesize = 1;
-        return b;
-    }
-
-    i = 0;
-    str[i++] = b;
-
-nextbyte:
-    b = bufio·getbyte(buf);
-    if (b < 0)            return b;
-    if (i >= arrlen(str)) return RuneErr;
-    str[i++] = b;
-    if (!utf8·fullrune(str, i))
-        goto nextbyte;
-
-    buf->runesize = utf8·bytetorune(&r, str);
-    if (r == RuneErr && b == 1) {
-        errorf("illegal UTF-8 sequence");
-		for (; i >= 0; i--)
-			errorf("%s%.2x", i > 0 ? " " : "", *(ubyte*)(str+i));
-		errorf("\n");
-
-        buf->runesize = 0;
-    } else
-        for (; i > buf->runesize; i--)
-            bufio·ungetbyte(buf, str[i]);
-
-    return r;
-}
-
-// TODO: Check that we are given the correct rune!
-error
-bufio·ungetrune(io·Buffer *buf, rune r)
-{
-    if (buf->state & bufio·rdr) {
-        errorf("attempted to unget on non-active reader");
-        return bufio·err;
-    }
-
-    if (buf->pos == buf->buf) {
-        errorf("attempted to unget past end of buffer");
-        return bufio·err;
-    }
-
-    buf->pos -= buf->runesize;
-    return 0;
-}
-#endif
-
-// -----------------------------------------------------------------------
-// writer
diff --git a/sys/base/bufio/get.c b/sys/base/bufio/get.c
deleted file mode 100644
index 9f10c88..0000000
--- a/sys/base/bufio/get.c
+++ /dev/null
@@ -1,17 +0,0 @@
-#include "internal.h"
-#include "refill.h"
-
-int
-bufio·getbyte(io·Buffer *buf)
-{
-getbyte:
-    if(buf->pos < buf->end)
-        return *buf->pos++;
-
-    memmove(buf->buf, buf->end - bufio·ungets, bufio·ungets);
-
-    if(refill(buf) <= 0)
-        return bufio·eof;
-
-    goto getbyte;
-}
diff --git a/sys/base/bufio/internal.h b/sys/base/bufio/internal.h
deleted file mode 100644
index 302c035..0000000
--- a/sys/base/bufio/internal.h
+++ /dev/null
@@ -1,4 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <base.h>
diff --git a/sys/base/bufio/read.c b/sys/base/bufio/read.c
deleted file mode 100644
index 09a9f83..0000000
--- a/sys/base/bufio/read.c
+++ /dev/null
@@ -1,36 +0,0 @@
-#include "internal.h"
-#include "refill.h"
-
-int
-bufio·read(io·Buffer *buf, int sz, int n, void *out)
-{
-    byte *wtr;
-    int   nr, rem, diff;
-
-    if(n == 0 || buf->state & bufio·end)
-        return bufio·err;
-
-    assert(buf->state & bufio·rdr);
-
-    wtr = out;
-    rem = n*sz;
-
-    while(rem > 0){
-        diff = buf->end - buf->pos;
-        nr   = MIN(diff, rem);
-        if(!nr){
-            if(buf->state & bufio·end) 
-                break;
-            if(refill(buf) <= 0)
-                break;
-
-            continue;
-        }
-        memmove(wtr, buf->pos, nr);
-        wtr      += nr;
-        buf->pos += nr;
-        rem      -= nr;
-    }
-
-    return n - rem/sz;
-}
diff --git a/sys/base/bufio/reader.c b/sys/base/bufio/reader.c
deleted file mode 100644
index afdaf60..0000000
--- a/sys/base/bufio/reader.c
+++ /dev/null
@@ -1,28 +0,0 @@
-#include "internal.h"
-
-error
-bufio·initreader(io·Buffer *buf, io·Reader rdr, void *h)
-{
-    if (buf->state) {
-        errorf("attemped to initialize an active buffer, state is '%d'", buf->state);
-        return bufio·err;
-    }
-    buf->state    = bufio·rdr;
-    buf->runesize = 0;
-    buf->h        = h;
-    buf->rdr      = rdr;
-    buf->beg      = buf->buf + bufio·ungets;
-    buf->pos      = buf->beg;
-    buf->end      = buf->pos; 
-    buf->size     = bufio·size - bufio·ungets;
-
-    return 0;
-}
-
-void
-bufio·finireader(io·Buffer *buf)
-{
-    buf->state    = bufio·nil;
-    buf->runesize = 0;
-    buf->rdr      = (io·Reader){ .read = nil };
-}
diff --git a/sys/base/bufio/refill.h b/sys/base/bufio/refill.h
deleted file mode 100644
index 41e357e..0000000
--- a/sys/base/bufio/refill.h
+++ /dev/null
@@ -1,28 +0,0 @@
-int
-refill(io·Buffer *buf)
-{
-    int n;
-
-    if(buf->state & bufio·end)
-        return bufio·err;
-
-    memcpy(buf->buf, buf->pos - bufio·ungets, bufio·ungets);
-
-    n = buf->rdr.read(buf->h, 1, buf->size, buf->beg);
-    if(n < 0)
-        return bufio·err;
-    if(n == 0){
-        buf->state |= bufio·end;
-        return 0;
-    }
-
-    buf->pos = buf->beg;
-    buf->end = buf->pos + n;
-
-    // TEST: put a physical EOF byte at the end
-    // this would allow for an unget operation
-    if(n < buf->size)
-        *buf->end++ =  EOF;
-
-    return n;
-}
diff --git a/sys/base/bufio/rules.mk b/sys/base/bufio/rules.mk
deleted file mode 100644
index 84f283f..0000000
--- a/sys/base/bufio/rules.mk
+++ /dev/null
@@ -1,5 +0,0 @@
-SRCS_$(d)+=\
-	$(d)/bufio/get.c\
-	$(d)/bufio/read.c\
-	$(d)/bufio/reader.c\
-	$(d)/bufio/unget.c\
diff --git a/sys/base/bufio/unget.c b/sys/base/bufio/unget.c
deleted file mode 100644
index 3fd16de..0000000
--- a/sys/base/bufio/unget.c
+++ /dev/null
@@ -1,18 +0,0 @@
-#include "internal.h"
-
-error
-bufio·ungetbyte(io·Buffer *buf, byte c)
-{
-    if(!(buf->state & bufio·rdr)) {
-        errorf("attempted to unget on non-active reader");
-        return bufio·err;
-    }
-
-    if(buf->pos == buf->buf) {
-        errorf("attempted to unget past end of buffer");
-        return bufio·err;
-    }
-
-    buf->pos--;
-    return 0;
-}
diff --git a/sys/base/coro/coro.c b/sys/base/coro/coro.c
deleted file mode 100644
index 2255c99..0000000
--- a/sys/base/coro/coro.c
+++ /dev/null
@@ -1,43 +0,0 @@
-#include "internal.h"
-
-/* Co-routine context */
-Coro*
-coro·make(uintptr stk, uintptr (*func)(Coro*, uintptr))
-{
-    if (!func) return nil;
-    if (stk == 0) stk = 8192;
-
-    byte *block = malloc(stk);
-    Coro *co    = (Coro*)&block[stk - sizeof(Coro)];
-    co->bp      = block;
-    co->size    = stk;
-
-    _newcoro(co, func, co);
-    return co;
-}
-
-error
-coro·free(Coro *co)
-{
-    enum 
-    {
-        NIL,
-        GOOD,
-        EMPTY,
-        LOST,
-    };
-
-    if (!co)           return NIL;
-    if (!co->bp)       return LOST;
-    if (co->size == 0) return EMPTY;
-
-    free(co->bp);
-
-    return GOOD;
-}
-
-uintptr
-coro·yield(Coro *c, uintptr arg)
-{
-    return _coroyield(c, arg);
-}
diff --git a/sys/base/coro/internal.h b/sys/base/coro/internal.h
deleted file mode 100644
index f57d27b..0000000
--- a/sys/base/coro/internal.h
+++ /dev/null
@@ -1,15 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <base.h>
-
-extern void    _newcoro(Coro *co, uintptr (*func)(Coro*, uintptr), void *stk);
-extern uintptr _coroyield(Coro *co, uintptr arg);
-
-struct Coro
-{
-    void   *sp;
-    void   *bp;
-    uintptr size;
-    void   *user;
-};
diff --git a/sys/base/coro/rules.mk b/sys/base/coro/rules.mk
deleted file mode 100644
index c2ee89f..0000000
--- a/sys/base/coro/rules.mk
+++ /dev/null
@@ -1,3 +0,0 @@
-SRCS_$(d)+=\
-	$(d)/coro/coro.c\
-	$(d)/coro/unix_x64.s\
diff --git a/sys/base/coro/unix_x64.s b/sys/base/coro/unix_x64.s
deleted file mode 100644
index d7de2a2..0000000
--- a/sys/base/coro/unix_x64.s
+++ /dev/null
@@ -1,113 +0,0 @@
-; Nicholas Noll 2019
-;
-; ===================================================================
-%use altreg
-
-    bits 64
-    default rel
-    global _newcoro
-    global _coroyield
-
-; ===================================================================
-    section .text
-; -------------------------------------------------------------------
-
-%assign L.coro  -8
-%assign L.func  -16
-
-coroinit:
-    mov     R7, [RBP + L.coro]
-    mov     R6, R0 
-    call    [RBP + L.func]
-
-rerun:
-    mov     R7, [RBP + L.coro]
-    mov     R6, R0
-    call    _coroyield
-    jmp     rerun
-
-; -------------------------------------------------------------------
-; # Register Mapping
-; 
-; R0   R1   R2   R3   R4   R5   R6   R7   R8  ...
-; RAX  RCX  RDX  RBX  RSP  RBP  RSI  RDI  R8  ...
-; 
-; # Sys V calling convention
-; func(R7, R6, R2, R1, R8, R9, Z0-7): R0
-;
-; # Stack layout of an in-flight coro
-; *coro
-; *func
-; *bp (base pointer of stack)
-; ....... STACK .........
-; Saved Clobbers
-;
-; ###
-; Stack layout of an init coro
-; Stores the func pointer to init 
-; Stores the clobber registers.
-;
-; L.coro        [8] 
-; L.func        [7]
-; coroinit      [6]
-; RBP           [5]
-; R3            [4]
-; R12           [3]
-; R13           [2]
-; R14           [1]
-; R15           [0]
-
-%define WORDSZ 8
-%define NSAVES 9 
-
-; coro *coro·new(co *coro, fn func, bp *stack)
-_newcoro:
-    lea     R0, [coroinit]              ; Store address of init function
-    lea     R1, [R2 - NSAVES*WORDSZ]    ; Store offset address of stack
-    
-    mov     [R1 + 8*WORDSZ], R7         ; Store context pointer
-    mov     [R1 + 7*WORDSZ], R6         ; Store function pointer
-    mov     [R1 + 6*WORDSZ], R0         ; Store initializer pointer
-    mov     [R1 + 5*WORDSZ], R2         ; Store stack base pointer
-
-    xor     R0, R0
-
-    ; Start of mutable stack
-    ; Blank out the clobbers
-    mov     [R1 + 4*WORDSZ], R0 ; R3
-    mov     [R1 + 3*WORDSZ], R0 ; R12
-    mov     [R1 + 2*WORDSZ], R0 ; R13
-    mov     [R1 + 1*WORDSZ], R0 ; R14
-    mov     [R1 + 0*WORDSZ], R0 ; R15
-
-    mov     [R7], R1
-    ret
-
-; Saves register state
-%macro pushclobs 0
-    push     RBP
-    push     R3
-    push     R12
-    push     R13
-    push     R14
-    push     R15
-%endmacro
-
-; Restores register state
-%macro popclobs 0
-    pop      R15
-    pop      R14
-    pop      R13
-    pop      R12
-    pop      R3
-    pop      RBP
-%endmacro
-
-; uintptr coro.yield(co *coro, data uintptr)
-_coroyield:
-    pushclobs
-    mov     R0, R6      ; Move return value into return register.
-    xchg    RSP, [R7]   ; Atomically swap the stack pointer with the yieldee. 
-    popclobs
-
-    ret
diff --git a/sys/base/error/errorf.c b/sys/base/error/errorf.c
deleted file mode 100644
index 193dd9d..0000000
--- a/sys/base/error/errorf.c
+++ /dev/null
@@ -1,13 +0,0 @@
-#include "internal.h"
-
-void
-errorf(byte* fmt, ...)
-{
-    va_list args;
-    va_start(args, fmt);
-
-    fprintf(stderr, "error: ");
-    vfprintf(stderr, fmt, args);
-
-    va_end(args);
-}
diff --git a/sys/base/error/exits.c b/sys/base/error/exits.c
deleted file mode 100644
index 6be7d3b..0000000
--- a/sys/base/error/exits.c
+++ /dev/null
@@ -1,11 +0,0 @@
-#include "internal.h"
-
-void
-exits(char *s)
-{
-    if(s == nil || *s == 0)
-        exit(0);
-
-    fputs(s, stderr);
-    exit(1);
-}
diff --git a/sys/base/error/internal.h b/sys/base/error/internal.h
deleted file mode 100644
index 88a8895..0000000
--- a/sys/base/error/internal.h
+++ /dev/null
@@ -1,3 +0,0 @@
-#include <u.h>
-#include <base.h>
-
diff --git a/sys/base/error/panicf.c b/sys/base/error/panicf.c
deleted file mode 100644
index d698576..0000000
--- a/sys/base/error/panicf.c
+++ /dev/null
@@ -1,16 +0,0 @@
-#include "internal.h"
-
-void
-panicf(byte* fmt, ...)
-{
-    va_list args;
-    va_start(args, fmt);
-
-    printf("panic: ");
-    vprintf(fmt, args);
-    printf("\n");
-
-    va_end(args);
-
-    exit(1);
-}
diff --git a/sys/base/error/rules.mk b/sys/base/error/rules.mk
deleted file mode 100644
index e3a9ce0..0000000
--- a/sys/base/error/rules.mk
+++ /dev/null
@@ -1,6 +0,0 @@
-SRCS_$(d)+=\
-	$(d)/error/exits.c \
-	$(d)/error/errorf.c \
-	$(d)/error/panicf.c \
-	$(d)/error/verrorf.c \
-	$(d)/error/vpanicf.c \
diff --git a/sys/base/error/verrorf.c b/sys/base/error/verrorf.c
deleted file mode 100644
index 15af064..0000000
--- a/sys/base/error/verrorf.c
+++ /dev/null
@@ -1,9 +0,0 @@
-#include "internal.h"
-
-void
-verrorf(byte* fmt, va_list args) 
-{
-    printf("error: ");
-    vprintf(fmt, args);
-    printf("\n");
-}
diff --git a/sys/base/error/vpanicf.c b/sys/base/error/vpanicf.c
deleted file mode 100644
index bea97ac..0000000
--- a/sys/base/error/vpanicf.c
+++ /dev/null
@@ -1,11 +0,0 @@
-#include "internal.h"
-
-void
-vpanicf(byte* fmt, va_list args) 
-{
-    printf("panic: ");
-    vprintf(fmt, args);
-    printf("\n");
-
-    exit(1);
-}
diff --git a/sys/base/flate/internal.h b/sys/base/flate/internal.h
deleted file mode 100644
index 794c7c2..0000000
--- a/sys/base/flate/internal.h
+++ /dev/null
@@ -1,39 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <base.h>
-
-#include <zlib.h>
-
-typedef struct buffer
-{
-    union {
-        struct z_stream_s; 
-        z_stream z;
-    };
-
-    ubyte buf[4098];
-} buffer;
-
-typedef struct flate·Reader
-{
-    io·Reader rdr;
-    void*     impl;
-
-    union {
-        struct buffer;
-        buffer b;
-    };
-} flate·Reader;
-
-typedef struct flate·Writer
-{
-    io·Writer wtr;
-    void*     impl;
-
-    union {
-        struct buffer;
-        buffer b;
-    };
-} flate·Writer;
-
diff --git a/sys/base/flate/read.c b/sys/base/flate/read.c
deleted file mode 100644
index 9a42070..0000000
--- a/sys/base/flate/read.c
+++ /dev/null
@@ -1,41 +0,0 @@
-#include "internal.h"
-
-int
-flate·read(flate·Reader *rdr, int sz, int n, void *buf)
-{
-    int r;
-    int err;
-    flate·Reader zrdr;
-
-    zrdr = *rdr;
-    zrdr.next_out  = buf;
-    zrdr.avail_out = n*sz;
-
-READ:
-    err = inflate(&zrdr.b.z, Z_STREAM_END);
-    switch (err) {
-    case Z_OK:
-        return n;
-
-    case Z_STREAM_END:
-        r  = zrdr.next_out - (ubyte*)buf;
-        n -= r;
-        zrdr.avail_in = zrdr.rdr.read(zrdr.impl, 1, arrlen(zrdr.buf), zrdr.buf);
-        if (!zrdr.avail_in) {
-            return r;
-        }
-        zrdr.next_in  = zrdr.buf;
-        goto READ;
-
-    case Z_NEED_DICT:
-        errorf("zlib: need input dictionary");
-        goto ERROR;
-
-    case Z_STREAM_ERROR:
-        errorf("zlib: inconsistent stream structure");
-        goto ERROR;
-    }
-ERROR:
-    flate·closereader(rdr);
-    return -1;
-}
diff --git a/sys/base/flate/reader.c b/sys/base/flate/reader.c
deleted file mode 100644
index 84f0d80..0000000
--- a/sys/base/flate/reader.c
+++ /dev/null
@@ -1,59 +0,0 @@
-#include "internal.h"
-
-flate·Reader*
-flate·openreader(io·Reader rdr, void* r, mem·Allocator mem, void* m)
-{
-    error      err;
-    flate·Reader *zrdr;
-
-    zrdr = mem.alloc(m, 1, sizeof(*zrdr));
-
-    zrdr->zalloc    = (void *(*)(void *, unsigned int, unsigned int))mem.alloc;
-    zrdr->zfree     = mem.free;
-    zrdr->opaque    = m;
-    zrdr->avail_in  = rdr.read(r, 1, arrlen(zrdr->buf), zrdr->buf);
-    zrdr->next_in   = zrdr->buf;
-
-    err = inflateInit(&zrdr->b.z);
-
-    switch (err) {
-    case Z_OK:
-        return zrdr;
-
-    case Z_MEM_ERROR:
-        errorf("zlib: not enough memory");
-        goto ERROR;
-
-    case Z_VERSION_ERROR:
-        errorf("zlib: incompatible version");
-        goto ERROR;
-
-    case Z_STREAM_ERROR:
-        errorf("zlib: incorrect input parameters");
-        goto ERROR;
-
-    default:
-        errorf("zlib: unrecognized error code");
-    }
-ERROR:
-    errorf("zlib: msg: %s", zrdr->msg);
-    mem.free(m, zrdr);
-    return nil;
-}
-
-error
-flate·closereader(flate·Reader *rdr)
-{
-    int err;
-    flate·Reader zrdr;
-
-    zrdr = *rdr;
-    err = inflateEnd(&zrdr.b.z);
-    if (err != Z_OK) {
-        errorf("zlib: failed to cleanup");
-        return err;
-    }
-    rdr->zfree(rdr->opaque, rdr);
-
-    return 0;
-}
diff --git a/sys/base/flate/rules.mk b/sys/base/flate/rules.mk
deleted file mode 100644
index 54d8c14..0000000
--- a/sys/base/flate/rules.mk
+++ /dev/null
@@ -1,6 +0,0 @@
-SRCS_$(d)+=\
-	$(d)/flate/read.c\
-	$(d)/flate/reader.c\
-	$(d)/flate/write.c\
-	$(d)/flate/writer.c\
-	$(d)/flate/writer.c\
diff --git a/sys/base/flate/write.c b/sys/base/flate/write.c
deleted file mode 100644
index 3f07b94..0000000
--- a/sys/base/flate/write.c
+++ /dev/null
@@ -1,48 +0,0 @@
-#include "internal.h"
-
-int
-flate·write(flate·Writer *wtr, int sz, int n, void *buf)
-{
-    int r;
-    int err;
-    flate·Writer zwtr;
-
-    zwtr = *wtr;
-    zwtr.next_out  = buf;
-DEFLATE:
-    zwtr.avail_out = n*sz;
-    err = deflate(&zwtr.z, Z_NO_FLUSH);
-
-    switch (err) {
-    case Z_STREAM_END:
-        return n;
-
-    case Z_OK:
-        r  = (zwtr.next_out - (ubyte*)buf)/sz;
-        n -= r;
-        if (!n) {
-            return r;
-        }
-        buf += n;
-        goto DEFLATE;
-
-    case Z_STREAM_ERROR:
-        errorf("zlib: bad input");
-        goto ERROR;
-
-    case Z_BUF_ERROR:
-        if (!zwtr.avail_in) {
-            zwtr.avail_in += zwtr.wtr.write(zwtr.impl, 1, arrlen(zwtr.buf), buf);
-            if (!zwtr.avail_in) {
-                errorf("reader: failed read");
-                goto ERROR;
-            }
-            goto DEFLATE;
-        }
-    }
-
-    return 0;
-ERROR:
-    errorf("zlib: %s", zwtr.msg);
-    return -1;
-}
diff --git a/sys/base/flate/writer.c b/sys/base/flate/writer.c
deleted file mode 100644
index f339ae0..0000000
--- a/sys/base/flate/writer.c
+++ /dev/null
@@ -1,57 +0,0 @@
-#include "internal.h"
-
-flate·Writer*
-flate·openwriter(io·Writer wtr, void* w, mem·Allocator mem, void* m)
-{
-    error      err;
-    flate·Writer *zwtr;
-
-    zwtr = mem.alloc(m, 1, sizeof(*zwtr));
-    zwtr->zalloc   = (void *(*)(void *, unsigned int, unsigned int))mem.alloc;
-    zwtr->zfree    = mem.free;
-    zwtr->opaque   = m;
-    zwtr->avail_in = 0;
-
-    err = deflateInit(&zwtr->b.z, Z_DEFAULT_COMPRESSION);
-
-    switch (err) {
-    case Z_OK:
-        return zwtr;
-
-    case Z_MEM_ERROR:
-        errorf("zlib: not enough memory");
-        goto ERROR;
-
-    case Z_VERSION_ERROR:
-        errorf("zlib: incompatible version");
-        goto ERROR;
-
-    case Z_STREAM_ERROR:
-        errorf("zlib: incorrect compression level");
-        goto ERROR;
-
-    default:
-        errorf("zlib: unrecognized error code");
-    }
-ERROR:
-    errorf("zlib: msg: %s", zwtr->msg);
-    mem.free(m, zwtr);
-    return nil;
-}
-
-error
-flate·closewriter(flate·Writer *wtr)
-{
-    int err;
-    flate·Writer zwtr;
-
-    zwtr = *wtr;
-    err = deflateEnd(&zwtr.b.z);
-    if (err != Z_OK) {
-        errorf("zlib: failed to cleanup");
-        return err;
-    }
-    zwtr.zfree(zwtr.opaque, wtr);
-
-    return 0;
-}
diff --git a/sys/base/fs/internal.h b/sys/base/fs/internal.h
deleted file mode 100644
index 7fde093..0000000
--- a/sys/base/fs/internal.h
+++ /dev/null
@@ -1,18 +0,0 @@
-#include <u.h>
-#include <base.h>
-#include <base/macro/map.h>
-#include <dirent.h>
-
-/*
- * path history
- */
-struct Key
-{
-    ino_t ino;
-    dev_t dev;
-};
-
-struct fs·History
-{
-    SET_STRUCT_BODY(struct Key);
-};
diff --git a/sys/base/fs/rules.mk b/sys/base/fs/rules.mk
deleted file mode 100644
index 3927ae3..0000000
--- a/sys/base/fs/rules.mk
+++ /dev/null
@@ -1,3 +0,0 @@
-SRCS_$(d)+=\
-	$(d)/fs/walk.c\
-	$(d)/fs/walker.c\
diff --git a/sys/base/fs/walk.c b/sys/base/fs/walk.c
deleted file mode 100644
index d528896..0000000
--- a/sys/base/fs/walk.c
+++ /dev/null
@@ -1,119 +0,0 @@
-#include "internal.h"
-
-#define hash(k) ((int32)k.ino ^ (int32)k.dev)
-#define equal(k1, k2) (k1.ino == k2.ino && k1.dev == k2.dev)
-
-static
-int
-morehistory(fs·History *h, int n)
-{
-    SET_GROW(h, struct Key, n, hash, sys·Memory, nil);
-}
-
-static
-int
-addentry(fs·History *h, struct Key key, int *err)
-{
-    SET_PUT(h, key, hash, equal, morehistory, err);
-}
-
-static
-void
-forget(fs·History *h)
-{
-    if (!h)
-        return;
-
-    SET_RESET(h);
-}
-
-void
-fs·walk(fs·Walker *fs)
-{
-    char *e, *b;
-    DIR *dir;
-    int new, fd, ofd, flags;
-    fs·History *h;
-    struct dirent *d;
-    io·Stat cwd;
-    struct fs·Entry *it;
-
-    flags = 0;
-    if(fs->flags & fs·nolinks)
-        flags |= AT_SYMLINK_NOFOLLOW;
-
-    /* get info for base relative to current fd */
-    if(fstatat(fs->fd, fs->base, &cwd, flags) < 0){
-        if(fs->flags & fs·verbose)
-            errorf("stat: %s", fs->path);
-        return;
-    }
-
-    /* if we hit a file, finish! */
-    if(!S_ISDIR(cwd.st_mode)) {
-        fs->func(fs->data, fs->base, fs->path, &cwd);
-        return;
-    }
-
-    /* have we been here before? (cycle detection) */
-    /* if not, add to our path history */
-    if (!(fs->flags & fs·nolinks)) {
-        addentry(fs->hist, (struct Key){.dev=cwd.st_dev, .ino=cwd.st_ino}, &new);
-        if (!new)
-            return;
-    }
-
-    /* 
-     * operate on directory first if preorder traversal 
-     * truncate recursion if callback returns an error code
-     */ 
-    if (fs->flags & fs·preorder) {
-        if (fs->func(fs->data, fs->base, fs->path, &cwd))
-            return;
-    }
-
-    /* open directory */
-    if(!fs->max || fs->lev + 1 < fs->max) {
-        fd = openat(fs->fd, fs->base, O_RDONLY | O_CLOEXEC | O_DIRECTORY);
-        if (fd < 0)
-            errorf("open %s:", fs->path);
-
-        if (!(dir=fdopendir(fd))) {
-            if(fs->flags & fs·verbose)
-                errorf("fdopendir: %s", fs->path);
-            return;
-        }
-
-        ofd = fs->fd, fs->fd = fd;
-
-        /* traverse children */
-        e = fs->end, b = fs->base;
-        if (fs->end[-1] != '/')
-            *fs->end++ = '/';
-
-        fs->base = fs->end;
-        while((d = readdir(dir))) {
-            if(*d->d_name == '.')
-            if(d->d_name[1] == 0 ||                       /* . */ 
-               (d->d_name[1] == '.' && d->d_name[2] == 0)) /* .. */ 
-                continue;
-
-            fs->end = str·copyn(fs->base, d->d_name, arrend(fs->path) - fs->base);
-
-            fs->lev++;
-            fs·walk(fs);
-            fs->lev--;
-        }
-        *e      = 0;
-        fs->fd  = ofd;
-        fs->end = e, fs->base = b;
-        closedir(dir);
-    }
-
-    /* operate on directory if postorder (default) traversal */
-    if (!(fs->flags & fs·preorder))
-        fs->func(fs->data, fs->base, fs->path, &cwd);
-
-    if (!fs->lev)
-        forget(fs->hist);
-}
diff --git a/sys/base/fs/walker.c b/sys/base/fs/walker.c
deleted file mode 100644
index 65ff391..0000000
--- a/sys/base/fs/walker.c
+++ /dev/null
@@ -1,39 +0,0 @@
-#include "internal.h"
-
-static
-void
-delete(fs·History *h)
-{
-    SET_FREE(h, sys·Memory, nil);
-}
-
-int
-fs·init(fs·Walker *fs, char *path)
-{
-    fs->base = fs->end = fs->path;
-
-    if(!path || !path[0]){
-        path = getcwd(fs->path, arrlen(fs->path));
-        if (!path)
-            return 1;
-        fs->end += strlen(path);
-    }else
-        fs->end = str·copyn(fs->base, path, arrlen(fs->path));
-
-    if(fs->path[0] != '/')
-        fs->fd = AT_FDCWD;
-
-    if(!fs->hist && !(fs->flags & fs·nolinks))
-        fs->hist = calloc(1, sizeof(*fs->hist));
-
-    return 0;
-}
-
-void
-fs·fini(fs·Walker *fs)
-{
-    if(fs->hist){
-        delete(fs->hist);
-        free(fs->hist);
-    }
-}
diff --git a/sys/base/gz/flush.c b/sys/base/gz/flush.c
deleted file mode 100644
index 011a3ab..0000000
--- a/sys/base/gz/flush.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-error
-gz·flush(gz·Stream *s)
-{
-    return gzflush(s, Z_FINISH);
-}
diff --git a/sys/base/gz/get.c b/sys/base/gz/get.c
deleted file mode 100644
index 24ba23a..0000000
--- a/sys/base/gz/get.c
+++ /dev/null
@@ -1,17 +0,0 @@
-#include "internal.h"
-
-byte
-gz·getbyte(gz·Stream *s)
-{
-    // NOTE: Can't call macro
-    byte b[2];
-    gzread(s, b, 1);
-
-    return b[0];
-}
-
-error
-gz·ungetbyte(gz·Stream *s, byte c)
-{
-    return gzungetc(c, s);
-}
diff --git a/sys/base/gz/interface.c b/sys/base/gz/interface.c
deleted file mode 100644
index 15b8f10..0000000
--- a/sys/base/gz/interface.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-io·Reader     gz·Reader     = (io·Reader){ gz·read };
-io·Peeker     gz·Peeker     = (io·Peeker){ gz·getbyte, gz·ungetbyte };
-io·Seeker     gz·Seeker     = (io·Seeker){ gz·seek, gz·tell };
-io·PeekReader gz·Peekreader = (io·PeekReader){ gz·read, gz·getbyte, gz·ungetbyte };
-
-io·Writer     gz·Writer     = (io·Writer){ gz·write };
-io·Putter     gz·Putter     = (io·Putter){ gz·putbyte, gz·putstring };
-io·PutWriter  gz·PutWriter  = (io·PutWriter){ gz·write, gz·putbyte, gz·putstring };
-
-io·ReadWriter gz·ReadWriter = (io·ReadWriter){ gz·read, gz·write };
diff --git a/sys/base/gz/internal.h b/sys/base/gz/internal.h
deleted file mode 100644
index 6a268c4..0000000
--- a/sys/base/gz/internal.h
+++ /dev/null
@@ -1,6 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <base.h>
-
-#include <zlib.h>
diff --git a/sys/base/gz/open.c b/sys/base/gz/open.c
deleted file mode 100644
index c84ce5e..0000000
--- a/sys/base/gz/open.c
+++ /dev/null
@@ -1,13 +0,0 @@
-#include "internal.h"
-
-gz·Stream*
-gz·open(byte *path, byte *mode)
-{
-    return gzopen(path, mode);
-}
-
-error
-gz·close(gz·Stream* s)
-{
-    return gzclose(s);
-}
diff --git a/sys/base/gz/printf.c b/sys/base/gz/printf.c
deleted file mode 100644
index d7f75cf..0000000
--- a/sys/base/gz/printf.c
+++ /dev/null
@@ -1,15 +0,0 @@
-#include "internal.h"
-
-int
-gz·printf(gz·Stream *s, byte *fmt, ...)
-{
-    error err;
-
-    va_list args;
-    va_start(args, fmt);
-    err = gzprintf(s, fmt, args);
-    va_end(args);
-
-    return err;
-}
-
diff --git a/sys/base/gz/put.c b/sys/base/gz/put.c
deleted file mode 100644
index fa9807d..0000000
--- a/sys/base/gz/put.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-error
-gz·putbyte(gz·Stream *s, byte c)
-{
-    return gzputc(s, c);
-}
diff --git a/sys/base/gz/putstring.c b/sys/base/gz/putstring.c
deleted file mode 100644
index 64ff470..0000000
--- a/sys/base/gz/putstring.c
+++ /dev/null
@@ -1,8 +0,0 @@
-#include "internal.h"
-
-error
-gz·putstring(gz·Stream *s, byte *str)
-{
-    return gzputs(s, str);
-}
-
diff --git a/sys/base/gz/read.c b/sys/base/gz/read.c
deleted file mode 100644
index 112fe4d..0000000
--- a/sys/base/gz/read.c
+++ /dev/null
@@ -1,16 +0,0 @@
-#include "internal.h"
-
-int
-gz·read(gz·Stream *s, int sz, int n, void* buf)
-{
-    return gzread(s, buf, n*sz);
-}
-
-int
-gz·readln(gz·Stream *s, int n, byte *buf)
-{
-    byte* b;
-    b = gzgets(s, buf, n);
-
-    return strlen(b);
-}
diff --git a/sys/base/gz/rules.mk b/sys/base/gz/rules.mk
deleted file mode 100644
index a933291..0000000
--- a/sys/base/gz/rules.mk
+++ /dev/null
@@ -1,11 +0,0 @@
-SRCS_$(d)+=\
-	$(d)/gz/flush.c\
-	$(d)/gz/get.c\
-	$(d)/gz/interface.c\
-	$(d)/gz/open.c\
-	$(d)/gz/printf.c\
-	$(d)/gz/put.c\
-	$(d)/gz/putstring.c\
-	$(d)/gz/read.c\
-	$(d)/gz/seek.c\
-	$(d)/gz/write.c\
diff --git a/sys/base/gz/seek.c b/sys/base/gz/seek.c
deleted file mode 100644
index 328886d..0000000
--- a/sys/base/gz/seek.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-int
-gz·seek(gz·Stream *s, long off, enum SeekPos whence)
-{
-    return gzseek(s, off, whence);
-}
diff --git a/sys/base/gz/write.c b/sys/base/gz/write.c
deleted file mode 100644
index 862d833..0000000
--- a/sys/base/gz/write.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-int
-gz·write(gz·Stream *s, int sz, int n, void* buf)
-{
-    return gzwrite(s, buf, n*sz);
-}
diff --git a/sys/base/io/fd.c b/sys/base/io/fd.c
deleted file mode 100644
index ded1b02..0000000
--- a/sys/base/io/fd.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-int
-io·fd(io·Stream *s)
-{
-    return fileno(s);
-}
diff --git a/sys/base/io/flush.c b/sys/base/io/flush.c
deleted file mode 100644
index 0f1217a..0000000
--- a/sys/base/io/flush.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-int
-io·flush(io·Stream *s)
-{
-    return fflush(s);
-}
diff --git a/sys/base/io/get.c b/sys/base/io/get.c
deleted file mode 100644
index d4e52f8..0000000
--- a/sys/base/io/get.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-byte
-io·getbyte(io·Stream *s)
-{
-    return fgetc(s);
-}
diff --git a/sys/base/io/interface.c b/sys/base/io/interface.c
deleted file mode 100644
index bead9e1..0000000
--- a/sys/base/io/interface.c
+++ /dev/null
@@ -1,70 +0,0 @@
-#include "internal.h"
-
-static
-int
-·read(void *rdr, int size, int n, void *buf)
-{
-    return io·read((io·Stream *)rdr, size, n, buf);
-}
-
-static
-byte
-·get(void *rdr)
-{
-    return io·getbyte((io·Stream *)rdr);
-}
-
-static
-error
-·unget(void *rdr, byte c)
-{
-    return io·ungetbyte((io·Stream *)rdr, c);
-}
-
-static
-int
-·write(void *wtr, int sz, int n, void *buf)
-{
-    return io·write((io·Stream *)wtr, sz, n, buf);
-}
-
-static
-error
-·put(void *wtr, byte c)
-{
-    return io·putbyte((io·Stream *)wtr, c);
-}
-
-static
-int
-·puts(void *wtr, string s)
-{
-    return io·putstring((io·Stream *)wtr, s);
-}
-
-static
-int
-·seek(void *skr, long off, enum SeekPos whence)
-{
-    return io·seek((io·Stream *)skr, off, whence);
-}
-
-static
-long
-·tell(void *skr)
-{
-    return io·tell((io·Stream *)skr);
-}
-
-/* actual interfaces */
-io·Reader     sys·Reader     = (io·Reader){ ·read };
-io·Seeker     sys·Seeker     = (io·Seeker){ ·seek, ·tell };
-io·Peeker     sys·Peeker     = (io·Peeker){ ·get, ·unget };
-io·SeekReader sys·SeekReader = (io·SeekReader){ ·seek, ·tell, ·read };
-io·PeekReader sys·PeekReader = (io·PeekReader){ ·read, ·get, ·unget };
-
-io·Writer     sys·Writer     = (io·Writer){ ·write };
-io·Putter     sys·Putter     = (io·Putter){ ·put, ·puts };
-io·PutWriter  sys·PutWriter  = (io·PutWriter){ ·write, ·put, ·puts };
-
-io·ReadWriter sys·ReadWriter = (io·ReadWriter){ ·read, ·write };
diff --git a/sys/base/io/internal.h b/sys/base/io/internal.h
deleted file mode 100644
index 302c035..0000000
--- a/sys/base/io/internal.h
+++ /dev/null
@@ -1,4 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <base.h>
diff --git a/sys/base/io/open.c b/sys/base/io/open.c
deleted file mode 100644
index e50e334..0000000
--- a/sys/base/io/open.c
+++ /dev/null
@@ -1,13 +0,0 @@
-#include "internal.h"
-
-io·Stream*
-io·open(byte *name, byte *mode)
-{
-    return fopen(name, mode);
-}
-
-error
-io·close(io·Stream *s)
-{
-    return fclose(s);
-}
diff --git a/sys/base/io/putbyte.c b/sys/base/io/putbyte.c
deleted file mode 100644
index 2350a8d..0000000
--- a/sys/base/io/putbyte.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-int
-io·putbyte(io·Stream *s, byte c)
-{
-    return fputc(c, s);
-}
diff --git a/sys/base/io/putstring.c b/sys/base/io/putstring.c
deleted file mode 100644
index 53fa993..0000000
--- a/sys/base/io/putstring.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-int
-io·putstring(io·Stream *s, string str)
-{
-    return fputs(str, s);
-}
diff --git a/sys/base/io/read.c b/sys/base/io/read.c
deleted file mode 100644
index b0ed3d2..0000000
--- a/sys/base/io/read.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-int
-io·read(io·Stream *s, int sz, int n, void *buf)
-{
-    return fread(buf, sz, n, s);
-}
diff --git a/sys/base/io/readln.c b/sys/base/io/readln.c
deleted file mode 100644
index 283472d..0000000
--- a/sys/base/io/readln.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-int
-io·readln(io·Stream *s, int n, byte* buf)
-{
-    byte* b;
-    b = fgets(buf, n+1, s);
-    if(b == nil)
-        return -1;
-
-    return strlen(buf);
-}
diff --git a/sys/base/io/rules.mk b/sys/base/io/rules.mk
deleted file mode 100644
index 2e03ca5..0000000
--- a/sys/base/io/rules.mk
+++ /dev/null
@@ -1,14 +0,0 @@
-SRCS_$(d)+=\
-	$(d)/io/fd.c\
-	$(d)/io/flush.c\
-	$(d)/io/interface.c\
-	$(d)/io/open.c\
-	$(d)/io/putbyte.c\
-	$(d)/io/putstring.c\
-	$(d)/io/read.c\
-	$(d)/io/readln.c\
-	$(d)/io/seek.c\
-	$(d)/io/stat.c\
-	$(d)/io/tell.c\
-	$(d)/io/unget.c\
-	$(d)/io/write.c\
diff --git a/sys/base/io/seek.c b/sys/base/io/seek.c
deleted file mode 100644
index d0e7488..0000000
--- a/sys/base/io/seek.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-int
-io·seek(io·Stream *s, long off, enum SeekPos origin)
-{
-    return fseek(s, off, origin);
-}
diff --git a/sys/base/io/stat.c b/sys/base/io/stat.c
deleted file mode 100644
index d86f1ee..0000000
--- a/sys/base/io/stat.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-error
-io·stat(io·Stream *s, io·Stat *buf)
-{
-    return fstat(fileno(s), buf);
-}
diff --git a/sys/base/io/tell.c b/sys/base/io/tell.c
deleted file mode 100644
index 1c50439..0000000
--- a/sys/base/io/tell.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-long
-io·tell(io·Stream *s)
-{
-    return ftell(s);
-}
diff --git a/sys/base/io/unget.c b/sys/base/io/unget.c
deleted file mode 100644
index 5ec3536..0000000
--- a/sys/base/io/unget.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-error
-io·ungetbyte(io·Stream *s, byte c)
-{
-    return ungetc(c, s);
-}
diff --git a/sys/base/io/write.c b/sys/base/io/write.c
deleted file mode 100644
index 63df664..0000000
--- a/sys/base/io/write.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-int
-io·write(io·Stream *s, int sz, int n, void *buf)
-{
-    return fwrite(buf, sz, n, s);
-}
diff --git a/sys/base/mem/arena.c b/sys/base/mem/arena.c
deleted file mode 100644
index b2ce044..0000000
--- a/sys/base/mem/arena.c
+++ /dev/null
@@ -1,119 +0,0 @@
-#include "internal.h"
-
-#define ARENA_ALIGN 8
-#define ARENA_BLOCK_SIZE 1024 * 1024
-
-#define ALIGN_DOWN(n, a) ((n) & ~((a)-1))
-#define ALIGN_UP(n, a) ALIGN_DOWN((n) + (a)-1, (a))
-#define ALIGN_DOWN_PTR(p, a) ((void*)ALIGN_DOWN((uintptr)(p), (a)))
-#define ALIGN_UP_PTR(p, a) ((void*)ALIGN_UP((uintptr)(p), (a)))
-
-struct Block
-{
-    struct Block *next;
-    byte   buf[];
-};
-
-struct mem·Arena
-{
-    void  *heap;
-    mem·Allocator mem;
-
-    byte  *off;
-    byte  *end;
-    struct Block *curr;
-    struct Block first;
-};
-
-static
-void*
-·arenaalloc(void *heap, uint n, ulong size)
-{
-    return mem·arenaalloc(heap, n, size);
-}
-
-static
-void
-·arenafree(void *heap, void *ptr)
-{
-    /* no-op */
-}
-
-mem·Allocator mem·ArenaAllocator = {
-    .alloc = ·arenaalloc,
-    .free  = ·arenafree,
-};
-
-
-static
-void
-grow(mem·Arena *a, vlong min)
-{
-    uintptr size;
-    struct Block *blk;
-
-    size   = ALIGN_UP(MAX(min, ARENA_BLOCK_SIZE), ARENA_ALIGN);
-    blk    = a->mem.alloc(a->heap, 1, sizeof(*blk) + size);
-    a->off = blk->buf;
-    a->end = a->off + size;
-
-    assert(a->curr->next == nil);
-    assert(a->off == ALIGN_DOWN_PTR(a->off, ARENA_ALIGN));
-
-    a->curr->next = blk;
-    a->curr       = blk;
-}
-
-mem·Arena*
-mem·makearena(mem·Allocator from, void *impl)
-{
-    mem·Arena *a  = from.alloc(impl, 1, sizeof(*a) + ARENA_BLOCK_SIZE);
-    a->mem        = from;
-    a->heap       = impl;
-    a->off        = a->first.buf;
-    a->end        = a->first.buf + ARENA_BLOCK_SIZE;
-    a->curr       = &a->first;
-    a->first.next = nil;
-
-    return a;
-}
-
-void
-mem·freearena(mem·Arena *a)
-{
-    struct Block *it, *next;
-
-    it = a->first.next;
-    while (it != nil) {
-        next = it->next;
-        a->mem.free(a->heap, it);
-        it   = next;
-    }
-
-    a->mem.free(a->heap, a);
-}
-
-void*
-mem·arenaalloc(mem·Arena *a, uint n, ulong size)
-{
-    if(!n) {
-        return nil;
-    }
-
-    void *ptr;
-    // TODO(nnoll): check for overflow
-    size = n * size;
-
-    if (size > (ulong)(a->end - a->off)) {
-        grow(a, size);
-        assert(size <= (uintptr)(a->end - a->off));
-    }
-
-    ptr    = a->off;
-    a->off = ALIGN_UP_PTR(a->off + size, ARENA_ALIGN);
-
-    assert(a->off <= a->end);
-    assert(ptr == ALIGN_DOWN_PTR(ptr, ARENA_ALIGN));
-
-    return ptr;
-}
diff --git a/sys/base/mem/buffer.c b/sys/base/mem/buffer.c
deleted file mode 100644
index b684d35..0000000
--- a/sys/base/mem/buffer.c
+++ /dev/null
@@ -1,45 +0,0 @@
-#include "internal.h"
-
-/* Grow to particular size */
-void*
-·bufgrow(void* buf, vlong newLen, vlong eltsize)
-{
-    assert(bufcap(buf) <= (SIZE_MAX - 1) / 2);
-
-    vlong newCap = MAX(16, MAX(1 + 2 * bufcap(buf), newLen));
-
-    assert(newLen <= newCap);
-    assert(newCap <= (SIZE_MAX - offsetof(BufHdr, buf)) / eltsize);
-
-    vlong newSize = offsetof(BufHdr, buf) + newCap * eltsize;
-
-    BufHdr* newHdr;
-    if (buf) {
-        newHdr = bufhdr(buf);
-        newHdr = (BufHdr*)realloc((void*)newHdr, newSize);
-    } else {
-        newHdr      = (BufHdr*)malloc(newSize);
-        newHdr->len = 0;
-    }
-
-    newHdr->cap = newCap;
-    return (void*)newHdr->buf;
-}
-
-/* Pop out a value */
-void
-·bufdel(void *buf, int i, vlong eltsize)
-{
-    int n;
-    byte *b;
-    byte stk[1024];
-    assert(eltsize < sizeof(stk));
-
-    b = (byte*)buf;
-    if(n = buflen(buf), i < n) {
-        memcpy(stk, b+eltsize*i, eltsize);
-        memcpy(b+eltsize*i, b+eltsize*(i+1), eltsize*(n-i-1));
-        memcpy(b+eltsize*(n-1), stk, eltsize);
-    } 
-    bufhdr(buf)->len--;
-}
diff --git a/sys/base/mem/interface.c b/sys/base/mem/interface.c
deleted file mode 100644
index 4d7d1ce..0000000
--- a/sys/base/mem/interface.c
+++ /dev/null
@@ -1,36 +0,0 @@
-#include "internal.h"
-
-static
-void
-·free(void *_, void *ptr) {
-    return free(ptr);
-}
-
-static
-void *
-·alloc(void *_, uint n, ulong size) {
-    return malloc(n*size);
-}
-
-static
-void *
-·calloc(void *_, uint n, ulong size) {
-    return calloc(n, size);
-}
-
-static 
-void *
-·realloc(void *_, void *ptr, uint n, ulong size) {
-    return realloc(ptr, n*size);
-}
-
-mem·Allocator sys·Memory = {
-    .alloc   = ·calloc,
-    .free    = ·free
-};
-
-mem·Reallocator sys·FullMemory = {
-    .alloc   = ·calloc,
-    .realloc = ·realloc,
-    .free    = ·free
-};
diff --git a/sys/base/mem/internal.h b/sys/base/mem/internal.h
deleted file mode 100644
index 302c035..0000000
--- a/sys/base/mem/internal.h
+++ /dev/null
@@ -1,4 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <base.h>
diff --git a/sys/base/mem/rules.mk b/sys/base/mem/rules.mk
deleted file mode 100644
index b912d0c..0000000
--- a/sys/base/mem/rules.mk
+++ /dev/null
@@ -1,5 +0,0 @@
-SRCS_$(d)+=\
-	$(d)/mem/arena.c\
-	$(d)/mem/buffer.c\
-	$(d)/mem/interface.c\
-	$(d)/mem/set64.c\
diff --git a/sys/base/mem/set64.c b/sys/base/mem/set64.c
deleted file mode 100644
index 464b3ad..0000000
--- a/sys/base/mem/set64.c
+++ /dev/null
@@ -1,13 +0,0 @@
-#include "internal.h"
-
-void
-mem·set64(void *dst, uint64 val, uintptr size)
-{
-    intptr i;
-
-    for(i = 0; i < (size & (~7)); i += 8)
-        memcpy((byte*)dst + i, &val, 8);
-
-    for(; i < size; i++)
-        ((byte*)dst)[i] = ((byte*)&val)[i&7];
-}
diff --git a/sys/base/mmap/internal.h b/sys/base/mmap/internal.h
deleted file mode 100644
index 7606c7e..0000000
--- a/sys/base/mmap/internal.h
+++ /dev/null
@@ -1,5 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <base.h>
-#include <sys/mman.h>
diff --git a/sys/base/mmap/mmap.c b/sys/base/mmap/mmap.c
deleted file mode 100644
index ce3011c..0000000
--- a/sys/base/mmap/mmap.c
+++ /dev/null
@@ -1,39 +0,0 @@
-#include "internal.h"
-
-mmap·Reader
-mmap·open(byte *filename)
-{
-    int     fd;
-    int    err;
-    void  *buf;
-    io·Stream  *s;
-    io·Stat     st;
-
-    s   = io·open(filename, "r");
-    fd  = io·fd(s);
-    err = io·stat(s, &st);
-    if(err){
-        errorf("file stat: error code %d", err);
-        goto ERROR;
-    }
-
-    buf = mmap(nil, st.st_size, PROT_READ, MAP_SHARED, fd, 0);
-    if(!buf){
-        errorf("mmap: failed");
-        goto ERROR;
-    }
-    // NOTE: posix systems require that reference kept to mmap file after fd is closed
-    io·close(s);
-    return (mmap·Reader){.len=st.st_size, .b=buf};
-
-ERROR:
-    io·close(s);
-    return (mmap·Reader){ 0 };
-}
-
-error
-mmap·close(mmap·Reader rdr)
-{
-    munmap(rdr.b, rdr.len);
-    return 0;
-}
diff --git a/sys/base/mmap/rules.mk b/sys/base/mmap/rules.mk
deleted file mode 100644
index fb3cab5..0000000
--- a/sys/base/mmap/rules.mk
+++ /dev/null
@@ -1,2 +0,0 @@
-SRCS_$(d)+=\
-	$(d)/mmap/mmap.c\
diff --git a/sys/base/os/basename.c b/sys/base/os/basename.c
deleted file mode 100644
index b5bb343..0000000
--- a/sys/base/os/basename.c
+++ /dev/null
@@ -1,10 +0,0 @@
-#include "internal.h"
-
-char*
-os·basename(char *path)
-{
-    char *sep;
-
-    sep = strrchr(path, os·sep());
-    return (sep == nil) ? path : sep+1;
-}
diff --git a/sys/base/os/exists.c b/sys/base/os/exists.c
deleted file mode 100644
index a3c8935..0000000
--- a/sys/base/os/exists.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-int
-os·exists(byte *path, int flag)
-{
-    return access(path, flag) == 0;
-}
diff --git a/sys/base/os/internal.h b/sys/base/os/internal.h
deleted file mode 100644
index 302c035..0000000
--- a/sys/base/os/internal.h
+++ /dev/null
@@ -1,4 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <base.h>
diff --git a/sys/base/os/rules.mk b/sys/base/os/rules.mk
deleted file mode 100644
index bf1e71d..0000000
--- a/sys/base/os/rules.mk
+++ /dev/null
@@ -1,4 +0,0 @@
-SRCS_$(d)+=\
-	$(d)/os/basename.c\
-	$(d)/os/exists.c\
-	$(d)/os/sep.c\
diff --git a/sys/base/os/sep.c b/sys/base/os/sep.c
deleted file mode 100644
index 750e627..0000000
--- a/sys/base/os/sep.c
+++ /dev/null
@@ -1,14 +0,0 @@
-#include "internal.h"
-
-int
-os·sep(void)
-{
-#if defined(UNIX) || defined(__linux__)
-    return '/';
-#elif defined(WIN32)
-    return '\\';
-#else
-    panicf("unrecognized operating system");
-    return '\0';
-#endif
-}
diff --git a/sys/base/rng/base.c b/sys/base/rng/base.c
deleted file mode 100644
index 9ec496e..0000000
--- a/sys/base/rng/base.c
+++ /dev/null
@@ -1,24 +0,0 @@
-#include "internal.h"
-
-static uint64
-splitmix64(struct Mix *state)
-{
-    uint64 result = state->s;
-
-    state->s = result + 0x9E3779B97f4A7C15;
-    result = (result ^ (result >> 30)) * 0xBF58476D1CE4E5B9;
-    result = (result ^ (result >> 27)) * 0x94D049BB133111EB;
-    return result ^ (result >> 31);
-}
-
-int
-rng·init(uint64 seed)
-{
-    int i;
-    Mix smstate = {seed};
-
-    for(i=0; i < 4; i++)
-        rng·RNG.s[i] = splitmix64(&smstate);
-
-    return 0;
-}
diff --git a/sys/base/rng/bernoulli.c b/sys/base/rng/bernoulli.c
deleted file mode 100644
index 02f531e..0000000
--- a/sys/base/rng/bernoulli.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#include "internal.h"
-
-bool
-rng·bernoulli(double f)
-{
-    return rng·random() < f;
-}
diff --git a/sys/base/rng/exponential.c b/sys/base/rng/exponential.c
deleted file mode 100644
index c07e007..0000000
--- a/sys/base/rng/exponential.c
+++ /dev/null
@@ -1,11 +0,0 @@
-#include "internal.h"
-
-/* Returns a random float64 between 0 and 1 */
-double
-rng·exponential(double lambda)
-{
-    double f;
-
-    f = rng·random();
-    return -log(1 - f)/lambda;
-}
diff --git a/sys/base/rng/internal.h b/sys/base/rng/internal.h
deleted file mode 100644
index 9cf5f41..0000000
--- a/sys/base/rng/internal.h
+++ /dev/null
@@ -1,19 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <base.h>
-
-#define rol64(x, k) ((x) << (k) | ((x) >> (64-(k))))
-
-typedef struct Rng
-{
-    uint64 s[4];
-} Rng;
-
-typedef struct Mix
-{
-	uint64 s;
-} Mix;
-
-
-extern Rng rng·RNG;
diff --git a/sys/base/rng/normal.c b/sys/base/rng/normal.c
deleted file mode 100644
index aab5731..0000000
--- a/sys/base/rng/normal.c
+++ /dev/null
@@ -1,77 +0,0 @@
-#include "internal.h"
-
-static inline double
-erfinv(double x)
-{
-    /* useful constants */
-    static double
-      a0 = 1.1975323115670912564578e0, a1 = 4.7072688112383978012285e1,
-      a2 = 6.9706266534389598238465e2, a3 = 4.8548868893843886794648e3,
-      a4 = 1.6235862515167575384252e4, a5 = 2.3782041382114385731252e4,
-      a6 = 1.1819493347062294404278e4, a7 = 8.8709406962545514830200e2,
-
-      b0 = 1.0000000000000000000e0, b1 = 4.2313330701600911252e1,
-      b2 = 6.8718700749205790830e2, b3 = 5.3941960214247511077e3,
-      b4 = 2.1213794301586595867e4, b5 = 3.9307895800092710610e4,
-      b6 = 2.8729085735721942674e4, b7 = 5.2264952788528545610e3,
-
-      c0 = 1.42343711074968357734e0,  c1 = 4.63033784615654529590e0,
-      c2 = 5.76949722146069140550e0,  c3 = 3.64784832476320460504e0,
-      c4 = 1.27045825245236838258e0,  c5 = 2.41780725177450611770e-1,
-      c6 = 2.27238449892691845833e-2, c7 = 7.74545014278341407640e-4,
-
-      d0 = 1.4142135623730950488016887e0,  d1 = 2.9036514445419946173133295e0,
-      d2 = 2.3707661626024532365971225e0,  d3 = 9.7547832001787427186894837e-1,
-      d4 = 2.0945065210512749128288442e-1, d5 = 2.1494160384252876777097297e-2,
-      d6 = 7.7441459065157709165577218e-4, d7 = 1.4859850019840355905497876e-9,
-
-      e0 = 6.65790464350110377720e0,  e1 = 5.46378491116411436990e0,
-      e2 = 1.78482653991729133580e0,  e3 = 2.96560571828504891230e-1,
-      e4 = 2.65321895265761230930e-2, e5 = 1.24266094738807843860e-3,
-      e6 = 2.71155556874348757815e-5, e7 = 2.01033439929228813265e-7,
-
-      f0 = 1.414213562373095048801689e0,  f1 = 8.482908416595164588112026e-1,
-      f2 = 1.936480946950659106176712e-1, f3 = 2.103693768272068968719679e-2,
-      f4 = 1.112800997078859844711555e-3, f5 = 2.611088405080593625138020e-5,
-      f6 = 2.010321207683943062279931e-7, f7 = 2.891024605872965461538222e-15,
-
-      Ln2 = 0.693147180559945309417232121458176568075500134360255254120680009;
-
-    int s;
-    double r, z1, z2;
-
-    if(x < 0) {
-        s = -1;
-        x = -x;
-    } else {
-        s = +1;
-    }
-
-    if(x <= 0.85) {
-        r = 0.180625 - 0.25*x*x;
-        z1 = ((((((a7*r+a6)*r+a5)*r+a4)*r+a3)*r+a2)*r+a1)*r + a0;
-        z2 = ((((((b7*r+b6)*r+b5)*r+b4)*r+b3)*r+b2)*r+b1)*r + b0;
-        return s*(x*z1) / z2;
-    }
-    r = sqrt(Ln2 - log(1.0-x));
-    if(r <= 5.0) {
-        r -= 1.6;
-        z1 = ((((((c7*r+c6)*r+c5)*r+c4)*r+c3)*r+c2)*r+c1)*r + c0;
-        z2 = ((((((d7*r+d6)*r+d5)*r+d4)*r+d3)*r+d2)*r+d1)*r + d0;
-    } else {
-        r -= 5.0;
-        z1 = ((((((e7*r+e6)*r+e5)*r+e4)*r+e3)*r+e2)*r+e1)*r + e0;
-        z2 = ((((((f7*r+f6)*r+f5)*r+f4)*r+f3)*r+f2)*r+f1)*r + f0;
-    }
-
-    return s*z1/z2;
-}
-
-double
-rng·normal(void)
-{
-    double f;
-    f = rng·random();
-
-    return sqrt(2)*erfinv(2*f-1);
-}
diff --git a/sys/base/rng/poisson.c b/sys/base/rng/poisson.c
deleted file mode 100644
index 3ec15c9..0000000
--- a/sys/base/rng/poisson.c
+++ /dev/null
@@ -1,126 +0,0 @@
-#include "internal.h"
-
-/*
- * Ahrens, J. H., & Dieter, U. (1982).
- * Computer Generation of Poisson Deviates from Modified Normal Distributions.
- */
-static double factorial[10] = {1., 1., 2., 6., 24., 120., 720., 5040., 40320., 362880.};
-static double coeffs[9] = {
-    -.500000000, +.333333333, -.249999856,
-    +.200011780, -.166684875, +.142187833,
-    -.124196313, +.125005956, -.114265030,
-};
-
-static inline
-double
-log1pmx(double x, double off)
-{
-    int i;
-    double r, t;
-
-    if(-0.25 < x && x < 0.25) {
-        r = 0;
-        t = 1;
-        for(i=0;i<arrlen(coeffs);i++) {
-            r += coeffs[i]*t;
-            t *= x;
-        }
-
-        return x*x*r;
-    }
-    return log(1+x) - off;
-}
-
-static inline
-double
-procf(double mu, double s, int64 K, double *px, double *py, double *fx, double *fy)
-{
-    double d, V, X;
-    double w, b1, b2, c1, c2, c3, c0, c;
-
-    w  = 0.3989422804014327/s;
-    b1 = 0.041666666666666664/mu;
-    b2 = 0.3*b1*b1;
-    c3 = 0.14285714285714285*b1*b2;
-    c2 = b2 - 15.*c3;
-    c1 = b1 - 6.*b2 + 45.*c3;
-    c0 = 1 - b1 + 3.*b2 - 15.*c3;
-    c  = .1069/mu;
-
-    if(K < 10) {
-        *px = -mu;
-        *py = pow(mu,K) / factorial[K];
-    }else{
-        d = 0.08333333333333333/K;
-        d = d - 4.8*d*d*d;
-        V = (mu - K) / K;
-
-        *px = K*log1pmx(V,mu-K) - d;
-        *py = 0.3989422804014327/sqrt(K);
-    }
-
-    X = (K - mu + 0.5)/s;
-    *fx = -0.5*X*X;
-    *fy = w*(((c3*X*X + c2)*X*X + c1)*X*X + c0);
-
-    return c;
-}
-
-static inline
-uint64
-bigpoisson(double mu)
-{
-    int64  L,K;
-    double G,s,d,U,E,T;
-    double px,py,fx,fy,c;
-
-    s = sqrt(mu);
-    d = 6*mu*mu;
-    L = floor(mu - 1.1484);
-
-stepN:
-    G = mu + s*rng·normal();
-    K = floor(G);
-    if(K<0)
-        goto stepP;
-stepI:
-    if(K>=L)
-        return K;
-stepS:
-    U = rng·random();
-    if(d*U >= (mu-K)*(mu-K)*(mu-K))
-        return K;
-stepP:
-    if(G < 0)
-        goto stepE;
-stepQ:
-    c = procf(mu, s, K, &px, &py, &fx, &fy);
-stepE:
-    E = rng·exponential(1.0);
-    U = rng·random();
-    U = U + U - 1;
-    T = 1.8 + copysign(E,U);
-    if(T < 0.6744)
-        goto stepE;
-    K = floor(mu + s*T);
-    c = procf(mu, s, K, &px, &py, &fx, &fy);
-stepH:
-    if(c*fabs(U) > (py*exp(px + E) - fy*exp(fx + E)))
-        goto stepE;
-    return K;
-}
-
-uint64
-rng·poisson(double mean)
-{
-    int64  n;
-    double z;
-
-    if(mean<10.0) {
-        for(n=0, z=rng·exponential(1.0); z<mean; ++n, z+=rng·exponential(1.0))
-            ;
-        return n;
-    }
-
-    return bigpoisson(mean);
-}
diff --git a/sys/base/rng/random.c b/sys/base/rng/random.c
deleted file mode 100644
index bd1bd6b..0000000
--- a/sys/base/rng/random.c
+++ /dev/null
@@ -1,33 +0,0 @@
-#include "internal.h"
-
-static uint64
-xoshiro256ss(Rng *state)
-{
-    uint64 *s     = state->s;
-    uint64 result = rol64(s[1] * 5, 7) * 9;
-    uint64 t      = s[1] << 17;
-
-    s[2] ^= s[0];
-    s[3] ^= s[1];
-    s[1] ^= s[2];
-    s[0] ^= s[3];
-
-    s[2] ^= t;
-    s[3] = rol64(s[3], 45);
-
-    return result;
-}
-
-double
-rng·random(void)
-{
-    uint64 r = xoshiro256ss(&rng·RNG);
-    return (double)r / (double)UINT64_MAX;
-}
-
-uint64
-rng·randi(int max)
-{
-    uint64 r = xoshiro256ss(&rng·RNG);
-    return r % max;
-}
diff --git a/sys/base/rng/rules.mk b/sys/base/rng/rules.mk
deleted file mode 100644
index 407b1bf..0000000
--- a/sys/base/rng/rules.mk
+++ /dev/null
@@ -1,7 +0,0 @@
-SRCS_$(d)+=\
-	$(d)/rng/base.c\
-	$(d)/rng/bernoulli.c\
-	$(d)/rng/exponential.c\
-	$(d)/rng/normal.c\
-	$(d)/rng/poisson.c\
-	$(d)/rng/random.c\
diff --git a/sys/base/rules.mk b/sys/base/rules.mk
deleted file mode 100644
index 1726aa3..0000000
--- a/sys/base/rules.mk
+++ /dev/null
@@ -1,36 +0,0 @@
-include share/push.mk
-
-# Iterate through subdirectory tree
-
-# Local sources
-SRCS_$(d) := $(d)/arg.c
-include $(d)/bufio/rules.mk
-include $(d)/coro/rules.mk
-include $(d)/error/rules.mk
-include $(d)/flate/rules.mk
-include $(d)/fs/rules.mk
-include $(d)/gz/rules.mk
-include $(d)/io/rules.mk
-include $(d)/mem/rules.mk
-include $(d)/mmap/rules.mk
-include $(d)/os/rules.mk
-include $(d)/rng/rules.mk
-include $(d)/sort/rules.mk
-include $(d)/string/rules.mk
-
-
-TSTS_$(d) := $(d)/test.c
-
-LIBS_$(d) := $(d)/base.a
-BINS_$(d) :=
-
-include share/paths.mk
-
-$(LIBS_$(d)): $(OBJS_$(d))
-	$(ARCHIVE)
-
-$(UNTS_$(d)): TCLIBS := $(LIBS_$(d))
-$(UNTS_$(d)): $(TOBJS_$(d)) $(LIBS_$(d))
-	$(LINK)
-
-include share/pop.mk
diff --git a/sys/base/sort/double.c b/sys/base/sort/double.c
deleted file mode 100644
index c3feac2..0000000
--- a/sys/base/sort/double.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-void
-sort·double(uintptr sz, double arr[])
-{
-    double tmp;
-#define LESS(i, j) (arr[i] < arr[j])
-#define SWAP(i, j) (tmp = arr[i], arr[i] = arr[j], arr[j] = tmp)
-    QSORT(sz, LESS, SWAP);
-#undef SWAP
-#undef LESS
-}
diff --git a/sys/base/sort/float.c b/sys/base/sort/float.c
deleted file mode 100644
index 57bd482..0000000
--- a/sys/base/sort/float.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-void
-sort·float(uintptr sz, float arr[])
-{
-    float tmp;
-#define LESS(i, j) (arr[i] < arr[j])
-#define SWAP(i, j) (tmp = arr[i], arr[i] = arr[j], arr[j] = tmp)
-    QSORT(sz, LESS, SWAP);
-#undef SWAP
-#undef LESS
-}
diff --git a/sys/base/sort/int.c b/sys/base/sort/int.c
deleted file mode 100644
index 33e1def..0000000
--- a/sys/base/sort/int.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-void
-sort·int(uintptr sz, int arr[])
-{
-    int tmp;
-#define LESS(i, j) (arr[i] < arr[j])
-#define SWAP(i, j) (tmp = arr[i], arr[i] = arr[j], arr[j] = tmp)
-    QSORT(sz, LESS, SWAP);
-#undef SWAP
-#undef LESS
-}
diff --git a/sys/base/sort/int16.c b/sys/base/sort/int16.c
deleted file mode 100644
index 072a3eb..0000000
--- a/sys/base/sort/int16.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-void
-sort·int16(uintptr sz, int16 arr[])
-{
-    int16 tmp;
-#define LESS(i, j) (arr[i] < arr[j])
-#define SWAP(i, j) (tmp = arr[i], arr[i] = arr[j], arr[j] = tmp)
-    QSORT(sz, LESS, SWAP);
-#undef SWAP
-#undef LESS
-}
diff --git a/sys/base/sort/int32.c b/sys/base/sort/int32.c
deleted file mode 100644
index 27b3b7b..0000000
--- a/sys/base/sort/int32.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-void
-sort·int32(uintptr sz, int32 arr[])
-{
-    int32 tmp;
-#define LESS(i, j) (arr[i] < arr[j])
-#define SWAP(i, j) (tmp = arr[i], arr[i] = arr[j], arr[j] = tmp)
-    QSORT(sz, LESS, SWAP);
-#undef SWAP
-#undef LESS
-}
diff --git a/sys/base/sort/int64.c b/sys/base/sort/int64.c
deleted file mode 100644
index b3fa5d4..0000000
--- a/sys/base/sort/int64.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-void
-sort·int64(uintptr sz, int64 arr[])
-{
-    int64 tmp;
-#define LESS(i, j) (arr[i] < arr[j])
-#define SWAP(i, j) (tmp = arr[i], arr[i] = arr[j], arr[j] = tmp)
-    QSORT(sz, LESS, SWAP);
-#undef SWAP
-#undef LESS
-}
diff --git a/sys/base/sort/int8.c b/sys/base/sort/int8.c
deleted file mode 100644
index 5848e6e..0000000
--- a/sys/base/sort/int8.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-void
-sort·int8(uintptr sz, int8 arr[])
-{
-    int8 tmp;
-#define LESS(i, j) (arr[i] < arr[j])
-#define SWAP(i, j) (tmp = arr[i], arr[i] = arr[j], arr[j] = tmp)
-    QSORT(sz, LESS, SWAP);
-#undef SWAP
-#undef LESS
-}
diff --git a/sys/base/sort/internal.h b/sys/base/sort/internal.h
deleted file mode 100644
index ac569de..0000000
--- a/sys/base/sort/internal.h
+++ /dev/null
@@ -1,5 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <base.h>
-#include <base/macro/qsort.h>
diff --git a/sys/base/sort/rules.mk b/sys/base/sort/rules.mk
deleted file mode 100644
index 780d6ea..0000000
--- a/sys/base/sort/rules.mk
+++ /dev/null
@@ -1,14 +0,0 @@
-SRCS_$(d)+=\
-	$(d)/sort/double.c\
-	$(d)/sort/float.c\
-	$(d)/sort/int.c\
-	$(d)/sort/int16.c\
-	$(d)/sort/int32.c\
-	$(d)/sort/int64.c\
-	$(d)/sort/int8.c\
-	$(d)/sort/string.c\
-	$(d)/sort/uint.c\
-	$(d)/sort/uint16.c\
-	$(d)/sort/uint32.c\
-	$(d)/sort/uint64.c\
-	$(d)/sort/uint8.c\
diff --git a/sys/base/sort/string.c b/sys/base/sort/string.c
deleted file mode 100644
index b511efa..0000000
--- a/sys/base/sort/string.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-void
-sort·string(uintptr sz, byte* arr[])
-{
-    byte *tmp;
-#define LESS(i, j) (strcmp(arr[i], arr[j]) < 0)
-#define SWAP(i, j) (tmp = arr[i], arr[i] = arr[j], arr[j] = tmp)
-    QSORT(sz, LESS, SWAP);
-#undef SWAP
-#undef LESS
-}
diff --git a/sys/base/sort/uint.c b/sys/base/sort/uint.c
deleted file mode 100644
index 5b27330..0000000
--- a/sys/base/sort/uint.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-void
-sort·uint(uintptr sz, uint arr[])
-{
-    uint tmp;
-#define LESS(i, j) (arr[i] < arr[j])
-#define SWAP(i, j) (tmp = arr[i], arr[i] = arr[j], arr[j] = tmp)
-    QSORT(sz, LESS, SWAP);
-#undef SWAP
-#undef LESS
-}
diff --git a/sys/base/sort/uint16.c b/sys/base/sort/uint16.c
deleted file mode 100644
index 2b635b4..0000000
--- a/sys/base/sort/uint16.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-void
-sort·uint16(uintptr sz, uint16 arr[])
-{
-    uint16 tmp;
-#define LESS(i, j) (arr[i] < arr[j])
-#define SWAP(i, j) (tmp = arr[i], arr[i] = arr[j], arr[j] = tmp)
-    QSORT(sz, LESS, SWAP);
-#undef SWAP
-#undef LESS
-}
diff --git a/sys/base/sort/uint32.c b/sys/base/sort/uint32.c
deleted file mode 100644
index 99a58cf..0000000
--- a/sys/base/sort/uint32.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-void
-sort·uint32(uintptr sz, uint32 arr[])
-{
-    uint32 tmp;
-#define LESS(i, j) (arr[i] < arr[j])
-#define SWAP(i, j) (tmp = arr[i], arr[i] = arr[j], arr[j] = tmp)
-    QSORT(sz, LESS, SWAP);
-#undef SWAP
-#undef LESS
-}
diff --git a/sys/base/sort/uint64.c b/sys/base/sort/uint64.c
deleted file mode 100644
index 2769825..0000000
--- a/sys/base/sort/uint64.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-void
-sort·uint64(uintptr sz, uint64 arr[])
-{
-    uint64 tmp;
-#define LESS(i, j) (arr[i] < arr[j])
-#define SWAP(i, j) (tmp = arr[i], arr[i] = arr[j], arr[j] = tmp)
-    QSORT(sz, LESS, SWAP);
-#undef SWAP
-#undef LESS
-}
diff --git a/sys/base/sort/uint8.c b/sys/base/sort/uint8.c
deleted file mode 100644
index ff02b3c..0000000
--- a/sys/base/sort/uint8.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-void
-sort·uint8(uintptr sz, uint8 arr[])
-{
-    uint8 tmp;
-#define LESS(i, j) (arr[i] < arr[j])
-#define SWAP(i, j) (tmp = arr[i], arr[i] = arr[j], arr[j] = tmp)
-    QSORT(sz, LESS, SWAP);
-#undef SWAP
-#undef LESS
-}
diff --git a/sys/base/string/append.c b/sys/base/string/append.c
deleted file mode 100644
index d4d0396..0000000
--- a/sys/base/string/append.c
+++ /dev/null
@@ -1,53 +0,0 @@
-#include "internal.h"
-
-// append will append the given null terminated c string to the string data
-// structure. this variant can append a substring of length len of the given
-// string to our buffer. the result is reallocated if not enough room is present
-// in the buffer.
-int
-str·appendlen(string *s, vlong n, const byte* b)
-{
-    /*
-    bl = strlen(b);
-    if (n > bl) panicf("attempted to make a substring longer than string");
-    */
-
-    str·grow(s, n);
-    if(*s == nil)
-        return 0;
-
-    Hdr* h = (Hdr*)(*s - sizeof(Hdr));
-
-    memcpy(*s + str·len(*s), b, n);
-    h->len += n;
-   (*s)[h->len] = '\0';
-
-   return n;
-}
-
-// append will append the given null terminated c string to the string data
-// structure. this variant will append the entire string.
-int
-str·append(string *s, const byte* b)
-{
-    return str·appendlen(s, strlen(b), b);
-}
-
-// appendbyte will append the given byte to our string.
-// NOTE: as the byte is on the stack, it is not null-terminated.
-// can not pass to the above functions.
-int
-str·appendbyte(string *s, const byte b)
-{
-    str·grow(s, 1);
-    if(*s == nil)
-        return 0;
-
-    Hdr* h = (Hdr*)(*s - sizeof(Hdr));
-
-    *(*s + str·len(*s)) = b;
-    h->len++;
-    (*s)[h->len] = '\0'; // NOTE: I don't think an explicit zero is required..?
-
-    return 1;
-}
diff --git a/sys/base/string/appendf.c b/sys/base/string/appendf.c
deleted file mode 100644
index 4b8d76c..0000000
--- a/sys/base/string/appendf.c
+++ /dev/null
@@ -1,31 +0,0 @@
-#include "internal.h"
-
-/*
- * appendf will append the given formatted string to our buffer.
- * returns the newly minted string
- */
-
-int
-str·appendf(string *s, const byte* fmt, ...)
-{
-    va_list args;
-    va_start(args, fmt);
-    int remain = str·cap(*s) - str·len(*s);
-    int n      = vsnprintf(*s + str·len(*s), remain + 1, fmt, args);
-    va_end(args);
-
-    if(n > remain){
-        // If the first write was incomplete, we overwite the data again.
-        str·grow(s, n);
-        va_list args;
-        va_start(args, fmt);
-        n = vsnprintf(*s + str·len(*s), n + 1, fmt, args);
-        assert(n - remain <= str·cap(*s));
-        va_end(args);
-    }
-
-    Hdr* h = (Hdr*)(*s - sizeof(Hdr));
-    h->len += n;
-
-    return n;
-}
diff --git a/sys/base/string/clear.c b/sys/base/string/clear.c
deleted file mode 100644
index 986f809..0000000
--- a/sys/base/string/clear.c
+++ /dev/null
@@ -1,9 +0,0 @@
-#include "internal.h"
-
-void
-str·clear(string *s)
-{
-    Hdr* h = (Hdr*)(*s - sizeof(Hdr));
-    h->len     = 0;
-    *s[0]      = '\0';
-}
diff --git a/sys/base/string/copyn.c b/sys/base/string/copyn.c
deleted file mode 100644
index 09c2879..0000000
--- a/sys/base/string/copyn.c
+++ /dev/null
@@ -1,11 +0,0 @@
-#include "internal.h"
-
-char *
-str·copyn(char *dst, char *src, int n)
-{
-    while(*src && n-- > 0)
-        *dst++ = *src++;
-
-    *dst = 0;
-    return dst;
-}
diff --git a/sys/base/string/equals.c b/sys/base/string/equals.c
deleted file mode 100644
index a975cf5..0000000
--- a/sys/base/string/equals.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-// Equals returns true if string s and t are equivalent.
-bool
-str·equals(const string s, const string t)
-{
-    vlong sL = str·len(s);
-    vlong tL = str·len(t);
-    if (sL != tL) return false;
-
-    return memcmp(s, t, sL) == 0;
-}
diff --git a/sys/base/string/find.c b/sys/base/string/find.c
deleted file mode 100644
index 20f990e..0000000
--- a/sys/base/string/find.c
+++ /dev/null
@@ -1,11 +0,0 @@
-#include "internal.h"
-
-// find will find the first occurence of
-// substr in the string returns -1 if nothing was found.
-int
-str·find(string s, const byte* substr)
-{
-    byte* loc = strstr(s, substr);
-    if (loc == nil) return -1;
-    return (int)(loc - s);
-}
diff --git a/sys/base/string/fit.c b/sys/base/string/fit.c
deleted file mode 100644
index 56ab041..0000000
--- a/sys/base/string/fit.c
+++ /dev/null
@@ -1,20 +0,0 @@
-#include "internal.h"
-
-// fit reallocates the string such that the buffer is exactly sized for the
-// buffer. if the capacity equals the length, then the function is a noop. the
-// byte array is unchanged.
-void
-str·fit(string *s)
-{
-    Hdr* h;
-    vlong  cap = str·cap(*s);
-    vlong  len = str·len(*s);
-
-    if (cap == len) return;
-
-    h      = (Hdr*)(s - sizeof(Hdr));
-    h      = realloc(h, sizeof(*h) + len + 1);
-    h->cap = len;
-
-    *s     = h->buf;
-}
diff --git a/sys/base/string/free.c b/sys/base/string/free.c
deleted file mode 100644
index 7b5ee98..0000000
--- a/sys/base/string/free.c
+++ /dev/null
@@ -1,8 +0,0 @@
-#include "internal.h"
-
-// free returns memory associated to the buffer.
-void
-str·free(string s)
-{
-    free(s - sizeof(Hdr));
-}
diff --git a/sys/base/string/grow.c b/sys/base/string/grow.c
deleted file mode 100644
index 39a9d2f..0000000
--- a/sys/base/string/grow.c
+++ /dev/null
@@ -1,33 +0,0 @@
-#include "internal.h"
-
-// grow ensures that the string can encompass at least delta bytes.
-// if it already can, this is a no op.
-// if it can't, the string will be reallocated.
-void
-str·grow(string *s, vlong delta)
-{
-    Hdr *h, *newh;
-    vlong cap = str·cap(*s);
-    vlong len = str·len(*s);
-    assert(cap >= len); // To prevent unsigned behavior
-
-    if (cap - len >= delta) return;
-
-    h = (Hdr*)(*s - sizeof(Hdr));
-
-    vlong newCap = cap + delta;
-    assert(newCap >= cap); // To prevent unsigned behavior
-    if (newCap < MAX_STRING_ALLOC) {
-        newCap *= 2;
-    } else
-        newCap += MAX_STRING_ALLOC;
-
-    newh = (Hdr*)realloc(h, sizeof(*h) + newCap + 1);
-    if (newh == nil) return;
-
-    memset(newh->buf + len, '\0', newCap - len);
-    newh->cap = newCap;
-    newh->len = len;
-
-    *s = newh->buf;
-}
diff --git a/sys/base/string/internal.h b/sys/base/string/internal.h
deleted file mode 100644
index 8c16c64..0000000
--- a/sys/base/string/internal.h
+++ /dev/null
@@ -1,12 +0,0 @@
-#pragma once
-#include <u.h>
-#include <base.h>
-
-#define MAX_STRING_ALLOC 1024 * 1024
-
-typedef struct Hdr
-{
-    vlong len;
-    vlong cap;
-    byte  buf[];
-} Hdr;
diff --git a/sys/base/string/join.c b/sys/base/string/join.c
deleted file mode 100644
index fb97b6c..0000000
--- a/sys/base/string/join.c
+++ /dev/null
@@ -1,16 +0,0 @@
-#include "internal.h"
-
-string
-str·join(vlong len, byte** fields, const byte* sep)
-{
-    string s = str·makecap("", 0, 10);
-    int    j = 0;
-
-    for (j = 0; j < len; j++) {
-        str·append(&s, fields[j]);
-        if (j < len - 1) 
-            str·appendlen(&s, 1, sep);
-    }
-
-    return s;
-}
diff --git a/sys/base/string/len.c b/sys/base/string/len.c
deleted file mode 100644
index 5e42919..0000000
--- a/sys/base/string/len.c
+++ /dev/null
@@ -1,17 +0,0 @@
-#include "internal.h"
-
-// len returns the length of the string.
-int
-str·len(const string s)
-{
-    Hdr* h = (Hdr*)(s - sizeof(Hdr));
-    return h->len;
-}
-
-// cap returns the capacity of the string buffer.
-int
-str·cap(const string s)
-{
-    Hdr* h = (Hdr*)(s - sizeof(Hdr));
-    return h->cap;
-}
diff --git a/sys/base/string/lower.c b/sys/base/string/lower.c
deleted file mode 100644
index c6935f8..0000000
--- a/sys/base/string/lower.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-// lower will force all runes in the string to be lowercase
-void
-str·lower(string s)
-{
-    byte *b, *e;
-    b = s;
-    e = b + str·len(s);
-    while (b++ != e)
-        *b = tolower(*b);
-}
diff --git a/sys/base/string/make.c b/sys/base/string/make.c
deleted file mode 100644
index eb71543..0000000
--- a/sys/base/string/make.c
+++ /dev/null
@@ -1,53 +0,0 @@
-#include "internal.h"
-
-// new returns a new dynamic string object, initialized from the given c string.
-// len defines the length of the c substring that we will copy into our buffer.
-// the backing buffer will have capacity cap.
-string
-str·makecap(const byte *s, vlong len, vlong cap)
-{
-    struct Hdr* h;
-
-    h = malloc(sizeof(*h) + cap + 1);
-    if (s == nil) memset(h, 0, sizeof(*h));
-
-    if (h == nil) return nil; // Allocation failed.
-
-    h->len = (s == nil) ? 0 : len;
-    h->cap = cap;
-
-    if (cap < h->len) goto cleanup;
-
-    if (s != nil && cap > 0) {
-        memcpy(h->buf, s, h->len);
-        memset(h->buf + h->len, '\0', h->cap - h->len + 1);
-    }
-
-    return h->buf;
-
-cleanup:
-    free(h);
-    panicf("Attempted to create a string with less capacity than length");
-    return nil;
-}
-
-// new returns a new dynamic string object, initialized from the given c string.
-// the backing buffer capacity is equivalent to the string length.
-string
-str·makelen(const byte *s, vlong len)
-{
-    vlong sl = (!s) ? 0 : strlen(s);
-    if (sl < len) panicf("attempted to take a bigger substring than string length");
-
-    vlong cap = (len == 0) ? 1 : len;
-    return str·makecap(s, len, cap);
-}
-
-// new returns a new dynamic string object, initialized from the given c string.
-// the backing buffer capacity is equivalent to the string length.
-string
-str·make(const byte *s)
-{
-    vlong len = (!s) ? 0 : strlen(s);
-    return str·makelen(s, len);
-}
diff --git a/sys/base/string/makef.c b/sys/base/string/makef.c
deleted file mode 100644
index 8fb9c38..0000000
--- a/sys/base/string/makef.c
+++ /dev/null
@@ -1,25 +0,0 @@
-#include "internal.h"
-
-// Newf returns a new dynamic string object
-string
-str·makef(const byte *fmt, ...)
-{
-    vlong  n;
-    string s;
-    va_list args;
-
-    va_start(args, fmt);
-    n = vsnprintf(nil, 0, fmt, args);
-    va_end(args);
-
-    s = str·makecap(nil, 0, n);
-
-    va_start(args, fmt);
-    vsnprintf(s, n + 1, fmt, args);
-    va_end(args);
-
-    Hdr* h = (Hdr*)(s - sizeof(Hdr));
-    h->len = n;
-
-    return s;
-}
diff --git a/sys/base/string/read.c b/sys/base/string/read.c
deleted file mode 100644
index df2028f..0000000
--- a/sys/base/string/read.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-int
-str·read(string s, int size, int n, void *buf)
-{
-    int len;
-
-    len = MIN(n * size, str·len(s));
-    memcpy(buf, s, len);
-
-    return len;
-}
diff --git a/sys/base/string/replace.c b/sys/base/string/replace.c
deleted file mode 100644
index 127daed..0000000
--- a/sys/base/string/replace.c
+++ /dev/null
@@ -1,26 +0,0 @@
-#include "internal.h"
-
-// replace will replace all occurences of the given bytes 'from' to bytes 'to'
-// edits are done in place and modify the string.
-// NOTE:  as of now strings from and to must be the same size.
-void
-str·replace(string s, const byte* from, const byte* to)
-{
-    vlong fromL = strlen(from);
-    vlong toL   = strlen(to);
-    if (toL != fromL) { panicf("different sized replacement string not supported"); }
-
-    vlong l = str·len(s);
-    vlong i = l;
-    vlong j = l;
-
-    for (i = 0; i < l; i++) {
-        for (j = 0; j < toL; j++) {
-            if (s[i] == from[j]) {
-                s[i] = to[j];
-                break;
-            }
-        }
-    }
-}
-
diff --git a/sys/base/string/rules.mk b/sys/base/string/rules.mk
deleted file mode 100644
index e517ca5..0000000
--- a/sys/base/string/rules.mk
+++ /dev/null
@@ -1,19 +0,0 @@
-SRCS_$(d)+=\
-	$(d)/string/append.c\
-	$(d)/string/appendf.c\
-	$(d)/string/clear.c\
-	$(d)/string/copyn.c\
-	$(d)/string/equals.c\
-	$(d)/string/find.c\
-	$(d)/string/fit.c\
-	$(d)/string/free.c\
-	$(d)/string/grow.c\
-	$(d)/string/join.c\
-	$(d)/string/len.c\
-	$(d)/string/lower.c\
-	$(d)/string/make.c\
-	$(d)/string/makef.c\
-	$(d)/string/read.c\
-	$(d)/string/replace.c\
-	$(d)/string/split.c\
-	$(d)/string/upper.c\
diff --git a/sys/base/string/split.c b/sys/base/string/split.c
deleted file mode 100644
index 2aa68b4..0000000
--- a/sys/base/string/split.c
+++ /dev/null
@@ -1,39 +0,0 @@
-#include "internal.h"
-
-// split will split the string by the given token.
-// returns a stretchy buffer of strings that result from the partition.
-// it is the caller's responsibility to clean the memory.
-string*
-str·split(string s, const byte* tok)
-{
-    string* fields = nil;
-    vlong start  = 0;
-
-    vlong sL   = str·len(s);
-    vlong tokL = strlen(tok);
-    if (sL == 0 || tokL == 0) return nil;
-
-    buffit(fields, 5);
-
-    for (vlong i = 0; i < sL - tokL; i++) {
-        if ((tokL == 1 && s[i] == tokL) || !memcmp(s + i, tok, tokL)) {
-            bufpush(fields, str·makelen(s + start, i - start));
-            if (fields[buflen(fields) - 1] == nil) goto cleanup;
-
-            start = i + tokL;
-            i += tokL - 1;
-        }
-    }
-
-    bufpush(fields, str·makelen(s + start, sL - start));
-
-    return fields;
-
-cleanup:
-    for (vlong i = 0; i < buflen(fields); i++) {
-        str·free(fields[i]);
-    }
-    buffree(fields);
-    return nil;
-}
-
diff --git a/sys/base/string/upper.c b/sys/base/string/upper.c
deleted file mode 100644
index ab692c1..0000000
--- a/sys/base/string/upper.c
+++ /dev/null
@@ -1,12 +0,0 @@
-#include "internal.h"
-
-// Upper will force all runes in the string to be uppercase.
-void
-str·upper(string s)
-{
-    byte *b, *e;
-    b = s;
-    e = b + str·len(s);
-    while (b++ != e) 
-        *b = toupper(*b);
-}
diff --git a/sys/base/test.c b/sys/base/test.c
deleted file mode 100644
index a29be1d..0000000
--- a/sys/base/test.c
+++ /dev/null
@@ -1,170 +0,0 @@
-#include <u.h>
-#include <base.h>
-#include <base/macro/map.h>
-
-#include <time.h>
-
-uintptr
-printtest(Coro *c, uintptr d)
-{
-    printf("--> Recieved %lu\n", d);
-    d = coro·yield(c, d+10);
-    printf("--> Now %lu\n", d);
-
-    return d;
-}
-
-uintptr
-sequence(Coro *c, uintptr start)
-{
-    int d = start;
-    for (;;) {
-        coro·yield(c, d++);
-    }
-
-    return d;
-}
-
-struct PrimeMsg 
-{
-    Coro *seq;
-    int   p;
-};
-
-uintptr
-filter(Coro *c, uintptr data)
-{
-    int x, p;
-    Coro *seq;
-    struct PrimeMsg *msg;
-
-    // Need to copy relevant variables onto the local stack
-    // Data is volatile.
-    msg = (struct PrimeMsg*)data;
-    seq = msg->seq; 
-    p   = msg->p;
-
-    for (;;) {
-        x = coro·yield(seq, x); 
-        if (x % p != 0) {
-            x = coro·yield(c, x);
-        }
-    }
-
-    return 0;
-}
-
-error
-test·coro()
-{
-    int i;
-    Coro *c[4];
-    uintptr d;
-
-    printf("Starting singleton test\n");
-
-    for (i = 0; i < arrlen(c); i++) {
-        c[i] = coro·make(0, &printtest);
-    }
-
-    /* Singleton test */
-    d = 0;
-    for (i = 0; i < 10; i++) {
-        d = coro·yield(c[0], d);
-    }
-
-    printf("Starting triplet test\n");
-
-    /* Triplet test */
-    for (i = 0; i < 10; i++) {
-        d = coro·yield(c[1], d);
-        d = coro·yield(c[2], d+100);
-        d = coro·yield(c[3], d+200);
-    }
-
-    for (i = 0; i < arrlen(c); i++) {
-        coro·free(c[i]);
-    }
-
-    /* Prime sieve */
-    printf("Starting prime test\n");
-    uintptr num;
-    Coro *cur, *seq[50];
-
-    num    = 2;
-    seq[0] = coro·make(4096, &sequence);
-    cur    = *seq;
-
-    num = coro·yield(cur, num);
-    for (i = 1; i < arrlen(seq); i++) {
-        seq[i] = coro·make(4096, &filter);
-        struct PrimeMsg msg = {
-            .seq = cur,
-            .p   = num,
-        };
-        cur = seq[i];
-        num = coro·yield(cur, (uintptr)&msg);
-        printf("--> prime number %lu\n", num);
-    }
-    return 0;
-}
-
-int
-less(void* a, void* b)
-{
-    int ai, bi;
-    ai = *(int*)a;
-    bi = *(int*)b;
-
-    return ai - bi;
-}
-
-error
-test·sort()
-{
-    clock_t t;
-    int i, test[10000];
-    for (i = 0; i < arrlen(test); i++) {
-        test[i] = rand();
-    }
-
-    t = clock();
-    sort·int(arrlen(test), test);
-    t = clock() - t;
-    printf("inlined code took %f ms to execute\n", 1000.*t/CLOCKS_PER_SEC);
-
-    for (i = 0; i < arrlen(test); i++) {
-        test[i] = rand();
-    }
-
-    t = clock();
-    qsort(test, arrlen(test), sizeof(int), (int (*)(const void *, const void *))less);
-    t = clock() - t;
-    printf("std qsort code took %f ms to execute\n", 1000.*t/CLOCKS_PER_SEC);
-
-    /*
-    for (i = 1; i < arrlen(test); i++) {
-        if (test[i] >= test[i-1]) {
-            printf("%d is less that %d\n", test[i], test[i-1]);
-        } else {
-            printf("ERROR: %d is NOT less that %d\n", test[i], test[i-1]);
-        }
-    }
-    */
-
-    return 0;
-}
-
-error
-main()
-{
-    error err;
-#if 0
-    if (err = test·coro(), err) {
-        errorf("test fail: coroutine");
-    }
-#endif
-    if (err = test·sort(), err) {
-        errorf("test fail: coroutine");
-    }
-}
diff --git a/sys/cmd/cc/ast.c b/sys/cmd/cc/ast.c
deleted file mode 100644
index 4330bcc..0000000
--- a/sys/cmd/cc/ast.c
+++ /dev/null
@@ -1,2139 +0,0 @@
-#include "cc.h"
-
-// -----------------------------------------------------------------------
-// helper macros
-
-#define alloc(ptr)  (ptr) = mem·arenaalloc(C.heap, 1, sizeof *(ptr))
-#define copyarray(dst, arr, n)  (dst) = mem·arenaalloc(C.heap, (n), sizeof *(arr)), memcpy((dst), (arr), n * sizeof *(arr))
-#define movearray(dst, arr, n)  copyarray(dst,arr,n), free(arr)
-
-#define attop(prs)    ((uintptr)prs->sp == (uintptr)prs->spstk)
-#define peek(p, i)    (p->tok[i])
-#define iskw(t, k)    (((t).kind == Akeywd) && (t).val.i == (k)) 
-#define advance(p, l) (p->tok[0] = p->tok[1], p->tok[1] = lex(l), p->tok[0])
-
-#define Bit(i) (1 << (i))
-
-// -----------------------------------------------------------------------
-// helper functions
-
-static
-string
-nameof(Name *n)
-{
-    switch (n->kind) {
-    /* 0 corresponds to no state - i.e. an abstract name */
-    case Nnil:
-        return nil;
-    case Nident:
-        return n->ident;
-    case Nparen:
-        return nameof(n->paren->name);
-    case Nindex:
-    case Ncall:
-        return nameof(n->sfx.name);
-    }
-    panicf("unreachable");
-    return nil;
-}
-
-static
-void
-openscope(Parser *p)
-{
-    if (++p->sp >= arrend(p->spstk))
-        panicf("scope stack overflow");
-}
-
-/* 
- * TODO: save the symbol table with the ast node
- *       write a "copy(move)scope"
- */
-
-static
-void
-closescope(Parser *p)
-{
-    if (p->sp <= p->spstk)
-        panicf("scope stack underflow");
-
-    forgetall(&p->sp->objs);
-    forgetall(&p->sp->tags);
-    p->sp--;
-}
-
-/* temporary stack helpers */
-static
-Name*
-getname(Parser *p)
-{
-    if (p->nm >= arrend(p->nmstk)) 
-        panicf("name stack overflow");
-    return p->nm++;
-}
-
-static void putdtor(Parser *p, Dtor *dt);
-
-static
-void
-putname(Parser *p, Name *n)
-{
-    if (p->nm <= p->nmstk)
-        panicf("name stack underflow");
-
-    switch (n->kind) {
-    case Nnil:
-    case Nident:
-        break;
-    case Nparen:
-        putdtor(p, n->paren);
-        break;
-    case Nindex:
-    case Ncall:
-        putname(p, n->sfx.name);
-        break;
-    default:
-        panicf("unrecognized name kind");
-    }
-    *p->nm-- = (Name){0};
-}
-
-static
-Ptr*
-getptr(Parser *p)
-{
-    if (p->pt >= arrend(p->ptstk))
-        panicf("pointer stack overflow");
-
-    return p->pt++;
-}
-
-static
-void
-putptr(Parser *p, Ptr *ptr)
-{
-    if (p->pt <= p->ptstk) 
-        panicf("pointer stack underflow");
-
-    while ((ptr = ptr->link))
-        putptr(p, ptr);
-
-    *p->pt-- = (Ptr){0};
-}
-
-
-static
-Dtor*
-getdtor(Parser *p)
-{
-    if (p->dt >= arrend(p->dtstk))
-        panicf("dtor stack overflow");
-
-    p->dt->name = getname(p);
-    return p->dt++;
-}
-
-static
-void
-putdtor(Parser *p, Dtor *dt)
-{
-    if (p->dt <= p->dtstk) 
-        panicf("dtor stack underflow");
-
-    /* release the pointer overflow if we had to use it */
-    if (p->dt->ptr.link)
-        putptr(p, p->dt->ptr.link);
-
-    /* the dtor could encompass multiple names hierarchically */
-    putname(p, dt->name);
-    *p->dt-- = (Dtor){0};
-}
-
-/* TODO: This will fail for forward declarations */
-static
-void
-declareobj(Parser *p, Decl *d)
-{
-    Sym    *sym;
-    string ident;
-    uint32 kind;
-    struct Decls *link;
-
-    switch (d->kind) {
-    case Dfunc:
-    case Dvar:
-        kind = Svar;
-        goto one;
-    case Dtype:
-        kind = Stype;
-    one:
-        ident = d->name;
-        break;
-
-    case Dvars:
-        kind = Svar;
-        goto many;
-    case Dtypes:
-        kind = Stype;
-    many:
-        while (link = &d->list, link != nil) {
-            ident = link->name;
-            sym   = lookup(&p->sp->objs, ident);
-            if (sym) {
-                errorat(peek(p, 0).pos, "redeclaration of name '%s' in object space", ident);
-                return;
-            }
-            sym = define(&p->sp->objs, ident, kind);
-            if (kind == Svar)
-                sym->obj  = d;
-            else
-                sym->type = d->type;
-        }
-        break;
-
-    default:
-        panicf("unrecognized node kind %d. expected declaration", d->kind);
-    }
-    sym = lookup(&p->sp->objs, ident);
-    if (sym) {
-        errorat(peek(p, 0).pos, "redeclaration of name '%s' in object space", ident);
-        return;
-    }
-    sym = define(&p->sp->objs, ident, kind);
-    if (kind == Svar)
-        sym->obj  = d;
-    else
-        sym->type = d->type;
-}
-
-/* enters the object identifier space */
-static
-void
-declareenum(Parser *p, int n, string *elts, Expr *vals)
-{
-    int  i;
-    Sym *s;
-
-    for (i = 0; i < n; i++) {
-        s = lookup(&p->sp->objs, elts[i]);
-        if (s) {
-            errorat(peek(p, 0).pos, "redeclaration of name %s in object space", elts[i]);
-            continue;
-        }
-        s = define(&p->sp->objs, elts[i], Senum);
-        s->val = vals + i;
-    }
-}
-
-static
-void
-declaretag(Parser *p, uint32 t, string name)
-{
-    Sym *sym;
-    sym = lookup(&p->sp->tags, name);
-    if (sym) {
-        errorat(peek(p, 0).pos, "redeclaration of name '%s' in tag space", name);
-        return;
-    }
-
-    sym = define(&p->sp->tags, name, Stype);
-    sym->type = t;
-}
-
-static
-Sym *
-lookupobj(Parser *p, string ident)
-{
-    Sym   *sym;
-    Scope *it;
-
-    it = p->sp;
-    do {
-        sym = lookup(&it->objs, ident);
-    } while (sym == nil && --it >= p->spstk);
-
-    return sym;
-}
-
-static
-Sym *
-lookuptag(Parser *p, string ident)
-{
-    Sym   *sym;
-    Scope *it;
-
-    it = p->sp;
-    do {
-        sym = lookup(&it->tags, ident);
-    } while (sym == nil && --it >= p->spstk);
-
-    return sym;
-}
-
-static
-int
-nomatch(Token t, vlong kind)
-{
-    if (t.kind == kind)
-        return 0;
-
-    if (t.kind == Akeywd)
-        errorat(t.pos, "expected token '%s', instead found keyword '%s'", tokens[kind], keywords[t.val.i]);
-    else
-        errorat(t.pos, "expected token '%s', instead found '%s'", tokens[kind], tokens[t.kind]);
-    return 1;
-}
-
-// -----------------------------------------------------------------------
-// needed forward declarations
-
-static error  spec(Parser *, Lexer *, uint64 *);
-static uint32 basetype(Parser *, Lexer *, uint64 *s);
-static string namedecl(Parser *, Lexer *, uint32 *, int);
-static uint32 typename(Parser *, Lexer *, uint32 *);
-
-static error  dtor(Parser *p, Lexer *lx, Dtor *d, int ab);
-static uint32 typeofdtor(Dtor *, uint32); 
-
-
-static Decl  *decl(Parser *, Lexer *);
-
-static Expr  *ternary(Parser *, Lexer *);
-static Expr  *expr(Parser *, Lexer *);
-
-static error  blkstmt(Parser *, Lexer *, Stmt **);
-
-
-// -----------------------------------------------------------------------
-// expressions
-
-#define MAKEX(x, state) alloc((x)), (x)->kind = X##state
-
-static
-Expr*
-primary(Parser *p, Lexer *lx)
-{
-    int   k;
-    Expr *x;
-    Token t;
-    Pos   b;
-
-    t = peek(p, 0);
-    b = t.pos;
-    switch (k = (t.kind & Vmask)) {
-    case Aident:
-        MAKEX(x, ident);
-        x->pos.beg = b;
-        x->pos.end = lx->pos;
-        x->name    = t.val.s;
-        break;
-
-    case Alit:
-        MAKEX(x, lit);
-        x->pos.beg  = b;
-        x->pos.end  = lx->pos;
-        x->val.kind = t.kind & ~Vmask;
-        x->val.v    = t.val; 
-        break;
-
-    case Alparen:
-        advance(p, lx);
-        x = expr(p, lx);
-        t = peek(p, 0);
-        if (nomatch(t, Arparen)) {
-            errorat(lx->pos, "unterminated paren expression");
-            goto Bad;
-        }
-        break;
-
-    default: 
-        panicf("unreachable");
-    }
-
-    advance(p, lx);
-    return x;
-Bad:
-    errorat(lx->pos, "unable to parse operand expression");
-    return nil;
-}
-
-static
-int
-istypename(Parser *p, Token t)
-{
-    Sym *sym;
-
-    if (t.kind == Akeywd && (Kconst <= t.val.i && t.val.i <= Kenum))
-        return 1;
-    if (t.kind == Aident) {
-        sym = lookupobj(p, t.val.s);
-        return (sym != nil) && sym->kind == Stype;
-    }
-
-    return 0;
-}
-
-static Expr* initx(Parser *p, Lexer *lx);
-
-static
-Expr*
-initlist(Parser *p, Lexer *lx)
-{
-    Token t;
-    int   c, n;
-    Expr *x, **a;
-    struct Key *k;
-
-    MAKEX(x, initlist);
-    x->pos.beg = lx->pos;
-    x->init.n  = 0;
-    if (t.kind == Arbrace) {
-        x->init.k = nil;
-        x->init.v = nil;
-        return x;
-    }
-
-    c = 0;
-    n = 0;
-    a = nil;
-    k = nil;
-Key0:
-    if (n >= c) {
-        c += 20;
-        k  = realloc(k, c * sizeof(*k));
-        a  = realloc(a, c * sizeof(*a));
-    }
-Key1:
-    switch (t.kind) {
-    case Adot:
-        t = advance(p, lx);
-        if (t.kind != Aident) {
-            errorat(t.pos, "dot designator must be followed by identifier");
-            goto Bad;
-        }
-        k[n++] = (struct Key) {
-            .kind  = (uint32)x->init.n,
-            .s     = t.val.s,
-        };
-        t = advance(p, lx);
-        goto Key0;
-
-    case Albrakt:
-        t = advance(p, lx);
-        k[n++] = (struct Key) {
-            .kind  = (uint32)x->init.n | (1ULL << 32),
-            .x     = expr(p, lx),
-        };
-        t = peek(p, 0);
-        goto Key0;
-
-    case Aeq:
-        t = advance(p, lx);
-        /* fallthrough */
-    default:
-        a[x->init.n++] = initx(p, lx);
-
-        t = peek(p, 0);
-        switch (t.kind) {
-        case Arbrace:
-            break;
-        case Acomma:
-            advance(p, lx);
-            /* fallthrough */
-        default:
-            goto Key0;
-        }
-        break;
-
-    case Acomma:
-        t = advance(p, lx);
-        break;
-    }
-    movearray(x->init.k, k, n);
-    movearray(x->init.v, a, x->init.n);
-    return x;
-Bad:
-    errorat(t.pos, "could not parse initializer list"); 
-    return nil;
-}
-
-static
-Expr*
-initx(Parser *p, Lexer *lx)
-{
-    Expr *x;
-    Token t;
-
-    t = peek(p, 0);
-    if (t.kind != Albrace)
-        return ternary(p, lx);
-
-    advance(p, lx);
-    x = initlist(p, lx);
-    t = peek(p, 0);
-    if (nomatch(t, Arbrace)) {
-        errorat(t.pos, "unmatched brace in initializer list, found %s instead", tokens[t.kind]);
-        advance(p, lx);
-    }
-
-    return x;
-}
-
-static
-Expr*
-postfix(Parser *p, Lexer *lx)
-{
-    Pos   b;
-    Token t;
-    int   c, n;
-    uint32 type, qual;
-    Expr *x, *y, **a;
-
-    t = peek(p, 0);
-    if (t.kind == Alparen) 
-        if (istypename(p, peek(p, 1))) {
-            t    = advance(p, lx);
-            type = typename(p, lx, &qual);
-            t    = peek(p, 0);
-            if (nomatch(t, Arparen)) {
-                errorat(lx->pos, "unmatched paren: found %s instead", tokens[t.kind]);
-                goto Bad;
-            }
-            t = advance(p, lx);
-            if (nomatch(t, Albrace)) {
-                errorat(lx->pos, "bad initializer list: found %s", tokens[t.kind]);
-                goto Bad;
-            }
-
-            x = initlist(p, lx);
-
-            t = peek(p, 0);
-            if (nomatch(t, Arbrace)) {
-                errorat(lx->pos, "unmatched brace: found %s instead", tokens[t.kind]);
-                goto Bad;
-            }
-
-            x->type = type;
-            x->qual = qual;
-            return x;
-        }
-        
-    x = primary(p, lx);
-    t = peek(p, 0);
-    for (;;) {
-        b = x->pos.beg;
-        switch (t.kind) {
-        case Ainc:
-            MAKEX(y, postinc);
-            goto Postfix;
-        case Adec:
-            MAKEX(y, postdec);
-        Postfix:
-            y->pos.beg    = b;
-            y->pos.end    = lx->pos;
-            y->unary.post = x;
-            x = y, y = nil;
-            break;
-
-        case Adot:
-            MAKEX(y, self);
-            goto Select;
-        case Aarrow:
-            MAKEX(y, selp);
-        Select:
-            t = advance(p, lx);
-            if (t.kind != Aident) {
-                errorat(t.pos, "invalid operand of selector expression");
-                goto Bad;
-            }
-            y->pos.beg = b;
-            y->pos.end = lx->pos;
-
-            y->idx.f = t.val.s;
-            y->idx.x = x;
-            x = y, y = nil;
-            break;
-
-        case Albrakt:
-            t = advance(p, lx);
-            if (t.kind == Arbrakt) {
-                errorat(t.pos, "empty index expression");
-                goto Bad;
-            }
-            MAKEX(y, index);
-            y->idx.x = x;
-            y->idx.i = expr(p, lx);
-
-            t = peek(p, 0);
-            if (t.kind != Albrakt) {
-                errorat(t.pos, "malformed index expression");
-                goto Bad;
-            }
-
-            x = y, y = nil;
-            break;
-
-        case Alparen:
-            t = advance(p, lx);
-            MAKEX(y, call);
-            y->call.fn = x;
-            y->pos.beg = b;
-            y->call.n  = 0;
-            if (t.kind == Arparen) {
-                y->call.arg = nil;
-                goto Endfunc;
-            }
-            c = 0;
-            a = nil; 
-        Arg:
-            if (y->call.n >= c) {
-                c += 20;
-                a  = realloc(a, c * sizeof(*a));
-            }
-            a[y->call.n++] = expr(p, lx);
-            t = peek(p, 0);
-            if (t.kind == Acomma) {
-                advance(p, lx);
-                goto Arg;
-            }
-            if (t.kind != Arparen) {
-                errorat(t.pos, "invalid token '%s' found in call argument");
-                goto Bad;
-            }
-            movearray(y->call.arg,  a, y->call.n);
-        Endfunc:
-            y->pos.end = lx->pos;
-            x = y, y = nil;
-            break;
-
-        default:
-            return x;
-        }
-        t = advance(p, lx);
-    }
-    return x;
-Bad:
-    errorat(lx->pos, "failed to parse primary expression");
-    return nil;
-}
-
-static
-uint32
-typename(Parser *p, Lexer *lx, uint32 *spec)
-{
-    uint32 base;
-    uint64 s;
-
-    base = basetype(p, lx, &s);
-    if (!base) {
-        errorat(lx->pos, "failed to parse type name specifiers");
-        return 0;
-    }
-    *spec = (uint32)s;
-    namedecl(p, lx, &base, 1);
-
-    return base;
-}
-
-static Expr* cast(Parser *p, Lexer *lx);
-
-static
-Expr*
-unary(Parser *p, Lexer *lx)
-{
-    Expr *x;
-    Token t;
-
-    t = peek(p, 0);
-    switch (t.kind) {
-    case Ainc:  MAKEX(x, preinc); goto Prefix;
-    case Adec:  MAKEX(x, predec); /* fallthrough */
-    Prefix:
-        advance(p, lx);
-        x->pos.beg   = t.pos;
-        x->unary.pre = unary(p, lx);
-        x->pos.end   = x->unary.pre->pos.end;
-        return x;
-
-    case Aneg:  MAKEX(x, neg);    goto Unary;
-    case Aand:  MAKEX(x, ref);    goto Unary;
-    case Anot:  MAKEX(x, not);    goto Unary;
-    case Astar: MAKEX(x, star);   goto Unary;
-    case Aadd:  MAKEX(x, plus);   goto Unary;
-    case Asub:  MAKEX(x, minus);  /* fallthrough */
-    Unary:
-        advance(p, lx);
-        x->pos.beg   = t.pos;
-        x->unary.pre = cast(p, lx);
-        x->pos.end   = x->unary.pre->pos.end;
-        return x;
-
-    case Akeywd:
-        switch (t.val.i) {
-        case Ksizeof:  
-            MAKEX(x, sizeof); 
-            goto Key;
-        case Kalignof: 
-            MAKEX(x, alignof); 
-            /* fallthrough */
-        Key:
-            t = advance(p, lx);
-            if (t.kind == Alparen) 
-                if (istypename(p, peek(p, 1))) {
-                    t = advance(p, lx);
-                    x->info.type    = 0;
-                    x->info.of.type = typename(p, lx, &x->info.of.qual);
-
-                    t = peek(p, 0);
-                    if (nomatch(t, Arparen)) {
-                        errorat(t.pos, "missing paren for size/alignof statement");
-                        goto Bad;
-                    }
-                    advance(p, lx);
-                    return x;
-                }
-            
-            x->info.type = 1;
-            x->info.x    = unary(p, lx);
-            return x;
-
-        default:
-            ;
-        }
-        /* fallthrough */
-    default:
-        return postfix(p, lx);
-    }
-Bad:
-    return nil;
-}
-
-static
-Expr*
-cast(Parser *p, Lexer *lx)
-{
-    Expr *x;
-    Token t;
-    
-    t = peek(p, 0);
-    if (t.kind == Alparen && istypename(p, peek(p,1))) {
-        t = advance(p, lx);
-        MAKEX(x, cast);
-
-        x->pos.beg      = t.pos;
-        x->cast.to.type = typename(p, lx, &x->cast.to.qual);
-        if (!x->cast.to.type) {
-            errorat(lx->pos, "invalid type operand of cast");
-            goto Bad;
-        }
-
-        t = peek(p, 0);
-        if (nomatch(t, Arparen)) {
-            errorat(lx->pos, "missing closing paren after cast expression");
-            goto Bad;
-        }
-        advance(p, lx);
-
-        x->cast.x  = cast(p, lx);
-        x->pos.beg = lx->pos;
-        return x;
-    }
-    return unary(p, lx);
-
-Bad:
-    errorat(lx->pos, "failed to parse cast expression");
-    return nil;
-}
-
-/* static data for binary operators */
-#define OPERATORS                   \
-    OPERATOR(Astar, 10, Xmul)       \
-    OPERATOR(Adiv, 10, Xdiv)        \
-    OPERATOR(Amod, 10, Xmod)        \
-    OPERATOR(Aadd, 9, Xadd)         \
-    OPERATOR(Asub, 9, Xsub)         \
-    OPERATOR(Alsft, 8, Xlsft)       \
-    OPERATOR(Arsft, 8, Xrsft)       \
-    OPERATOR(Agteq, 7, Xgteq)       \
-    OPERATOR(Alteq, 7, Xlteq)       \
-    OPERATOR(Alt, 7, Xlt)           \
-    OPERATOR(Agt, 7, Xgt)           \
-    OPERATOR(Aeq, 6, Xeql)          \
-    OPERATOR(Aneq, 6, Xneq)         \
-    OPERATOR(Aand, 5, Xand)         \
-    OPERATOR(Axor, 4, Xxor)         \
-    OPERATOR(Aor, 3, Xor)           \
-    OPERATOR(Aandand, 2, Xandand)   \
-    OPERATOR(Aoror, 1, Xoror)  
-
-static int prectab[NUM_TOKENS] = 
-{ 
-#define OPERATOR(a, b, c) [a] = b,
-    OPERATORS
-#undef OPERATOR
-};
-
-static int optab[NUM_TOKENS] = 
-{ 
-#define OPERATOR(a, b, c) [a] = c,
-    OPERATORS
-#undef OPERATOR
-};
-#undef OPERATORS
-
-static
-Expr*
-binary(Parser *p, Lexer *lx, int prec)
-{
-    Token t;
-    int   k, np;
-    Expr *l, *x;
-
-    l = cast(p, lx);
-    for (;;) {
-        t  = peek(p, 0);
-        k  = t.kind;
-        np = prectab[k];
-        if (np < prec) 
-            return l;
-
-        alloc(x);
-        t = advance(p, lx);
-
-        x->pos.beg  = l->pos.beg;
-        x->kind     = optab[k];
-        x->binary.l = l;
-        x->binary.r = binary(p, lx, np + 1);
-        x->pos.end  = x->binary.r->pos.end;
-
-        l = x;
-    }
-    return l;
-Bad:
-    errorat(t.pos, "failed to parse expression");
-    return nil;
-}
-
-static
-Expr*
-ternary(Parser *p, Lexer *lx)
-{
-    Pos   b;
-    Token t;
-    Expr *x, *y;
-
-    x = binary(p, lx, 1);
-    t = peek(p, 0);
-    b = t.pos;
-
-    switch (t.kind) {
-    case Aqmark:
-        t = advance(p, lx);
-        y = x;
-        MAKEX(x, ternary);
-        x->pos.beg = b;
-        x->kind    = Xternary;
-        x->cond.c  = y;
-        x->cond.t  = expr(p, lx);
-
-        t = peek(p, 0);
-        if (nomatch(t, Acolon)) {
-            errorat(t.pos, "ternary expression missing ':'");
-            goto Bad;
-        }
-        t = advance(p, lx);
-        x->cond.e  = expr(p, lx);
-        x->pos.end = lx->pos;
-        break;
-
-    case Aasn:     MAKEX(y, asn);     goto Assign;
-    case Aorasn:   MAKEX(y, orasn);   goto Assign;
-    case Axorasn:  MAKEX(y, xorasn);  goto Assign;
-    case Aandasn:  MAKEX(y, andasn);  goto Assign;
-    case Asubasn:  MAKEX(y, subasn);  goto Assign;
-    case Amulasn:  MAKEX(y, mulasn);  goto Assign;
-    case Adivasn:  MAKEX(y, divasn);  goto Assign;
-    case Amodasn:  MAKEX(y, modasn);  goto Assign;
-    case Alsftasn: MAKEX(y, lsftasn); goto Assign;
-    case Arsftasn: MAKEX(y, rsftasn); goto Assign;
-    Assign:
-        advance(p, lx);
-
-        y->asn.l = x;
-        y->asn.r = ternary(p, lx);
-        x = y;
-        x->pos.beg = b;
-        x->pos.end = lx->pos;
-        break;
-    default:
-        ;
-    }
-
-    return x;
-Bad:
-    errorat(lx->pos, "failing expression parse");
-    return nil;
-}
-
-static
-Expr*
-expr(Parser *p, Lexer *lx)
-{
-    Pos   b;
-    Token t;
-    Expr *x, *y;
-
-    x = ternary(p, lx);
-    while (t = peek(p, 0), t.kind == Acomma) {
-        advance(p, lx);
-        y = x;
-        MAKEX(x, comma);
-        x->pos.beg    = y->pos.beg;
-        x->comma.x[0] = y;
-        x->comma.x[1] = ternary(p, lx);
-        x->pos.end    = lx->pos;
-        y = nil;
-    }
-
-    return x;
-}
-
-// -----------------------------------------------------------------------
-// statements
-
-static
-struct Node*
-stmt(Parser *p, Lexer *lx)
-{
-    int k;
-    Stmt *s;
-    Sym *sym;
-    Token t;
-
-    t = peek(p, 0);
-    k = t.kind;
-
-    /* intercept decl before allocating a statement */
-    if (k == Aident) {
-        if (peek(p, 1).kind == Acolon)
-            goto Tlabel;
-        sym = lookupobj(p, t.val.s);
-        if (!sym) {
-            errorat(lx->pos, "unrecognized type identifier '%s'", t.val.s);
-            goto Bad;
-        }
-
-        if (sym->kind == Stype)
-            goto Tdecl;
-        if (sym->kind == Svar) {
-            alloc(s);
-            s->pos.beg = lx->pos;
-            goto Texpr;
-        }
-
-        errorat(lx->pos, "bad symbol type used as type identifier");
-        goto Bad;
-    }
-
-    if (k == Akeywd) {
-        if ((Kauto <= t.val.i && t.val.i <= Ktypedef) || (Kconst <= t.val.i && t.val.i <= Kenum)) {
-        Tdecl:
-            return (Node *)decl(p, lx);
-        }
-    }
-
-    alloc(s);
-    s->pos.beg = lx->pos;
-
-    switch (k) {
-    case Akeywd:
-        switch (k = t.val.i) {
-        case Kif:
-            t = advance(p, lx);
-            s->kind = Sif;
-
-            if (nomatch(t, Alparen)) {
-                errorat(lx->pos, "missing opening paren before if conditional");
-                goto Bad;
-            }
-            s->br.cond = expr(p, lx);
-            if (nomatch(t, Arparen)) {
-                errorat(lx->pos, "missing closing paren after if conditional");
-                goto Bad;
-            }
-            s->br.body = stmt(p, lx); 
-
-            t = peek(p, 0);
-            if (iskw(t, Kelse)) 
-                s->br.orelse = stmt(p, lx);
-            else 
-                s->br.orelse = nil;
-
-            break;
-
-        case Kswitch:
-            t = advance(p, lx);
-            s->kind = Sswitch;
-
-            if (nomatch(t, Alparen)) {
-                errorat(lx->pos, "missing opening paren before switch conditional");
-                goto Bad;
-            }
-            s->br.cond = expr(p, lx);
-            if (nomatch(t, Arparen)) {
-                errorat(lx->pos, "missing closing paren after switch conditional");
-                goto Bad;
-            }
-            s->br.body   = stmt(p, lx);
-            s->br.orelse = nil;
-
-            break;
-
-        case Kfor:
-            t = advance(p, lx);
-            s->kind = Sfor;
-
-            if (nomatch(t, Alparen)) {
-                errorat(lx->pos, "missing opening paren before for loop preamble");
-                goto Bad;
-            }
-
-            if (t.kind == Asemi)
-                s->loop.init = nil;
-            else {
-                // TODO: test for declaration
-                s->loop.init = (Node *)expr(p, lx);
-            }
-
-            if (nomatch(t, Asemi)) {
-                errorat(lx->pos, "missing semicolon");
-                goto Bad;
-            }
-
-            if (t.kind == Asemi)
-                s->loop.cond = nil;
-            else 
-                s->loop.cond = expr(p, lx);
-
-            if (nomatch(t, Asemi)) {
-                errorat(lx->pos, "missing semicolon");
-                goto Bad;
-            }
-
-            if (t.kind == Asemi)
-                s->loop.step = nil;
-            else 
-                s->loop.step = expr(p, lx);
-
-            if (nomatch(t, Alparen)) {
-                errorat(lx->pos, "missing closing paren after for loop preamble");
-                goto Bad;
-            }
-            s->loop.body = stmt(p, lx);
-            break;
-
-        case Kwhile:
-            t = advance(p, lx);
-            s->kind = Swhile;
-            if (nomatch(t, Alparen)) {
-                errorat(lx->pos, "missing opening paren before while loop conditional");
-                goto Bad;
-            }
-            s->loop.cond = expr(p, lx);
-            if (nomatch(t, Arparen)) {
-                errorat(t.pos, "missing closing paren after while loop conditional");
-                goto Bad;
-            }
-
-            s->loop.init = nil;
-            s->loop.step = nil;
-            s->loop.body = stmt(p, lx);
-            break;
-
-        case Kdo:
-            t = advance(p, lx);
-            s->kind      = Sdo;
-            s->loop.body = stmt(p, lx); 
-
-            if (!iskw(t, Kwhile)) {
-                errorat(t.pos, "missing while statement conditional after do body");
-                goto Bad;
-            }
-            t = advance(p, lx);
-            if (nomatch(t, Alparen)) {
-                errorat(t.pos, "missing open paren after while conditional");
-                goto Bad;
-            }
-
-            s->loop.init = nil;
-            s->loop.step = nil;
-            s->loop.cond = expr(p, lx);
-            break;
-
-        case Kgoto:
-            t = advance(p, lx);
-            s->kind = Sgoto;
-            if (t.kind != Aident) {
-                errorat(t.pos, "invalid argument to goto");
-                goto Bad;
-            }
-            s->jmp.lbl = t.val.s;
-            t = advance(p, lx);
-            if (nomatch(t, Asemi)) {
-                errorat(t.pos, "missing semicolon after goto");
-                goto Bad;
-            }
-            advance(p, lx);
-            break;
-
-        case Kcontinue:
-            t = advance(p, lx);
-            s->kind = Scontin;
-            s->jmp.lbl = nil;
-            s->jmp.x   = nil;
-            if (nomatch(t, Asemi)) {
-                errorat(t.pos, "missing semicolon after continue");
-                goto Bad;
-            }
-            advance(p, lx);
-            break;
-
-        case Kbreak:
-            t = advance(p, lx);
-            s->kind = Sbreak;
-            s->jmp.lbl = nil;
-            s->jmp.x   = nil;
-            if (nomatch(t, Asemi)) {
-                errorat(t.pos, "missing semicolon after break");
-                goto Bad;
-            }
-            advance(p, lx);
-            break;
-
-        case Kreturn:
-            t = advance(p, lx);
-            s->kind = Sreturn;
-
-            s->jmp.lbl = nil;
-            s->jmp.x   = (t.kind == Asemi) ? nil : expr(p, lx);
-
-            t = peek(p, 0);
-            if (nomatch(t, Asemi)) {
-                errorat(t.pos, "missing semicolon after return statement");
-                goto Bad;
-            }
-            advance(p, lx);
-            break;
-
-        case Kcase:
-            t = advance(p, lx);
-            s->kind  = Scase;
-            s->lbl.x = expr(p, lx);
-            if (nomatch(t, Acolon)) {
-                errorat(t.pos, "missing colon after default label");
-                goto Bad;
-            }
-            t = advance(p, lx);
-            s->lbl.stmt = stmt(p, lx);
-            break;
-
-        case Kdefault:
-            t = advance(p, lx);
-            s->kind  = Scase;
-            s->lbl.x = nil;
-            if (nomatch(t, Acolon)) {
-                errorat(t.pos, "missing colon after default label");
-                goto Bad;
-            }
-            t = advance(p, lx);
-            s->lbl.stmt = stmt(p, lx);
-            break;
-
-        default:
-            panicf("unexpected statement keyword %s", keywords[k]);
-        }
-        break;
-    case Albrace:
-        s->kind = Sblock;
-        openscope(p);
-        if (blkstmt(p, lx, &s)) {
-            errorat(lx->pos, "failed to parse block statement");
-            goto Bad;
-        }
-        closescope(p);
-        break;
-
-    case Asemi:
-        t = advance(p, lx);
-        s->kind = Sempty;
-        break;
-
-    case Aident:
-    Tlabel:
-        t = advance(p, lx);
-        s->kind = Slabel;
-        if (nomatch(t, Acolon)) {
-            errorat(t.pos, "missing colon after labelled block");
-            goto Bad;
-        }
-        t = advance(p, lx);
-        s->lbl.stmt = stmt(p, lx);
-        break;
-
-    default:
-    Texpr:
-        s->kind = Sexpr;
-        s->x    = expr(p, lx);
-
-        t = peek(p, 0);
-        if (nomatch(t, Asemi)) {
-            errorat(t.pos, "missing semicolon after statement expression");
-            goto Bad;
-        }
-        advance(p, lx);
-    }
-
-    s->pos.end = lx->pos;
-    return (Node *)s;
-Bad:
-    errorat(lx->pos, "failed to parse statement");
-    return nil;
-}
-
-static
-error
-blkstmt(Parser *p, Lexer *lx, Stmt **s)
-{
-    Token t;
-    int len;
-    int cap;
-    Node **ns;
-
-    alloc(*s);
-    (*s)->kind    = Sblock;
-    (*s)->pos.beg = lx->pos;
-
-    t = peek(p, 0);
-    if (nomatch(t, Albrace))
-        goto Bad;
-    t = advance(p, lx);
-
-    len = 0, cap = 20;
-    ns  = malloc(cap*sizeof(*ns));
-    while (t.kind != Arbrace) {
-        if (cap == len) {
-            cap += 20;
-            ns   = realloc(ns, cap*sizeof(*ns));
-        }
-        ns[len++] = stmt(p, lx);
-        t = peek(p, 0);
-    }
-    advance(p, lx);
-
-    (*s)->pos.end = lx->pos;
-    (*s)->blk.n   = len;
-    movearray((*s)->blk.item, ns, len);
-    return 0;
-Bad:
-    errorat(lx->pos, "failed to parse block statement");
-    free(ns);
-    return 1;
-}
-
-// -----------------------------------------------------------------------
-// types
-
-uint32
-ptrtype(uint32 base, uint32 qual)
-{
-    uint32 i;
-    Type *t;
-
-    i = type();
-    t = C.type.info + i;
-    t->kind     = Tptr;
-    t->ptr.base = base;
-    t->ptr.qual = qual;
-    t->size     = pointer.size;
-    t->align    = pointer.align;
-    t->sign     = pointer.sign;
-
-    return i;
-}
-
-uint32
-arraytype(uint32 base, uint32 qual, Expr *ix)
-{
-    int   i, n;
-    Type *t;
-
-    /* TODO: evaluate the length */
-    n = 10;
-    i = type();
-    t = C.type.info + i;
-    t->kind     = Tarray;
-    t->ptr.base = base;
-    t->size     = n * C.type.info[base].size;     
-    t->align    = C.type.info[base].align;
-    t->sign     = 0;
-
-    return i;
-}
-
-uint32
-functype(uint32 ret, int n, Field *args, int dots)
-{
-    uint32 i;
-    Type  *t;
-
-    i = type();
-    t = C.type.info + i;
-    t->kind  = Tfunc;
-    t->size  = pointer.size;
-    t->align = pointer.align;
-    t->sign  = pointer.sign;
-
-    t->func.ret  = ret;
-    t->func.n    = n; 
-    t->func.arg  = args;
-    t->func.dots = dots;
-
-    return i;
-}
-
-#define ALIGN_DOWN(n, a) ((n) & ~((a)-1))
-#define ALIGN_UP(n, a) ALIGN_DOWN((n) + (a)-1, (a))
-uint32
-structtype(int n, Field *field, Expr *bits)
-{
-    uint32 i;
-    Type  *t;
-    Field *f, *e;
-
-    i = type();
-    t = C.type.info + i;
-    t->kind  = Tstruct;
-    t->size  = 0;
-    t->align = 0;
-    for (f = field, e = field+n; f != e; ++f) {
-        t->size += C.type.info[f->type].size + ALIGN_UP(t->size, C.type.info[f->type].align);
-        t->align = MAX(t->align, C.type.info[f->type].align);
-    }
-    t->aggr.len = n;
-    t->aggr.f   = field;
-    t->aggr.x   = bits;
-
-    return i;
-}
-
-uint32
-uniontype(int n, Field *field, Expr *bits)
-{
-    uint32 i;
-    Type  *t;
-    Field *f, *e;
-
-    i = type();
-    t = C.type.info + i;
-    t->kind  = Tstruct;
-    t->size  = 0;
-    t->align = 0;
-    for (f = field, e = field+n; f != e; ++f) {
-        t->size  = MAX(t->size, C.type.info[f->type].size); 
-        t->align = MAX(t->align, C.type.info[f->type].align);
-    }
-    t->aggr.len = n;
-    t->aggr.f   = field;
-    t->aggr.x   = bits;
-
-    return i;
-}
-
-uint32
-enumtype(int n, string *elts, Expr *vals)
-{
-    uint32 i;
-    Type  *t;
-    Field *f, *e;
-
-    i = type();
-    t = C.type.info + i;
-    t->kind  = Tenum;
-    /* TODO: dont hardcode int32 */
-    t->size  = 4;
-    t->align = 4;
-    t->enm.len = n;
-    t->enm.elt = elts;
-    t->enm.val = vals;
-
-    return i;
-}
-#undef ALIGN_UP
-#undef ALIGN_DOWN
-
-/* unpacking C declarations into sensible types */
-static
-uint32
-typeofname(Name *name, uint32 base)
-{
-    switch (name->kind) {
-    /* Nnil corresponds to an abstract declarator (i.e. no identifier) */
-    case Nnil:
-    case Nident:
-        return base;
-    case Nparen:
-        return typeofdtor(name->paren, base);
-    case Nindex:
-        return typeofname(name->sfx.name, arraytype(base, name->sfx.idx.q, name->sfx.idx.x));
-    case Ncall:
-        return typeofname(name->sfx.name, functype(base, name->sfx.call.n, name->sfx.call.arg, name->sfx.call.dots));
-    default:
-        panicf("unreachable");
-    }
-    return 0;
-}
-
-static
-uint32
-typeofdtor(Dtor *decl, uint32 base)
-{
-    int    n;
-    Ptr   *p;
-    uint64 b, tmp;
-
-    n = 0;
-    p = &decl->ptr;
-    b = p->kind;
-    while (b & 1) {
-        base = ptrtype(base, b >> 1);
-        if (++n >= 8) {
-            p = p->link;
-            b = p->kind;
-        } else {
-            b >>= 6;
-        }
-    }
-
-    return typeofname(decl->name, base);
-}
-
-static
-uint32
-basetype(Parser *p, Lexer *lx, uint64 *s)
-{
-    int    n;
-    uint64 m;
-    
-    if (spec(p, lx, s)) {
-        errorat(lx->pos, "failed to parse type specifier");
-        return 0;
-    }
-    
-    m = (((*s<<32)>>32) & ~(MaskQul|MaskMem|MaskFcn));
-    for (n = 0; n < arrlen(validtypespec); n++) {
-        if (validtypespec[n] == m) {
-            if (indextypespec[n] < 0) {
-                m = *s >> 32;
-                if (!m) {
-                    errorat(lx->pos, "not a valid type identifier");
-                    return 0;
-                }
-                return m;
-            }
-            return indextypespec[n];
-        }
-    }
-
-    errorat(lx->pos, "invalid type specifier");
-    return 0;
-}
-
-static
-string
-namedecl(Parser *p, Lexer *lx, uint32 *base, int noname)
-{
-    Dtor    *dt;
-    string name;
-    Type    *t;
-
-    dt   = getdtor(p);
-    name = nil;
-    if (dtor(p, lx, dt, noname)) {
-        errorat(lx->pos, "invalid declarator");
-        goto End;
-    }
-    if (!noname || noname == 2 && dt->name->kind)
-        name = nameof(dt->name);
-
-    *base = typeofdtor(dt, *base);
-    putdtor(p, dt);
-    return name;
-End:
-    putdtor(p, dt);
-    return nil;
-}
-
-// -----------------------------------------------------------------------
-// declarations
-
-static
-uint32
-enumerate(Parser *p, Lexer *lx, string name, int kind)
-{
-    int    i, n;
-    uint64 s;
-    uint32 t;
-    Token  tk;
-    /* TODO: think of a better soln */
-    string  nm[1024], *elts;
-    Expr   *cx[1024], *vals;
-
-    for (n = 0; tk.kind != Arbrace && n < arrlen(nm); n++) {
-        if (tk.kind != Aident) {
-            errorat(tk.pos, "invalid token %s in enum declaration", tokens[tk.kind]);
-            goto Bad;
-        }
-        nm[n] = tk.val.s; 
-        cx[n] = nil;
-
-        tk = advance(p, lx);
-        switch(tk.kind) {
-        case Aeq:
-            advance(p, lx);
-            cx[n] = expr(p, lx);
-            tk = peek(p, 0);
-            if (tk.kind != Acomma)
-                continue;
-            /* fallthrough */
-        case Acomma:
-            tk = advance(p, lx);
-        }
-    }
-    copyarray(elts, nm, n);
-    copyarray(vals, cx, n);
-
-    t = enumtype(n, elts, vals); 
-    declareenum(p, n, elts, vals);
-    return t;
-Bad:
-    errorat(tk.pos, "failed to parse enum declaration");
-    return 0;
-}
-
-static
-uint32
-aggregate(Parser *p, Lexer *lx, string name, int kind)
-{
-    int    n;
-    uint64 s;
-    Token  tk;
-    /* TODO: think of a better soln */
-    static Field fs[1024];
-    Field *f;
-    static Expr *cx[1024];
-    Expr  *x;
-
-    for (n = 0, tk = peek(p, 0); tk.kind != Arbrace && n < arrlen(fs); n++) {
-        fs[n].type = basetype(p, lx, &s);
-        fs[n].qual = (uint32)(s & ~(MaskTyp|MaskInt|MaskFlt));
-    Field:
-        fs[n].name = namedecl(p, lx, &fs[n].type, 0);
-        tk    = peek(p, 0);
-        switch (tk.kind) {
-        case Acolon:
-            advance(p, lx);
-            cx[n] = expr(p, lx);
-            tk    = peek(p, 0);
-            if (tk.kind == Asemi) {
-                tk = advance(p, lx);
-                continue;
-            }
-            if (tk.kind != Acomma) {
-                errorat(tk.pos, "unrecognized token %s in struct field declaration", tokens[tk.kind]);
-                goto Bad;
-            }
-            /* fallthrough */
-        case Acomma:
-            advance(p, lx);
-            n++;
-            goto Field;
-
-        case Asemi:
-            tk = advance(p, lx);
-            continue;
-
-        default:
-            errorat(tk.pos, "unrecognized token %s in struct field declaration", tokens[tk.kind]);
-            goto Bad;
-        }
-    }
-    copyarray(f, fs, n);
-    copyarray(x, cx, n);
-    return (kind == Tstruct) ? structtype(n, f, x) : uniontype(n, f, x);
-Bad:
-    errorat(tk.pos, "failed to parse aggregate declaration");
-    return 0;
-}
-
-static
-error
-spec(Parser *p, Lexer *lx, uint64 *spec)
-{
-    Token  t;
-    int    n, i;
-    Sym   *typ;
-    string name;
-    uint32 tag;
-    uint64 s, sm;
-    static uint32 (*aggrfunc[2])(Parser *, Lexer *, string , int) = {aggregate, enumerate};
-
-    s = 0;
-    while (t = peek(p, 0), t.kind >= Aident) {
-        /* typename */
-        if (t.kind == Aident) {
-            typ = lookupobj(p, t.val.s);
-            if (!typ || (typ && typ->kind != Stype)) 
-                break;
-
-            sm = typ->type;
-            s |= (sm << 32 | Tname);
-            advance(p, lx);
-            continue;
-        }
-
-        /* keyword */
-        switch (n = t.val.i) {
-        case Kauto: case Kregister: case Kstatic: case Kextern: case Ktypedef: case Ktls:
-            if (s & MaskMem) {
-                errorat(lx->pos, "multiple storage class specifiers: second was %s", keywords[n]);
-                goto Bad;
-            }
-            break;
-
-        case Kinline: case Knoret:
-            if (s & Bit(n)) 
-                warnat(lx->pos, "duplicate %s function specifier", keywords[n]);
-            break;
-
-        case Kconst: case Kvolatile:
-            if (s & Bit(n))
-                warnat(lx->pos, "duplicate %s specifier found in declaration", keywords[n]);
-            break;
-
-        case Ksigned: case Kunsigned:
-            if (s & MaskSgn) {
-                if (s & Bit(n)) {
-                    warnat(lx->pos, "duplicated storage class specifier: second was %s", keywords[n]);
-                    break;
-                }
-                errorat(lx->pos, "multiple storage class specifiers");
-                goto Bad;
-            }
-            break;
-
-        case Kshort:
-            if (s & Tshort) {
-                warnat(lx->pos, "duplicated short specifier");
-                break;
-            }
-            break;
-
-        case Klong:
-            if ((s >> Klong) & 2) {
-                errorat(lx->pos, "cannot chain three or more long specifiers");
-                goto Bad;
-            }
-            s += Bit(n);
-            t  = advance(p, lx);
-            continue;
-
-        case Kvoid: case Kchar: case Kint: case Kfloat: case Kdouble:
-            if (s & MaskTyp) {
-                errorat(lx->pos, "more than one base type specified");
-                goto Bad;
-            }
-            break;
-
-        case Kstruct: case Kunion:
-            i = 0;
-            goto Aggr;
-        case Kenum:
-            i = 1;
-        Aggr:
-            if (s & (Tstruct | Tunion | Tenum)) {
-                errorat(lx->pos, "more than one aggregate/enum type specified");
-                goto Bad;
-            }
-            t  = advance(p, lx);
-            if (t.kind != Aident && t.kind != Albrace) {
-                errorat(t.pos, "enum specifier missing valid declaration");
-                goto Bad;
-            }
-
-            /* NOTE: This offset is needed to correctly obtain Tstruct */
-            n++;
-            name = nil;
-            tag  = 0;
-            if (t.kind == Aident) {
-                name = t.val.s;
-                t    = advance(p, lx);
-            }
-            if (t.kind == Albrace) {
-                /* TODO: we need check if the name exists. */
-                t   = advance(p, lx);
-                /* NOTE: This depends on the enum order. KEEP IN SYNC */
-                tag = aggrfunc[i](p, lx, name, Bit(n));
-                if (t = peek(p, 0), nomatch(t, Arbrace)) {
-                    errorat(t.pos, "invalid token %s in aggregate/enum declaration", tokens[t.kind]);
-                    goto Bad;
-                }
-                /* high bits encode the type index */
-                s |= (uint64)tag << 32;
-            }
-            /* TODO: if name does not exist, enter in an incomplete type! */
-            if (name)
-                declaretag(p, tag, name);
-
-            break;
-
-        default:
-            errorat(t.pos, "invalid keyword '%s' found in declaration specifier", keywords[n]); 
-        }
-
-        s |= Bit(n);
-        advance(p, lx);
-    }
-
-    *spec = s;
-    return 0;
-
-Bad:
-    /* TODO: serialize bitflags to string for nice error message */
-    errorat(lx->pos, "ignoring specifier");
-    *spec = Sbad;
-    return 1;
-}
-
-/* 
- * name declaration 
- * see dtor for valid values of ab 
- */
-static
-error
-name(Parser *p, Lexer *lx, Name **nmp, int ab)
-{
-    Token  t;
-    int n, k;
-    uint64 s;
-    Sym  *sym;
-    Name *nm, *tmp;
-
-    /* max args = 100 */
-    struct Field args[100];
-
-    nm = *nmp;
-    t  = peek(p, 0);
-    switch (k = t.kind) {
-    case Aident:
-        if (ab == 1) {
-            errorat(t.pos, "identifier not allowed in abstract declarator");
-            goto Bad;
-        }
-        nm->kind  = Nident;
-        nm->ident = t.val.s;
-        break;
-
-    case Alparen:
-        advance(p, lx);
-        nm->kind  = Nparen;
-        nm->paren = getdtor(p);
-        if (dtor(p, lx, nm->paren, ab)) {
-            putdtor(p, nm->paren);
-            nm->paren = nil;
-            errorat(lx->pos, "invalid declarator in parenthesis");
-            goto Bad;
-        }
-
-        t = peek(p, 0);
-        if (nomatch(t, Arparen)) {
-            putdtor(p, nm->paren);
-            nm->paren = nil;
-            errorat(lx->pos, "missing closing paren in declarator");
-            goto Bad;
-        }
-        break;
-
-    case Albrakt:
-        if (ab) 
-            goto Sfx;
-        errorat(lx->pos, "missing identifier in non-abstract declarator");
-        /* fallthrough */
-    default:
-        if (ab)
-            goto Sfx;
-        errorat(lx->pos, "invalid token '%s' in name declaration", tokens[k]);
-        goto Bad;
-    }
-
-    t = advance(p, lx);
-Sfx:
-    for (;;) {
-        switch (k = t.kind) {
-        case Albrakt:
-            tmp = getname(p);
-            tmp->kind = Nindex;
-            tmp->sfx.name = nm;
-
-            nm = tmp, tmp = nil;
-
-            t = advance(p, lx);
-            if (t.kind == Arbrakt) {
-                nm->sfx.idx.q = 0;
-            Iend:
-                nm->sfx.idx.x = nil;
-                t = advance(p, lx);
-                break;
-            }
-            if (t.kind == Astar) {
-                nm->sfx.idx.q = -1;
-            IStar:
-                nm->sfx.idx.x = nil;
-                t = advance(p, lx);
-                if (t.kind != Arbrakt) {
-                    errorat(t.pos, "invalid '*' syntax in index expression");
-                    goto Bad;
-                }
-                t = advance(p, lx);
-                break;
-            }
-
-            if (spec(p, lx, &s)) {
-                errorat(lx->pos, "invalid type qualifier list in index expression");
-                goto Bad;
-            }
-
-            nm->sfx.idx.q = (uint32)s;
-            t = peek(p, 0);
-
-            if (t.kind == Astar)
-                goto IStar;
-
-            if (t.kind == Arbrakt)
-                goto Iend;
-
-            nm->sfx.idx.x = expr(p, lx);
-            
-            t = peek(p, 0);
-            if (nomatch(t, Arbrakt)) {
-                errorat(t.pos, "unterminated index expression");
-                goto Bad;
-            }
-
-            t = advance(p, lx);
-            continue;
-
-        case Alparen:
-            tmp = getname(p);
-            tmp->kind = Ncall;
-            tmp->sfx.name = nm;
-
-            nm = tmp, tmp = nil;
-
-            t = advance(p, lx);
-            nm->sfx.call.n = 0;
-            switch (t.kind) {
-            case Arparen:
-                nm->sfx.call.arg = nil;
-                break;
-
-            case Aident:
-                sym = lookupobj(p, t.val.s);
-                if (!sym || (sym && sym->kind != Stype)) {
-                    while (t.kind == Aident) {
-                        if (nm->sfx.call.n >= arrlen(args))
-                            panicf("ident stack overflow");
-                        args[nm->sfx.call.n++] = (struct Field) {
-                            .qual = 0,
-                            .type = 0,
-                            .name = t.val.s,
-                        };
-                        t = advance(p, lx);
-                    }
-                    if (nomatch(t, Arparen)) {
-                        errorat(t.pos, "token '%s' found in function parameter identifier list");
-                        goto Bad;
-                    }
-                    copyarray(nm->sfx.call.arg, args, nm->sfx.call.n);
-                    break;
-                }
-                goto ParamLoop;
-
-            case Akeywd:
-                if (t.val.i < Kconst || t.val.i > Kenum) {
-                    errorat(t.pos, "invalid keyword %s inside function signature");
-                    goto Bad;
-                }
-
-            ParamLoop:
-                if (nm->sfx.call.n >= arrlen(args)-1)
-                    panicf("out of argument buffer");
-
-                args[nm->sfx.call.n].type = basetype(p, lx, &s);
-                if (!args[nm->sfx.call.n].type) {
-                    errorat(lx->pos, "could not parse base type in function call");
-                    goto Bad;
-                }
-
-                args[nm->sfx.call.n].qual = (uint32)s & ~(MaskTyp|MaskInt|MaskFlt);
-                args[nm->sfx.call.n].name = namedecl(p, lx, &args[nm->sfx.call.n].type, 2);
-
-                nm->sfx.call.n++;
-                if ((t = peek(p, 0)).kind == Acomma) {
-                    advance(p, lx);
-                    goto ParamLoop;
-                }
-
-                if (t.kind == Aellip) {
-                    nm->sfx.call.dots = 1;
-                    t = advance(p, lx);
-                }
-
-                if (nomatch(t, Arparen)) {
-                    errorat(t.pos, "token '%s' found in function parameter list");
-                    goto Bad;
-                }
-                copyarray(nm->sfx.call.arg, args, nm->sfx.call.n);
-                break;
-
-            default:
-                errorat(t.pos, "invalid token %s inside function call signature", tokens[t.kind]);
-                goto Bad;
-            }
-
-            t = advance(p, lx);
-            continue;
-
-        default:
-            break;
-        }
-        break;
-    }
-
-    *nmp = nm;
-    return 0;
-Bad:
-    return 1;
-}
-
-/* pointer kind is partitioned into 8x6 regions 
- * ab => abstract
- *      @ 0: must have identifier
- *      @ 1: must not have identifier
- *      @ 2: don't care
- *      else: undefined
- */
-static
-error
-dtor(Parser *p, Lexer *lx, Dtor *d, int ab)
-{
-    int n, k;
-    error err;
-    Token t;
-    Dtor *link;
-    Ptr *ptr, *x;
-
-    err = 1;
-
-    ptr = &d->ptr;
-    ptr->kind = 0;
-    ptr->link = nil;
-
-    t = peek(p, 0);
-    if (t.kind != Astar) {
-        if (ab || t.kind == Aident || t.kind == Arparen)
-            goto Name;
-        goto Bad;
-    }
-    n = 0;
-Ptr:
-    ptr->kind |= Bit(n);
-    advance(p, lx);
-Key:
-    t = peek(p, 0);
-    switch (k = t.kind) {
-    case Akeywd:
-        if (Kconst <= t.val.i && t.val.i <= Katomic) 
-            ptr->kind |= Bit(6*n + (t.val.i - Kconst + 1));
-        else {
-            errorat(lx->pos, "invalid keyword '%s' modifies pointer", keywords[t.val.i]);
-            goto Bad;
-        }
-        advance(p, lx);
-        goto Key;
-            
-    case Astar:
-        if (++n >= 8) {
-            x = getptr(p);
-            x->kind   = 0;
-            x->link   = nil;
-            ptr->link = x;
-            ptr       = x;
-            n = 0;
-        }
-        goto Ptr;
-
-    case Aident:
-    case Alparen:
-        goto Name;
-
-    default:
-        if (ab)
-            goto Name;
-        errorat(lx->pos, "invalid token '%s' modifies pointer specification", tokens[t.kind]);
-        goto Bad;
-    }
-Name:
-    return name(p, lx, &d->name, ab);
-Bad:
-    return err;
-}
-
-static
-Decl *
-decl(Parser *p, Lexer *lx)
-{
-    uint64 s;
-    Token  t;
-    Decl  *d;
-    Expr  *x;
-    string name;
-    struct Decls *ds;
-    uint32 base, type;
-
-    alloc(d);
-
-    d->kind    = 0;
-    d->pos.beg = lx->pos;
-
-    base = basetype(p, lx, &s);
-    if (!base) {
-        errorat(lx->pos, "could not parse type declaration");
-        goto Bad;
-    }
-
-    x       = nil;
-    d->spec = (uint32)s & ~(MaskInt|MaskFlt|MaskTyp);
-    d->type = base;
-    d->name = namedecl(p, lx, &d->type, 0);
-    /* TODO: think about functions (both decls and defs) */
-    d->kind = (s & Mtype) ? Dtype : Dvar;
-
-    switch (t = peek(p, 0), t.kind) {
-    case Aeq:
-        if (s & Mtype) {
-            errorat(d->pos.beg, "initialization of type not allowed");
-            goto Bad;
-        }
-        t = advance(p, lx);
-        x = initx(p, lx);
-        d->kind = Dvar;
-        if (t.kind != Acomma) {
-            d->init = x;
-            goto Semi;
-        }
-    /* fallthrough */
-    case Acomma:
-        d->kind     |= Dlist;
-        d->list.init = x;
-        /* move singleton data over */
-        name         = d->name;
-        type         = d->type;
-        d->list.name = name;
-        d->list.type = type;
-        ds           = &d->list;
-        /* iterate until we hit end of list */
-        while (t.kind == Acomma) {
-            t  = advance(p, lx);
-
-            alloc(ds->link);
-            ds = ds->link;
-            ds->type = base;
-            ds->name = namedecl(p, lx, &ds->type, 0);
-
-            t = peek(p, 0);
-            if (t.kind == Aeq) {
-                t = advance(p, lx);
-                ds->init = initx(p, lx);
-            } else
-                ds->init = nil;
-        }
-        goto Semi;
-
-    case Albrace:
-        d->kind = Dfunc;
-        alloc(d->body);
-
-        if (!attop(p)) {
-            errorat(lx->pos, "nested function declarations are illegal");
-            goto Bad;
-        }
-
-        if (C.type.info[d->type].kind != Tfunc) {
-            errorat(lx->pos, "attempted to define function body for non function type");
-            goto Bad;
-        }
-
-        openscope(p);
-        if (blkstmt(p, lx, &d->body)) {
-            errorat(lx->pos, "failed to parse function body");
-            goto Bad;
-        }
-        closescope(p);
-        break;
-
-    default:
-    Semi:
-        if (nomatch(t, Asemi)) {
-            errorat(t.pos, "no semicolon after declaration");
-            goto Bad;
-        }
-        t = advance(p, lx);
-    }
-
-    d->pos.end = lx->pos;
-    declareobj(p, d);
-    return d;
-Bad:
-    errorat(lx->pos, "failed to parse top level declaration");
-    return nil;
-}
-
-// -----------------------------------------------------------------------
-// top level api
-
-void
-setup(Parser *p, Lexer *lx)
-{
-    advance(p,lx);
-    advance(p,lx);
-
-    /* define all builtin typedefs */
-    declareobj(p, &C.builtin.vargs);
-}
-
-error
-parse(Parser *p, Lexer *lx)
-{
-    Token tok;
-
-    setup(p, lx);
-    while ((tok = peek(p, 0)), tok.kind > Aeof) {
-        if (p->ast.len >= p->ast.cap) {
-            p->ast.cap  += 20;
-            p->ast.decls = realloc(p->ast.decls, p->ast.cap*sizeof(*p->ast.decls));
-        }
-        p->ast.decls[p->ast.len++] = decl(p, lx);
-    }
-
-    return 0;
-}
diff --git a/sys/cmd/cc/bits.c b/sys/cmd/cc/bits.c
deleted file mode 100644
index 4b405dc..0000000
--- a/sys/cmd/cc/bits.c
+++ /dev/null
@@ -1,114 +0,0 @@
-#include "cc.h"
-
-// -----------------------------------------------------------------------
-// Architecture
-
-enum 
-{
-    archx64,
-    numarch,
-};
-
-// -----------------------------------------------------------------------
-// Types
-
-/* 
- * enumerated type specifers 
- * see https://en.wikipedia.org/wiki/C_data_types
- */
-#define VOID      X(Tvoid, 2)
-
-#define BOOL      X(Tbool, 3)
-#define CHAR      X(Tchar, 4)
-#define SCHAR     X(Tsign|Tchar, 5)
-#define UCHAR     X(Tunsign|Tchar, 6)
-
-#define SHORT     X(Tshort, 7), X(Tshort|Tint, 7)
-#define SSHORT    X(Tsign|Tshort, 8), X(Tsign|Tshort|Tint, 8)
-#define USHORT    X(Tunsign|Tshort, 9), X(Tunsign|Tshort|Tint, 9)
-
-#define INT       X(0, 10), X(Tint, 10)
-#define SINT      X(Tsign, 11), X(Tsign|Tint, 11)
-#define UINT      X(Tunsign, 12), X(Tunsign|Tint, 12)
-
-#define LONG      X(Tlong, 13), X(Tlong|Tint, 13)
-#define SLONG     X(Tsign|Tlong, 14), X(Tsign|Tlong|Tint, 14)
-#define ULONG     X(Tunsign|Tlong, 15), X(Tunsign|Tlong|Tint, 15)
-
-#define VLONG     X(Tvlong, 16), X(Tvlong|Tint, 16)
-#define SVLONG    X(Tsign|Tvlong, 17), X(Tsign|Tvlong|Tint, 17)
-#define UVLONG    X(Tunsign|Tvlong, 18), X(Tunsign|Tvlong|Tint, 18)
-
-#define FLOAT     X(Tfloat, 19)
-#define DOUBLE    X(Tdouble, 20)
-#define LONGDB    X(Tlong|Tdouble, 21)
-#define COMPLEX   X(Tcmplx, 22)
-#define IMAGINARY X(Timag, 23)
-
-/* fixed width definitions */
-#define DEF(sz, aln, mx, sgn) {.size=sz, .align=aln, .max=mx, .sign=sgn }
-
-#define  INT8  DEF(1, 1, 0x7fff, 0)
-#define UINT8  DEF(1, 1, 0xffff, 1)
-
-#define  INT16 DEF(2, 2, 0x7fff, 0)
-#define UINT16 DEF(2, 2, 0xffff, 1)
-
-#define  INT32 DEF(4, 4, 0x7fffffff, 0)
-#define UINT32 DEF(4, 4, 0xffffffff, 1)
-
-#define  INT64 DEF(8, 8, 0x7fffffffffffffff, 0)
-#define UINT64 DEF(8, 8, 0xffffffffffffffff, 1)
-
-/* architecture specific definitions */
-// TODO: max value should be able to take floats
-#define TYPES                             \
-    TYPE(DEF(0, 0, 0, 0), VOID)           \
-    TYPE(INT8, BOOL)                      \
-    TYPE(UINT8, CHAR)                     \
-    TYPE(INT8, SCHAR)                     \
-    TYPE(UINT8, UCHAR)                    \
-    TYPE(INT16, SHORT)                    \
-    TYPE(INT16, SSHORT)                   \
-    TYPE(UINT16, USHORT)                  \
-    TYPE(INT32, INT)                      \
-    TYPE(INT32, SINT)                     \
-    TYPE(UINT32, UINT)                    \
-    TYPE(INT64, LONG)                     \
-    TYPE(INT64, SLONG)                    \
-    TYPE(UINT64, ULONG)                   \
-    TYPE(INT64, VLONG)                    \
-    TYPE(INT64, SVLONG)                   \
-    TYPE(UINT64, UVLONG)                  \
-    TYPE(DEF(4, 4, 0, 0), FLOAT)          \
-    TYPE(DEF(8, 8, 0, 0), DOUBLE)         \
-    TYPE(DEF(16, 16, 0, 0), LONGDB)       \
-    TYPE(DEF(8, 8, 0, 0), COMPLEX)        \
-    TYPE(DEF(4, 4, 0, 0), IMAGINARY)      \
-
-Type pointer = {.size=8, .align=8, .max=0xffffffffffffffff, .sign=0};
-
-/* pack architecture specific definitions into exported arrays */
-#define TYPE(a, ...) a,
-Type basetypes[] = {
-    { 0 }, /* sentinel value for bad types */
-    { 0 }, /* sentinel value for variadic args */
-    TYPES
-};
-#undef TYPE
-
-#define TYPE(a, ...) __VA_ARGS__,
-#define X(a, b) a
-uint64 validtypespec[38] = {
-    TYPES
-    Tstruct, Tunion, Tenum, Tname,
-};
-#undef X
-
-#define X(a, b) b
-int indextypespec[38] = {
-    TYPES
-    -1, -1, -1, -1,
-};
-#undef X
-#undef TYPE
diff --git a/sys/cmd/cc/cc.c b/sys/cmd/cc/cc.c
deleted file mode 100644
index 8ad0022..0000000
--- a/sys/cmd/cc/cc.c
+++ /dev/null
@@ -1,409 +0,0 @@
-#include "cc.h"
-#include <libn/macro/map.h>
-
-// -----------------------------------------------------------------------
-// string interning
-
-/* jenkins' one at a time hash */
-static 
-int32
-hash_string(byte* s)
-{
-    int32 h;
-
-    h = 0; 
-    if (s != nil) {
-        for (; *s; ++s) {
-            h += *s;
-            h  = (h << 10);
-            h  = (h >> 6);
-        }
-    }
-
-    h += (h << 3);
-    h ^= (h >> 11);
-    h += (h >> 11);
-
-    return h;
-}
-
-static
-int
-streq(byte *s, byte *t)
-{
-    if (s == nil) {
-        if (t == nil) 
-            return 1;
-        else
-            return 0;
-    }
-
-    return (t == nil) ? 0 : strcmp(s, t) == 0;
-}
-
-#define HASH(s)      hash_string(s)
-#define EQUAL(s, t) (streq(s, t))
-static
-int
-getstr(string key, int *ok)
-{
-    int idx;
-    MAP_GET(idx, (&C.strs), key, HASH, EQUAL);
-
-    *ok = idx < C.strs.n_buckets;
-    return idx; 
-}
-
-static 
-void 
-·free(void* _, void* ptr) {
-    return free(ptr);
-}
-
-static 
-void *
-·alloc(void* _, uint n, ulong size) {
-    return malloc(n*size);
-}
-
-static 
-void *
-·calloc(void* _, uint n, ulong size) {
-    return calloc(n, size);
-}
-
-static
-int
-morestrtab(StrTab *tab, int n)
-{
-    MAP_GROW(tab, string, int32, n, HASH, ·calloc, ·free, nil);
-}
-
-static
-int
-putstr(byte *s, error *err)
-{
-    int sz;
-    sz = C.strs.size; 
-    MAP_PUT((&C.strs), s, sz, HASH, EQUAL, morestrtab, err);
-}
-#undef HASH
-#undef EQUAL
-
-int32
-intern(byte **s)
-{
-    int i, ok;
-
-    i = getstr(*s, &ok);
-    if (ok) {
-        *s = C.strs.keys[i];
-        goto END;
-    }
-
-    *s = str·make(*s);
-    i  = putstr(*s, &ok);
-    C.strs.vals[i] = C.strs.size - 1;
-
-END:
-    return C.strs.vals[i];
-}
-
-// -----------------------------------------------------------------------
-// type interning
-
-/* TODO: intern types for memory savings */
-int 
-type()
-{
-    if (C.type.len >= C.type.cap) {
-        C.type.cap += 100;
-        C.type.info = realloc(C.type.info, C.type.cap * sizeof(*C.type.info));
-    }
-
-    return C.type.len++;
-}
-
-// -----------------------------------------------------------------------
-// universal compiler builtins
-
-#define KEYWORD(a, b) b,
-byte *keywords[NUM_KEYWORDS] = { KEYWORDS };
-#undef KEYWORD
-
-#define DIRECTIVE(a, b, c) b,
-byte *directives[NUM_DIRECTIVES] = { DIRECTIVES };
-#undef DIRECTIVE
-
-struct Compiler C = { 0 }; 
-
-// -----------------------------------------------------------------------
-// cli flag handlers
-
-void
-pushinclude(byte *dirs)
-{
-    string d, s, *it, *end;
-
-    while (*dirs != '\0') {
-        d = strchr(dirs, ' ');
-        if (d != nil)
-            *d = '\0';
-
-        s = dirs;
-        intern(&s);
-        for (it = C.inc.dir, end = it + C.inc.len; it != end; ++it) {
-            if ((uintptr)s == (uintptr)(*it))
-                goto Nextdir;
-        }
-
-        if (C.inc.len == C.inc.cap) {
-            C.inc.cap += 20;
-            C.inc.dir = realloc(C.inc.dir, C.inc.cap*sizeof(*C.inc.dir));
-        }
-        C.inc.dir[C.inc.len++] = s;
-Nextdir:
-        if (d == nil)
-            break;
-        dirs = d + 1;
-    }
-}
-
-// -----------------------------------------------------------------------
-// error reporting
-
-void
-errorat(Pos x, byte *fmt, ...)
-{
-    va_list args;
-    va_start(args, fmt);
-
-    printf("error:%s:%d:%d: ", os·basename(x.path), x.line, x.col);
-    vprintf(fmt, args);
-    printf("\n");
-
-    va_end(args);
-    assert(0);
-}
-
-void
-warnat(Pos x, byte *fmt, ...)
-{
-    va_list args;
-    va_start(args, fmt);
-
-    printf("warning:%s:%d:%d: ", os·basename(x.path), x.line, x.col);
-    vprintf(fmt, args);
-    printf("\n");
-
-    va_end(args);
-}
-
-// -----------------------------------------------------------------------
-// main point of entry
-
-void
-init(void)
-{
-    int i;
-
-    for (i = 0; i < arrlen(keywords); i++)
-        intern(&keywords[i]);
-
-    for (i = 0; i < arrlen(directives); i++)
-        intern(&directives[i]);
-
-    C.heap = mem·makearena(mem·sys, nil);
-
-    /* compiler definitions */
-    C.def.len = 0;
-    C.def.cap = 100;
-    C.def.val = calloc(C.def.cap, sizeof(*C.def.val));
-
-    /* compiler include paths */
-    C.inc.len = 0;
-    C.inc.cap = 100;
-    C.inc.dir = calloc(C.inc.cap, sizeof(*C.inc.dir));
-    C.inc.dir[C.inc.len++] = ".";
-
-    C.outfile  = nil;
-
-    /* type info */
-    C.type.len  = arrlen(basetypes);
-    C.type.cap  = 100 + arrlen(basetypes);
-    C.type.info = calloc(C.type.cap, sizeof(*C.type.info));
-
-    memcpy(C.type.info, basetypes, C.type.len * sizeof(*C.type.info));
-
-    /* builtins */
-    C.builtin.vargs = (Decl) {
-        .pos = (Range) {
-            .beg = {
-                .col  = 0,
-                .line = 0,
-                .path = "<builtin>",
-            },
-            .end = {
-                .col  = 0,
-                .line = 0,
-                .path = "<builtin>",
-            },
-        },
-        .kind = Dtype,
-        .spec = Mtype,
-        .type = 1,
-        .name = "__builtin_va_list",
-    };
-
-    intern(&C.builtin.vargs.name);
-}
-
-void
-initlx(Lexer *lx)
-{
-    int i;
-
-    memset(lx, 0, sizeof(*lx));
-    lx->b = lx->buf;
-
-    /* predefine macros */
-    dodefine(lx, "__LINE__");
-    dodefine(lx, "__FILE__");
-    lx->macline = (uintptr)lookup(&lx->sym, "__LINE__");
-    lx->macfile = (uintptr)lookup(&lx->sym, "__FILE__");
-
-    for (i = 0; i < C.def.len; i++) 
-        dodefine(lx, C.def.val[i]);
-
-    lx->omit.len  = 0;
-    lx->omit.cap  = 100;
-    lx->omit.path = calloc(lx->omit.cap, sizeof(*C.inc.dir));
-
-    lx->new = lx->iostk;
-    lx->new->link = nil;
-    memset(lx->iostk, 0, sizeof(lx->iostk));
-
-    lx->sym = (SymTab){ 0 };
-}
-
-void
-freelx(Lexer *lx)
-{
-    free(lx->omit.path);
-}
-
-void
-initp(Parser *p)
-{
-    /* initialize temporary buffers */
-    memset(p->spstk, 0, sizeof(p->spstk));
-    memset(p->nmstk, 0, sizeof(p->nmstk));
-    memset(p->dtstk, 0, sizeof(p->dtstk));
-    memset(p->ptstk, 0, sizeof(p->ptstk));
-
-    p->sp = p->spstk;
-    p->nm = p->nmstk;
-    p->dt = p->dtstk;
-    p->pt = p->ptstk;
-
-    /* initialize ast */
-    p->ast.cap   = 0;
-    p->ast.len   = 0;
-    p->ast.decls = nil;
-}
-
-error
-compile(byte *path)
-{
-    Lexer  lx;
-    Parser p;
-    error  err;
-    byte *sep, out[400];
-
-    intern(&path);
-    strcpy(out, path);
-
-    sep = utf8·findrrune(out, '/');
-    if (sep) 
-        *sep++ = '\0';
-    else
-        sep = out; 
-
-    if (!C.outfile) {
-        C.outfile = sep;
-        if (C.outfile) {
-            if ((sep = utf8·findrrune(C.outfile, '.'))) {
-                sep[0] = '.';
-                sep[1] = 'o';
-                sep[2] = '\0';
-            }
-        } else {
-            C.outfile = "/dev/null";
-        }
-    }
-
-    initlx(&lx);
-    initp(&p);
-
-    lx.io  = openio(&lx, path);
-    lx.pos = (Pos){
-        .path = path,
-        .line = 1,
-        .col  = 1,
-    };
-
-    err = parse(&p, &lx);
-    freelx(&lx);
-    return err;
-}
-
-error
-main(int argc, byte *argv[])
-{
-    byte *a, *src;
-    int   err;
-
-    init();
-
-    ARGBEGIN {
-    case 'o':
-        C.outfile = ARGF();
-        break;
-
-    case 'D':
-        a = ARGF();
-        if (a) {
-            intern(&a);
-            if (C.def.len >= C.def.cap) {
-                C.def.cap += 20;
-                C.def.val = realloc(C.def.val, C.def.cap * sizeof(*C.def.val));
-            }
-            C.def.val[C.def.len++] = a;
-        }
-        break;
-
-    case 'I':
-        a = ARGF();
-        if (a)
-            pushinclude(a);
-        break;
-    } ARGEND
-
-    if (argc < 1 && C.outfile == nil) {
-        printf("usage: cc [-options] files\n");
-        exit(1);
-    }
-
-    // NOTE: This is just for my comfort during debugging.
-    pushinclude("/home/nolln/root/include");
-    pushinclude("/home/nolln/root/include/vendor/libc");
-
-    src = (argc == 0) ? "<stdin>" : argv[0];
-    intern(&src);
-
-    if ((err = compile(src)), err) {
-        exit(2);
-    }
-
-    exit(0);
-}
diff --git a/sys/cmd/cc/cc.h b/sys/cmd/cc/cc.h
deleted file mode 100644
index 8fc5f73..0000000
--- a/sys/cmd/cc/cc.h
+++ /dev/null
@@ -1,806 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <libn.h>
-
-#define iota(x) 1 << (x)
-
-/* core types */
-typedef struct Io    Io;
-typedef struct Pos   Pos;
-typedef struct Range Range;
-typedef struct Token Token;
-
-typedef struct Lexer Lexer;
-
-typedef struct Sym   Sym;
-typedef struct Type  Type;
-typedef struct Scope Scope;
-
-typedef struct Parser Parser;
-
-typedef struct Ptr   Ptr;
-typedef struct Name  Name;
-typedef struct Dtor  Dtor;
-typedef struct Field Field;
-
-typedef struct Node  Node;
-typedef struct Decl  Decl;
-typedef struct Stmt  Stmt;
-typedef struct Expr  Expr;
-
-typedef struct SymTab SymTab;
-typedef struct StrTab StrTab;
-
-typedef struct Compiler Compiler;
-
-/* keywords of language */
-#define KEYWORDS                       \
-    KEYWORD(Kauto,"auto")              \
-    KEYWORD(Kregister,"register")      \
-    KEYWORD(Kstatic,"static")          \
-    KEYWORD(Kextern,"extern")          \
-    KEYWORD(Ktls,"thread_local")       \
-    KEYWORD(Ktypedef,"typedef")        \
-    KEYWORD(Kinline,"inline")          \
-    KEYWORD(Knoret,"_Noreturn")        \
-    KEYWORD(Kconst,"const")            \
-    KEYWORD(Kvolatile,"volatile")      \
-    KEYWORD(Krestrict,"restrict")      \
-    KEYWORD(Katomic,"_Atomic")         \
-    KEYWORD(Ksigned,"signed")          \
-    KEYWORD(Kunsigned,"unsigned")      \
-    KEYWORD(Kvoid,"void")              \
-    KEYWORD(Kbool,"_Bool")             \
-    KEYWORD(Kchar,"char")              \
-    KEYWORD(Kfloat,"float")            \
-    KEYWORD(Kdouble,"double")          \
-    KEYWORD(Kcomplex,"complex")        \
-    KEYWORD(Kimaginary,"imaginary")    \
-    KEYWORD(Kint,"int")                \
-    KEYWORD(Kshort,"short")            \
-    KEYWORD(Klong,"long")              \
-    KEYWORD(Kstruct,"struct")          \
-    KEYWORD(Kunion,"union")            \
-    KEYWORD(Kenum,"enum")              \
-    KEYWORD(Kfor,"for")                \
-    KEYWORD(Kdo,"do")                  \
-    KEYWORD(Kwhile,"while")            \
-    KEYWORD(Kcontinue,"continue")      \
-    KEYWORD(Kif,"if")                  \
-    KEYWORD(Kelse,"else")              \
-    KEYWORD(Kswitch,"switch")          \
-    KEYWORD(Kcase,"case")              \
-    KEYWORD(Kdefault,"default")        \
-    KEYWORD(Kbreak,"break")            \
-    KEYWORD(Kgoto,"goto")              \
-    KEYWORD(Kreturn,"return")          \
-    KEYWORD(Ksizeof,"sizeof")          \
-    KEYWORD(Kalignof,"alignof")        \
-    KEYWORD(Kalignas,"alignas")        
-
-#define KEYWORD(a, b) a,
-enum { KEYWORDS NUM_KEYWORDS };
-#undef KEYWORD
-
-extern byte *keywords[NUM_KEYWORDS];
-
-// -----------------------------------------------------------------------
-// lexing: byte stream -> tokens
-// pre-processor built in
-
-/* source position: error reporting */
-struct Pos
-{
-    int    col;
-    int    line;
-    string path;
-};
-
-
-struct Range
-{
-    Pos beg;
-    Pos end;
-};
-
-void errorat(Pos x, byte *fmt, ...);
-void warnat(Pos x, byte *fmt, ...);
-
-/* pre-processor */
-#define DIRECTIVES                          \
-    DIRECTIVE(Dpragma,"pragma", ppprag)     \
-    DIRECTIVE(Dinclude,"include", ppinc)    \
-    DIRECTIVE(Ddefine,"define", ppdef)      \
-    DIRECTIVE(Dundef,"undef", ppund)        \
-    DIRECTIVE(Dif,"if", ppif0)              \
-    DIRECTIVE(Delif,"elif", ppif1)          \
-    DIRECTIVE(Delse, "else", ppif1)         \
-    DIRECTIVE(Difdef,"ifdef", ppif2)        \
-    DIRECTIVE(Difndef,"ifndef", ppif3)      \
-    DIRECTIVE(Dendif,"endif", ppend)        
-
-#define DIRECTIVE(a, b, c) a,
-enum { DIRECTIVES NUM_DIRECTIVES };
-#undef DIRECTIVE 
-
-extern byte *directives[NUM_DIRECTIVES]; 
-
-error  domacro(Lexer*);
-error  dodefine(Lexer *lx, string s);
-int    expandmacro(Lexer *lx, Sym *s, byte *dst);
-
-extern error (*macros[NUM_DIRECTIVES])(Lexer*); 
-
-/* tokenization of byte stream */
-#define TOKENS                   \
-    TOK(Anil,"nil")              \
-    TOK(Aeof,"eof")              \
-    TOK(Aeq, "==")               \
-    TOK(Aneq, "!=")              \
-    TOK(Anot, "!")               \
-    TOK(Aneg, "~")               \
-    TOK(Axor, "^")               \
-    TOK(Aor, "|")                \
-    TOK(Aand, "&")               \
-    TOK(Aoror, "||")             \
-    TOK(Aandand, "&&")           \
-    TOK(Aadd,"+")                \
-    TOK(Asub,"-")                \
-    TOK(Astar,"*")               \
-    TOK(Adiv,"/")                \
-    TOK(Amod,"%")                \
-    TOK(Agt,">")                 \
-    TOK(Alt,"<")                 \
-    TOK(Agteq,">=")              \
-    TOK(Alteq,"<=")              \
-    TOK(Alsft,"<<")              \
-    TOK(Arsft,">>")              \
-    TOK(Ainc,"++")               \
-    TOK(Adec,"--")               \
-    TOK(Aasn,"=")                \
-    TOK(Aorasn,"|=")             \
-    TOK(Axorasn,"^=")            \
-    TOK(Aandasn,"&=")            \
-    TOK(Aaddasn,"+=")            \
-    TOK(Asubasn,"-=")            \
-    TOK(Amulasn,"*=")            \
-    TOK(Adivasn,"/=")            \
-    TOK(Amodasn,"%=")            \
-    TOK(Alsftasn,"<<=")          \
-    TOK(Arsftasn,">>=")          \
-    TOK(Acomma,",")              \
-    TOK(Acolon,":")              \
-    TOK(Asemi,";")               \
-    TOK(Alparen,"(")             \
-    TOK(Arparen,")")             \
-    TOK(Albrace,"{")             \
-    TOK(Arbrace,"}")             \
-    TOK(Albrakt,"[")             \
-    TOK(Arbrakt,"]")             \
-    TOK(Adot,".")                \
-    TOK(Aarrow,"->")             \
-    TOK(Aqmark,"?")              \
-    TOK(Aellip,"...")            \
-    TOK(Alit,"<literal>")        \
-    TOK(Aident,"<identifier>")   \
-    TOK(Akeywd,"<keyword>")      \
-
-#define TOK(a, b) a,
-enum
-{
-    TOKENS
-    NUM_TOKENS,
-
-    Vchar  = iota(8),
-    Vrune  = iota(9),
-    Vint   = iota(10),
-    Vlong  = iota(11),
-    Vvlong = iota(12),
-    Vun    = iota(13),
-    Vfloat = iota(14),
-    Vstr   = iota(15),
-    Vwstr  = iota(16),
-
-    Vmask  = Vchar - 1,
-};
-#undef TOK
-
-extern byte *tokens[NUM_TOKENS];
-
-/* TODO: store literals in a big val */
-union Val
-{
-    byte  *s;
-    double f;
-    vlong  i;
-    uvlong ui;
-    int32  c;
-    uint32 uc;
-    rune   r;
-};
-
-struct Token
-{
-    uint32    kind;
-    Pos       pos;
-    union Val val;
-};
-
-enum
-{
-    Svar   = iota(1), 
-    Sfunc  = iota(2), 
-    Stype  = iota(3), 
-    Stag   = iota(4), 
-    Senum  = iota(5), 
-    Slabl  = iota(6), 
-    Smacro = iota(7), 
-};
-
-struct Sym
-{
-    uint32 kind;
-    string name;
-    union {
-        string macro;
-        Decl   *obj;
-        int32  type;
-        Stmt   *blk;
-        Expr   *val;
-    };
-};
-
-struct SymTab
-{
-  int32  n_buckets;
-  int32  size;
-  int32  n_occupied; 
-  int32  upper_bound;
-  int32  *flags;
-  string *keys;
-  Sym    **vals;
-};
-
-Sym  *define(SymTab *tab, string ident, uint32 kind);
-Sym  *lookup(SymTab *tab, string ident);
-error forget(SymTab *tab, string ident);
-void  forgetall(SymTab *tab);
-
-enum
-{
-    IOnil  = iota(0),
-    IOfile = iota(1),
-    IObuff = iota(2),
-};
-
-struct Io
-{
-    io·Buffer  rdr;
-    string     path;
-    uint32     kind;
-    union {
-        Stream  *f;
-        byte    *b;
-    };
-
-    Pos        store;
-    struct Io *link;
-};
-
-struct Lexer
-{
-    Pos     pos;
-    SymTab  sym;
-    byte   *b;
-    byte    buf[2*1024];
-
-    /* predefined dynamic macros */
-    uintptr macfile;
-    uintptr macline;
-
-    /* i/o data */
-    Io     *io, *new;
-    Io      iostk[100];
-    struct {
-        int      cap;
-        int      len;
-        string  *path;
-    } omit;
-};
-
-/* lex.c functions */
-Token lex(Lexer *);
-
-int   getbyte(Lexer *);
-int   getnsbyte(Lexer *l);
-rune  getrune(Lexer *);
-byte  ungetbyte(Lexer *);
-rune  ungetrune(Lexer *, rune r);
-
-Io*   openio(Lexer *lx, byte *path);
-void  pushio(Lexer *lx, Io *new);
-void  popio(Lexer *lx);
-
-void  puttok(Token);
-
-// -----------------------------------------------------------------------
-// parsing & type resolution
-// tokens -> ast
-
-/* parent data */
-struct Node
-{
-    Range   pos;
-    uint32  kind;
-};
-
-/* ast types */
-enum
-{
-    Nbad,
-    /* labels */
-    Sempty, Slabel, Scase, 
-    Sblock,
-    Sexpr, Sdecl,
-    Sselect,
-    /* loops */
-    Sfor, Swhile, Sdo, 
-    /* jumps */
-    Sgoto, Scontin, Sbreak, Sreturn, 
-    /* forks */
-    Sif, Sswitch, 
-
-
-    /* assignments */
-    Xasn, Xmulasn, Xdivasn, Xmodasn, Xsubasn, Xaddasn, 
-    Xlsftasn, Xrsftasn, Xandasn, Xxorasn, Xorasn,
-    /* conditional */
-    Xternary,
-    /* unary prefix ops  */
-    Xref, Xstar, Xplus, Xminus, Xneg, Xnot, Xsizeof, Xalignof, Xpreinc, Xpredec, 
-    Xcast, 
-    /* unary postfix ops */
-    Xpostinc, Xpostdec, Xindex, Xcall, Xselp, Xself, Xinitlist, 
-    /* binary ops */
-    Xoror, Xandand, Xor, Xxor, Xand, Xneq, Xeql, Xgt, Xlt, Xgteq, Xlteq, Xlsft, Xrsft, 
-    Xadd, Xsub, Xmul, Xdiv, Xmod,
-    /* primary */
-    Xparen, Xident, Xlit,  
-    /* lists */
-    Xcomma,
-    
-
-    Dvar,
-    Dfunc, 
-    Dtype,
-    Dlist  = iota(20),
-    Dvars  = Dvar  | Dlist,
-    Dtypes = Dtype | Dlist,
-
-    /* names (don't interact w/ final AST) */
-    Nnil = 0,
-    Nident,
-    Nparen,
-    Nindex,
-    Ncall,
-};
-
-/* expressions */
-enum
-{
-    Keynil,
-    Keyidx,
-    Keysel,
-};
-
-struct Key
-{
-    uint kind : 2;
-    union {
-        Expr  *x;
-        string s;
-    };
-};
-
-struct Expr
-{
-    struct  Node;
-    uint32  qual; 
-    uint32  type;
-    union {
-        string name;
-        struct {
-            uint64 kind;
-            union {
-                union Val;
-                union Val v;
-            };
-        } val;
-        struct {
-            int         n;
-            struct Key *k;
-            Expr       *v;
-        } init;
-        Expr *x;
-        struct {
-            Expr *l;
-            Expr *r;
-        } asn;
-        struct {
-            Expr *c;
-            Expr *t;
-            Expr *e;
-        } cond;
-        struct {
-            Expr *x;
-            union {
-                Expr  *i;
-                string f;
-            };
-        } idx;
-        struct {
-            Expr *fn;
-            int  n;
-            Expr **arg;
-        } call;
-        union {
-            Expr *pre;
-            Expr *post;
-        } unary;
-        struct {
-            int type : 1;
-            union {
-                struct {
-                    uint32 qual;
-                    uint32 type;
-                } of;
-                Expr *x;
-            };
-        } info;
-        struct {
-            struct {
-                uint32 qual;
-                uint32 type;
-            } to;
-            Expr   *x;
-        } cast;
-        struct {
-            Expr *l;
-            Expr *r;
-        } binary;
-        struct {
-            Expr *x[2];
-        } comma;
-    };
-};
-
-
-/* statements */
-struct Stmt
-{
-    struct Node;
-    union {
-        struct {
-            union {
-                string ident;
-                Expr  *x;
-            };
-            Node *stmt;
-        } lbl;
-        struct {
-            long             n;
-            struct Node **item;
-        } blk;
-        Expr *x;
-        struct {
-            Node *init;
-            Expr *cond;
-            Expr *step;
-            Node *body;
-        } loop;
-        union{
-            string lbl;
-            Expr  *x;
-        } jmp;
-        struct {
-            Expr *cond;
-            Node *body;
-            Node *orelse;
-        } br;
-    };
-};
-
-/* declarations */
-
-/* 
- * specifiers
- * the design is the following:
- * type info is held w/in a 64 bit integer.
- * the bottom 32 bits are associated to specializations 
- * the top 32 bits index into a type-info array held by the compiler.
- */
-enum
-{
-    /* memory */
-    Mauto   = iota(Kauto),
-    Mstatic = iota(Kstatic),
-    Mreg    = iota(Kregister),
-    Mtls    = iota(Ktls),
-    Mtype   = iota(Ktypedef),
-    Mextern = iota(Kextern),
-
-    MaskMem = Mauto | Mstatic | Mreg | Mtls | Mtype | Mextern,
-
-    /* qualifiers */
-    Qconst  = iota(Kconst),
-    Qrestr  = iota(Krestrict),
-    Qvoltl  = iota(Kvolatile),
-    Qatom   = iota(Katomic),
-
-    MaskQul = Qconst | Qrestr | Qvoltl | Qatom,
-
-    Finlne  = iota(Kinline),
-    Fnoret  = iota(Knoret),
-
-    MaskFcn = Finlne | Fnoret,
-
-    /* types */
-    Tsign   = iota(Ksigned),
-    Tunsign = iota(Kunsigned),
-
-    MaskSgn = Tsign | Tunsign,
-
-    Tvoid   = iota(Kvoid),
-    Tfloat  = iota(Kfloat),
-    Tdouble = iota(Kdouble),
-    Tcmplx  = iota(Kcomplex),
-    Timag   = iota(Kimaginary),
-
-    MaskFlt = Tfloat | Tdouble | Tcmplx | Timag,
-
-    Tchar   = iota(Kchar),
-    Tbool   = iota(Kbool),
-
-    Tshort  = iota(Kshort),
-    Tint    = iota(Kint),
-    Tlong   = iota(Klong),
-    Tvlong  = iota(Klong+1),
-
-    MaskInt = Tshort | Tint | Tlong | Tvlong,
-    MaskTyp = Tvoid | Tbool | Tchar | Tint | Tfloat | Timag | Tcmplx,
-    /* 
-     * NOTE IMPORTANT: vlong takes over the struct bit place 
-     * DON'T MOVE KEYWORDS WITHOUT REORGANIZING 
-     */
-    Tstruct = iota(Kstruct+1),
-    Tunion  = iota(Kunion+1),
-    Tenum   = iota(Kenum+1),
-    Tname   = iota(Kenum+2),
-
-    Sbad    = -1,
-};
-
-/* intermediate nodes */
-struct Ptr
-{
-    uint64  kind;
-    Ptr    *link;
-};
-
-struct Name 
-{
-    uint32 kind;
-    union {
-        string       ident;
-        struct Dtor *paren;
-        struct {
-            Name *name;
-            union {
-                struct {
-                    uint32 q;
-                    Expr  *x;
-                } idx;
-                struct {
-                    int n;
-                    int dots : 1; 
-                    Field *arg;
-                } call;
-            };
-        } sfx;
-    };
-};
-
-struct Dtor
-{
-    Ptr    ptr;
-    Name  *name;
-};
-
-/* final ast node */
-
-struct Field
-{
-    uint32 qual;
-    uint32 type;
-    string name;
-};
-
-struct Decls
-{
-    string name;
-    uint32 type;
-    Expr  *init;
-    struct Decls *link;
-};
-
-
-struct Decl
-{
-    struct Node;
-    uint32 spec;
-    union {
-        struct {
-            string name;
-            uint32 type;
-            union {
-                Stmt *body;
-                Expr *init;
-            };
-        };
-        struct Decls list;
-    };
-};
-
-enum
-{
-    Tbad,
-    Tbase,
-    Tdef,
-    Tptr,
-    Tarray,
-    Tfunc,
-};
-
-/* types */
-struct Type
-{
-    uint32  kind;
-    Sym     *sym;
-    uintptr size;
-    uintptr max;
-    uint16  align : 8;
-    uint8   sign  : 2;
-    union {
-        struct {
-            uint32 qual;
-            uint32 base;
-        } ptr;
-        struct {
-            int     len;
-            uint32 qual;
-            uint32 *elt;
-        } arr;
-        struct {
-            int   len;
-            Field *f;
-            Expr  *x;
-        } aggr;
-        struct {
-            int     len;
-            string *elt;
-            Expr   *val;
-        } enm;
-        struct {
-            uint32 ret;
-            int    n;
-            int    dots : 1;
-            Field *arg;
-        } func;
-    };
-};
-
-/* platform specific */
-extern Type   pointer;
-extern Type   basetypes[24];
-/* mandated by C standard */
-extern uint64 validtypespec[38];
-extern int    indextypespec[38];
-
-struct Scope
-{
-    SymTab tags;
-    SymTab objs;
-};
-
-struct Parser
-{
-    Token tok[2];
-    struct {
-        int     cap;
-        int     len;
-        Decl  **decls;
-    } ast;
-
-    /* static buffers/stacks */
-    Scope *sp;
-    Scope  spstk[40];
-
-    Name  *nm;
-    Name   nmstk[40];
-
-    Ptr   *pt;
-    Ptr    ptstk[10];
-
-    Dtor  *dt;
-    Dtor   dtstk[40];
-};
-
-/* ast.c functions */
-error parse(Parser *, Lexer *);
-
-// -----------------------------------------------------------------------
-// global compiler data
-
-struct StrTab
-{
-  int32  n_buckets;
-  int32  size;
-  int32  n_occupied; 
-  int32  upper_bound;
-  int32  *flags;
-  string *keys;
-  int32  *vals;
-};
-
-#if 0
-struct TypeSet
-{
-  int32  n_buckets;
-  int32  size;
-  int32  n_occupied; 
-  int32  upper_bound;
-  int32  *flags;
-  Type   **keys;
-};
-#endif
-
-/* main data */
-struct Compiler
-{
-    mem·Arena *heap;
-    StrTab     strs;
-    string     outfile;
-
-    struct {
-        int     cap;
-        int     len;
-        string *val;
-    } def;
-
-    struct {
-        int     cap;
-        int     len;
-        string *dir;
-    } inc;
-
-    struct {
-        int   cap;
-        int   len;
-        Type *info;
-    } type;
-
-    /* TODO: make array */
-    struct {
-        Decl vargs;
-    } builtin;
-};
-
-extern Compiler C;
-
-/* cc.c functions */
-void  init();
-int32 intern(byte **str);
-int32 type();
-
-#undef iota
diff --git a/sys/cmd/cc/lex.c b/sys/cmd/cc/lex.c
deleted file mode 100644
index 33fc5d0..0000000
--- a/sys/cmd/cc/lex.c
+++ /dev/null
@@ -1,873 +0,0 @@
-#include "cc.h"
-#include <libn/macro/map.h>
-
-// -----------------------------------------------------------------------
-// printing functions
-
-void
-puttok(Token tok)
-{
-    if (tok.kind < Alit)
-        printf("%s", tokens[tok.kind]);
-    else if (tok.kind & Alit) {
-        if (tok.kind & Vchar)
-        if (tok.kind & Vint)
-        if (tok.kind & Vlong)
-        if (tok.kind & Vvlong)
-            printf("literal <%lld>", tok.val.i); 
-        if (tok.kind & Vfloat)
-            printf("literal <%f>", tok.val.f); 
-        printf("literal <%s>", tok.val.s); 
-    } else 
-        printf("ident <%s>", tok.val.s);
-}
-
-// -----------------------------------------------------------------------
-// io buffer management
-
-#define asrdr(x) (io·Reader){(int (*)(void *, int, int, void *))x}
-
-// path should be absolute 
-Io*
-openio(Lexer *lx, byte *path)
-{
-    string *it, *end;
-
-    intern(&path);
-
-    // See if we have already opened file;
-    // If so, and it hasn't been flagged return it
-    for (it = lx->omit.path, end = it + lx->omit.len; it < end; ++it) {
-        if ((uintptr)(*it) == (uintptr)(path))
-            return nil;
-    }
-
-    // TODO: See if we have already loaded the file
-    
-    if ((lx->new - lx->iostk) >= arrlen(lx->iostk)-1) 
-        panicf("out of I/O space!");
-
-    lx->new->f = io·open(path, "r");
-    if (!lx->new->f)
-        panicf("file %s not found", path);
-
-    lx->new->kind = IOfile;
-    lx->new->path = path;
-    bufio·initreader(&lx->new->rdr, asrdr(io·read), lx->new->f);
-
-    return lx->new++;
-} 
-
-static
-Io*
-makeio(Lexer *lx, byte *name)
-{
-    if ((lx->new - lx->iostk) >= arrlen(lx->iostk)-1) 
-        panicf("out of I/O space!");
-
-    lx->new->path = name;
-    lx->new->rdr = (io·Buffer) {
-        .state    = bufio·rdr | bufio·end, 
-        .runesize = 0,
-        .h        = nil,
-        .size     = bufio·size,
-        .beg      = lx->new->rdr.buf + bufio·ungets,
-        .pos      = lx->new->rdr.buf + bufio·ungets,
-        .end      = lx->new->rdr.buf + bufio·ungets,
-    };
-    lx->new->b = lx->new->rdr.beg;
-
-    return lx->new++;
-} 
-#undef asrdr
-
-static
-void
-freeio(Lexer *lx, Io *io)
-{
-    if (io->kind & IOfile) {
-        io·close(io->f);
-    }
-
-    io->rdr.state = 0;
-    io->kind      = 0;
-    io->link      = nil;
-    io->path      = nil;
-    io->store     = (Pos){ 0 };
-    io->path      = "<empty>";
-}
-
-void
-pushio(Lexer *lx, Io *new)
-{
-    new->link     = lx->io;
-    lx->io->store = lx->pos;
-    lx->io        = new;
-
-    lx->pos = (Pos){
-        .line = 1,
-        .col  = 1,
-        .path = new->path,
-    };
-}
-
-void
-popio(Lexer *lx)
-{
-    Io *prev;
-
-    assert(lx->io == lx->new-1);
-    --lx->new;
-
-    prev = lx->io->link;
-    freeio(lx, lx->io);
-
-    lx->io = prev;
-    if (!prev) {
-        return;
-    }
-
-    lx->pos = prev->store;
-}
-
-// -----------------------------------------------------------------------
-// simple wrappers
-
-int
-getbyte(Lexer *lx)
-{
-    return bufio·getbyte(&lx->io->rdr);
-}
-
-int
-getnsbyte(Lexer *lx)
-{
-    int b;
-    b = getbyte(lx);
-    for (;;) {
-        if (b == EOF) {
-            if (lx->io->link) {
-                popio(lx);
-                assert(lx->io);
-                b = getbyte(lx);
-                continue;
-            } else
-                return b;
-        }
-        if (b >= RuneSelf || !isspace(b))
-            return b;
-        if (b == '\n')
-            return b;
-        b = getbyte(lx);
-    }
-    return b;
-}
-
-rune
-getrune(Lexer *lx)
-{
-    return bufio·getrune(&lx->io->rdr);
-}
-
-byte
-ungetbyte(Lexer *lx)
-{
-    byte b;
-    return bufio·ungetbyte(&lx->io->rdr, b);
-}
-
-rune
-ungetrune(Lexer *l, rune r)
-{
-    return bufio·ungetrune(&l->io->rdr, r);
-}
-
-// -----------------------------------------------------------------------
-// main lexer 
-
-#define TOK(a, b) b,
-byte *tokens[NUM_TOKENS] = { TOKENS };
-#undef TOK
-
-static uint8 Atoi[256] = 
-{
-    ['0'] = 0,  ['1'] = 1,  ['2'] = 2,  ['3'] = 3,  ['4'] = 4,  ['5'] = 5,
-    ['6'] = 6,  ['7'] = 7,  ['8'] = 8,  ['9'] = 9,  ['a'] = 10, ['A'] = 10,
-    ['b'] = 11, ['B'] = 11, ['c'] = 12, ['C'] = 12, ['d'] = 13, ['D'] = 13,
-    ['e'] = 14, ['E'] = 14, ['f'] = 15, ['F'] = 15,
-};
-
-static
-error
-escapechar(Lexer *lx, int x, int islong, int esc, vlong *val)
-{
-    int i, u, c;
-    vlong l;
-
-    c = getrune(lx);
-
-    switch (c) {
-    case '\\':
-        break;
-    case EOF: 
-        errorat(lx->pos, "EOF in string");
-        return 1;
-    case '\n':
-        errorat(lx->pos, "newline in string");
-        return 1;
-    default:
-        if (c == x) 
-            return 1;
-        *val = c;
-        return 0;
-    }
-
-    u = 0;
-	c = getrune(lx);
-
-	switch(c) {
-	case 'x':
-		i = islong ? 4 : 2;
-		goto hex;
-
-	case 'u':
-		i = islong ? 8 : 4;
-		u = 1;
-		goto hex;
-
-	case 'U':
-		i = 8;
-		u = 1;
-		goto hex;
-
-	case '0': case '1': case '2': case '3':
-	case '4': case '5': case '6': case '7':
-        i = islong ? 4 : 2;
-		goto oct;
-
-	case 'a': c = '\a'; break;
-	case 'b': c = '\b'; break;
-	case 'f': c = '\f'; break;
-	case 'n': c = '\n'; break;
-	case 'r': c = '\r'; break;
-	case 't': c = '\t'; break;
-	case 'v': c = '\v'; break;
-	case '\\':c = '\\'; break;
-
-	default:
-		if(c != x) errorat(lx->pos, "unknown escape sequence: %c", c);
-	}
-	*val = c;
-	return 0;
-
-hex:
-	l = 0;
-	for(; i > 0; i--) {
-		c = getbyte(lx);
-		if (c >= '0' && c <= '9') {
-			l = l*16 + c-'0';
-			continue;
-		}
-		if (c >= 'a' && c <= 'f') {
-			l = l*16 + c-'a' + 10;
-			continue;
-		}
-		if (c >= 'A' && c <= 'F') {
-			l = l*16 + c-'A' + 10;
-			continue;
-		}
-		ungetbyte(lx);
-		break;
-	}
-	if (u && (l > RuneMax || (0xd800 <= l && l < 0xe000))) {
-		errorat(lx->pos, "invalid unicode code point in escape sequence: %#llx", l);
-		l = RuneErr;
-	}
-	*val = l;
-    if (esc) 
-        *val |= RuneMask + 1;
-	return 0;
-
-oct:
-	l = c - '0';
-	for (; i > 0; i--) {
-		c = getbyte(lx);
-		if (c >= '0' && c <= '7') {
-			l = l*8 + c-'0';
-			continue;
-		}
-		ungetbyte(lx);
-        break;
-	}
-	if (l > 255) errorat(lx->pos, "octal escape value > 255: %d", l);
-
-	*val = l;
-    if (esc) 
-        *val |= RuneMask + 1;
-	return 0;
-}
-
-#define CASE1(stmt1, kind1)                                         \
-    case stmt1:                                                     \
-        tok.kind = kind1;                                           \
-        goto Return
-
-#define CASE2(stmt1, kind1, b1, kind2)                              \
-    case stmt1:                                                     \
-        tok.kind = kind1;                                           \
-        b = getbyte(lx);                                            \
-        if (b == b1)                                                \
-            tok.kind = kind2;                                       \
-        else                                                        \
-            ungetbyte(lx);                                          \
-        goto Return
-
-#define CASE3(stmt1, kind1, b1, kind2, b2, kind3)                   \
-    case stmt1:                                                     \
-        tok.kind =  kind1;                                          \
-        b = getbyte(lx);                                            \
-        if (b == b1)                                                \
-            tok.kind = kind2;                                       \
-        else if (b == b2)                                           \
-            tok.kind = kind3;                                       \
-        else                                                        \
-            ungetbyte(lx);                                          \
-        goto Return
-
-#define CASE4(stmt1, kind1, b1, kind2, b2, kind3, b3, type4)        \
-    case stmt1:                                                     \
-        tok.kind =  kind1;                                          \
-        b = getbyte(lx);                                            \
-        if (b == b1)                                                \
-            tok.kind = kind2;                                       \
-        else if (b == b2)                                           \
-            tok.kind = kind3;                                       \
-        else if (b == b3)                                           \
-            tok.kind = type4;                                       \
-        else                                                        \
-            ungetbyte(lx);                                          \
-        goto Return
-
-
-Token
-lex(Lexer *lx)
-{
-    int    b, n, f;
-    vlong  v, _;
-    rune   r;
-    string s;
-    double d;
-    byte  *e;
-    Token  tok;
-    Sym   *sym;
-    Io    *io;
-
-GetByte:
-    b = getbyte(lx);
-Dispatch:
-    tok.pos = lx->pos;
-
-    if ((b != EOF && b >= RuneSelf) || b == '_')
-        goto Talpha;
-    if (isalpha(b)) {
-        if (b != 'L')
-            goto Talpha;
-
-        n = b;
-        b = getbyte(lx);
-        if (b == '\'') {
-            if (escapechar(lx, '\'', 1, 0, &v)) 
-                b = '\'';
-            if (!escapechar(lx, '\'', 1, 0, &_)) {
-                errorat(lx->pos, "missing ' at end of character constant");
-            }
-            tok.kind  = Alit | Vrune;
-            tok.val.r = v;
-            goto Return;
-        }
-        if (b == '"')
-            goto TLstr;
-        ungetbyte(lx);
-        b = n;
-
-        goto Talpha;
-    }
-    if (isdigit(b))
-        goto Tnum;
-
-    switch (b) {
-    case '\n': 
-        lx->pos.line++;
-    case ' ': case '\r': case '\t': case '\v': case '\f':
-        while (b = getbyte(lx), isspace(b)) 
-            if (b == '\n') 
-                lx->pos.line++;
-        goto Dispatch;
-
-    case '\\':
-        b = getbyte(lx);
-        if (b != '\n')
-            errorat(lx->pos, "'\\' without a trailing newline");
-        goto GetByte;
-
-    Tchar:
-    case '\'':
-        if (escapechar(lx, '\'', 0, 0, &v)) {
-            errorat(lx->pos, "empty literal or escaped ' in char literal");
-            v = '\'';
-        }
-        if (!escapechar(lx, '\'', 0, 0, &_)) {
-            errorat(lx->pos, "missing '");
-            ungetbyte(lx);
-        }
-
-        if (v > 0xff) {
-            errorat(lx->pos, "overflowed character literal");
-            v = 0;
-        }
-        tok.kind  = Alit | Vchar;
-        tok.val.c = v;
-        goto Return;
-
-    case '"':
-        s = str·makecap("", 0, 8);
-        for (;;) {
-            if (escapechar(lx, '"', 0, 1, &v))
-                break;
-
-            if (v & (RuneMask + 1))
-                str·appendbyte(&s, v);
-            else {
-                r = v;
-                b = utf8·runelen(r);
-                utf8·runetobyte(lx->buf, &r);
-                str·appendlen(&s, b, lx->buf);
-            }
-        }
-        tok.kind  = Alit | Vstr;
-        tok.val.s = s; 
-        intern(&tok.val.s);
-
-        str·free(s);
-        goto Return;
-
-    TLstr:
-        s = str·makecap("", 0, 8);
-        // NOTE: this violates strict aliasing
-        for (;;) {
-            if (escapechar(lx, '"', 1, 0, &v))
-                break;
-            str·appendlen(&s, sizeof(wchar_t), (byte*)&v);
-        }
-        tok.kind  = Alit | Vwstr;
-        tok.val.s = s;
-        intern(&tok.val.s);
-
-        str·free(s);
-        goto Return;
-
-    case '.':
-        tok.kind = Adot;
-        b = getbyte(lx);
-
-        if (isdigit(b)) {
-            // *lx->b++ = b;
-            goto Tflt;
-        } else if (b == '.') {
-            b = getbyte(lx);
-            if (b != '.') {
-                errorat(lx->pos, "invalid token '..'");
-                tok.kind = Aellip;
-                break;
-            }
-        }
-        ungetbyte(lx);
-        goto Return;
-
-    case '<':
-        tok.kind = Alt;
-        b = getbyte(lx);
-
-        if (b == '<') {
-            tok.kind = Alsft;
-            b = getbyte(lx);
-            if (b == '=') 
-                tok.kind = Alsftasn;
-            else 
-                ungetbyte(lx);
-        } else if (b == '=') 
-            tok.kind = Alteq;
-        else 
-            ungetbyte(lx);
-        goto Return;
-
-    case '>':
-        tok.kind = Agt;
-        b = getbyte(lx);
-
-        if (b == '>') {
-            tok.kind = Arsft;
-            b = getbyte(lx);
-            if (b == '=') 
-                tok.kind = Arsftasn;
-            else 
-                ungetbyte(lx);
-        } else if (b == '=') 
-            tok.kind = Agteq;
-        else 
-            ungetbyte(lx);
-        goto Return;
-
-    case '/': 
-        tok.kind = Adiv;
-        b = getbyte(lx);
-
-        if (b == '=') 
-            tok.kind = Adivasn;
-        else if (b == '/') { 
-            while (b != EOF && b != '\n') 
-                b = getbyte(lx);
-            goto Dispatch;
-        } else if (b == '*') {
-            int level = 1;
-            b = getbyte(lx);
-            while (b != EOF && level > 0) {
-                if (b == '/') {
-                    b = getbyte(lx);
-                    if (b == '*') 
-                        level++;
-                } else if (b == '*') {
-                    b = getbyte(lx);
-                    if (b == '/') 
-                        level--;
-                } 
-                if (b == '\n') 
-                    lx->pos.line++;
-                b = getbyte(lx);
-            }
-            goto Dispatch;
-        } else 
-            ungetbyte(lx);
-        goto Return;
-
-    case '#':
-        if (domacro(lx)) {
-            tok.kind = Anil;
-            errorat(lx->pos, "failed to perform preprocessor directive");
-            return tok;
-        }
-        goto GetByte;
-
-    case EOF:
-        popio(lx);
-        if (lx->io)
-            goto GetByte;
-        tok.kind = Aeof;
-        goto Return;
-
-    CASE1('(', Alparen);
-    CASE1(')', Arparen);
-    CASE1('{', Albrace);
-    CASE1('}', Arbrace);
-    CASE1('[', Albrakt);
-    CASE1(']', Arbrakt);
-    CASE1(',', Acomma);
-    CASE1('?', Aqmark);
-    CASE1(';', Asemi);
-    CASE1('~', Aneg);
-    CASE1(':', Acolon);
-    CASE2('^', Axor, '=', Axorasn);
-    CASE2('!', Anot, '=', Aneq);
-    CASE2('*', Astar,'=', Amulasn);
-    CASE2('=', Aasn, '=', Aeq);
-    CASE2('%', Amod, '=', Amodasn);
-    CASE3('+', Aadd, '=', Aaddasn, '+', Ainc);
-    CASE3('&', Aand, '=', Aandasn, '&', Aandand);
-    CASE3('|', Aor,  '=', Aorasn,  '|', Aoror);
-    CASE4('-', Asub, '=', Asubasn, '-', Adec, '>', Aarrow);
-
-    Tnum:
-        e = lx->buf + arrlen(lx->buf);
-        do {
-            if (lx->b >= e) {
-                errorat(lx->pos, "number overflows lexer buffer");
-                goto Nospace;
-            }
-            *lx->b++ = b;
-        } while (b = getbyte(lx), isdigit(b) || b == '_');
-        
-        if (b == '.' || tolower(b) == 'e')
-            goto Tflt;
-    Tint:
-        n = 10;
-        s = lx->buf;
-        if (*s == '0') {
-            switch (b) {
-            case 'x': n = 16; break;
-            case 'b': n = 2;  break;
-            case 'o': n = 8;  break;
-            default: goto Rint;
-            }
-            lx->b = s;
-            /* reparse number, now with base info */
-            while (b = getbyte(lx), (isdigit(b) || 
-                         ('a' <= b && b <= 'f') || 
-                         ('A' <= b && b <= 'F') || 
-                         b == '_'))
-                *lx->b++ = b;
-        }
-    Rint:
-        v = 0;
-        r = b;
-        for (; s != lx->b ; s++) {
-            b = *s;
-            if (b == '_') continue;
-
-            f = Atoi[b];
-            if (f == 0 && b != '0') 
-                break;
-
-            if (f >= n) {
-                errorat(lx->pos, "digit '%c' out of range for base %d", b, n);
-                f = 0;
-            }
-
-            if (v > (UINT64_MAX - f) / n) {
-                errorat(lx->pos, "integer literal overflow");
-                v = 0;
-                break;
-            }
-
-            v = v * n + f;
-        }
-
-        b = r;
-        tok.kind  = Alit;
-        tok.val.i = v;
-
-        if (b == 'u' || b == 'U') {
-            tok.kind |= Vun;
-            b = getbyte(lx);
-        }
-        if (b == 'l' || b == 'L') {
-            r = getbyte(lx);
-            if (r == 'l' || r == 'L') {
-                if (r != b)
-                    errorat(lx->pos, "mismatched case on long long integer suffix");
-                tok.kind |= Vvlong;
-                r = getbyte(lx);
-            } else 
-                tok.kind |= Vlong;
-
-            if (r == 'u' || r == 'U') {
-                if (tok.kind & Vun)
-                    errorat(lx->pos, "multiple unsigned designators on integer suffix");
-                tok.kind |= Vun;
-                goto Return;
-            }
-
-            ungetbyte(lx);
-            goto Return;
-        }
-
-        tok.kind |= Vint;
-        ungetbyte(lx);
-        goto Return;
-
-    Tflt:
-        if (b == '.') {
-            *lx->b++ = b;
-            b = getbyte(lx);
-        }
-
-        while (isdigit(b)) {
-            *lx->b++ = b;
-
-            if (lx->b >= e) {
-                errorat(lx->pos, "number overflows lexer buffer");
-                goto Nospace;
-            }
-        }
-
-        if (tolower(b) == 'e') {
-            b = getbyte(lx);
-            if (b == '-' || b == '+')
-                b = getbyte(lx);
-
-            if (!isdigit(b)) 
-                errorat(lx->pos, "expected number after exponent, found %c", b);
-
-            do {
-                *lx->b++ = b;
-            } while (b = getbyte(lx), isdigit(b));
-        }
-        *lx->b = '\0';
-        d      = strtod(lx->buf, nil);
-        ungetbyte(lx);
-
-        tok.kind  = Alit | Vfloat;
-        tok.val.f = d;
-
-        goto Return;
-
-    Talpha:
-        s = lx->buf;
-        e = lx->buf + arrlen(lx->buf);
-        for (;;) {
-            if (s >= e) {
-                errorat(lx->pos, "identifier too long for buffer: %s", s);
-                goto Nospace;
-            }
-            if (b != EOF && b >= RuneSelf) {
-                ungetbyte(lx);
-                r = getrune(lx);
-                if (!utf8·isletter(r) && !utf8·isdigit(r) && r != 0xb7) {
-                    errorat(lx->pos, "invalid identifier character %d", r);
-                }
-                s += utf8·runetobyte(s, &r);
-            } else if (!isalnum(b) && b != '_') 
-                break;
-            else 
-                *s++ = b;
-            b = getbyte(lx);
-        }
-        *s = '\0';
-        ungetbyte(lx);
-
-        tok.kind  = Aident;
-        tok.val.s = lx->buf;
-
-        n = intern(&tok.val.s);
-        if (n < arrlen(keywords)) {
-            tok.kind  = Akeywd;
-            tok.val.i = n;
-            goto Return;
-        } 
-
-        sym = lookup(&lx->sym, tok.val.s);
-        if (sym && ((uintptr)sym->name != (uintptr)lx->io->path)) {
-            if ((uintptr)sym == lx->macline) {
-                tok.kind  = Alit | Vint;
-                tok.val.i = lx->pos.line;
-                goto Return;
-            }
-            if ((uintptr)sym == lx->macfile) {
-                tok.kind  = Alit | Vstr; 
-                tok.val.s = lx->pos.path;
-                goto Return;
-            }
-            io = makeio(lx, sym->name);
-            io->rdr.end   += expandmacro(lx, sym, io->b);
-            printf("EXPANDED %s: %s\n", sym->name, io->rdr.beg);
-            *io->rdr.end++ = EOF;
-            pushio(lx, io);
-            goto GetByte;
-        }
-        goto Return;
-
-    default:
-        tok.kind = Anil;
-        errorat(lx->pos, "invalid token, crashing");
-        abort();
-    }
-
-Return:
-    lx->b       = lx->buf;
-    return tok;
-
-Nospace:
-    panicf("aborting compilation");
-    exit(1);
-}
-
-#undef CASE4
-#undef CASE3
-#undef CASE2
-#undef CASE1
-
-// -----------------------------------------------------------------------
-// symbol tables
-
-#define PTR_HASH(p)        (uintptr)(p)
-#define PTR_EQUAL(p1, p2) ((uintptr)(p1) == (uintptr)(p2))
-
-static 
-void 
-·free(void* _, void* ptr) {
-    return free(ptr);
-}
-
-static 
-void *
-·alloc(void* _, uint n, ulong size) {
-    return malloc(n*size);
-}
-
-static 
-void *
-·calloc(void* _, uint n, ulong size) {
-    return calloc(n, size);
-}
-
-static
-int
-moresymtab(SymTab *tab, int n)
-{
-    MAP_GROW(tab, string, Sym*, n, PTR_HASH, sys·Memory, nil);
-}
-
-static
-int
-putsym(SymTab *tab, Sym *sym, error *err)
-{
-    MAP_PUT(tab, sym->name, sym, PTR_HASH, PTR_EQUAL, moresymtab, err);
-}
-
-Sym*
-define(SymTab *tab, string name, uint32 kind)
-{
-    int   i;
-    Sym  *sym;
-    error err;
-
-    sym = mem·arenaalloc(C.heap, 1, sizeof(*sym));
-    sym->name = name;
-    sym->kind = kind;
-
-    i = putsym(tab, sym, &err);
-    tab->vals[i] = sym;
-
-    return sym;
-}
-
-Sym*
-lookup(SymTab *tab, string ident)
-{
-    int idx;
-    MAP_GET(idx, tab, ident, PTR_HASH, PTR_EQUAL);
-
-    if (idx < tab->n_buckets)
-        return tab->vals[idx];
-
-    return nil;
-}
-
-
-error
-forget(SymTab *tab, string ident)
-{
-    int idx;
-    MAP_GET(idx, tab, ident, PTR_HASH, PTR_EQUAL);
-
-    if (idx < tab->n_buckets) {
-        MAP_DEL(tab, idx);
-        return 0;
-    }
-    return 1;
-}
-
-void
-forgetall(SymTab *tab)
-{
-    MAP_RESET(tab);
-}
diff --git a/sys/cmd/cc/pp.c b/sys/cmd/cc/pp.c
deleted file mode 100644
index 57c3501..0000000
--- a/sys/cmd/cc/pp.c
+++ /dev/null
@@ -1,1125 +0,0 @@
-#include "cc.h"
-
-// -----------------------------------------------------------------------
-// helper functions
-
-static
-void
-pushomit(Lexer *lx, string omit)
-{
-    if (lx->omit.len == lx->omit.cap) {
-        lx->omit.cap += 20;
-        lx->omit.path = realloc(lx->omit.path, lx->omit.cap*sizeof(*lx->omit.path));
-    }
-    lx->omit.path[lx->omit.len++] = omit;
-}
-
-// NOTE: The iterator of lexer lx->b IS NOT reset.
-//       Its the caller's responsibility.
-static
-string
-ident(Lexer *lx)
-{
-    int b;
-    byte *s;
-
-    b = getnsbyte(lx);
-    if (!isalpha(b) && b != '_' && b < RuneSelf) {
-        ungetbyte(lx);
-        return "";
-    }
-
-    s = lx->b;
-    for (;;) {
-        *lx->b++ = b;
-        b = getbyte(lx);
-        if (isalnum(b) || b == '_' || b >= RuneSelf)
-            continue;
-        ungetbyte(lx);
-        break;
-    }
-    *lx->b++ = '\0';
-
-    return s;
-}
-
-static
-string
-identdots(Lexer *lx, int *dots)
-{
-    int    c;
-    byte  *s;
-
-    s = ident(lx);
-    if (*s != '\0')
-        return s;
-
-    c = getnsbyte(lx);
-    if (c != '.') {
-        ungetbyte(lx);
-        return s;
-    }
-
-    if (getbyte(lx) != '.' || getbyte(lx) != '.')
-        errorat(lx->pos, "incorrect '...' token in macro");
-
-    *dots = 1;
-    // TODO: should only run intern once...
-    s     = "__VA_ARGS__"; 
-    intern(&s);
-    return s;
-}
-
-static
-Sym*
-defmacro(Lexer *lx, string name, string macro)
-{
-    Sym *mac;
-
-    // printf("DEFINING MACRO %s ON LINE %d, file %s\n", name, lx->pos.line, os·basename(lx->pos.path));
-    mac = define(&lx->sym, name, Smacro);
-    mac->macro = macro;
-
-    return mac;
-}
-
-static vlong evalmacro(Lexer *lx, byte prec);
-
-static
-vlong
-opand(Lexer *lx)
-{
-    int    b;
-    vlong  v;
-    string s;
-    Token  tok;
-    Sym   *sym;
-
-    b = getnsbyte(lx);
-    if (b == '\n') {
-        errorat(lx->pos, "new line in macro expression");
-        return 0;
-    }
-    ungetbyte(lx);
-
-    tok = lex(lx);
-
-    switch (tok.kind & Vmask) {
-    case Aneg:
-        return ~opand(lx);
-
-    case Anot:
-        return !opand(lx);
-
-    case Alparen:
-        v   = evalmacro(lx, 1);
-        tok = lex(lx);
-        if (!(tok.kind & Arparen)) {
-            errorat(lx->pos, "unbalanced parenthesis in macro expression");
-            return 0;
-        }
-        return v;
-
-    case Alit:
-        switch (tok.kind & ~Vmask) {
-        case Vint: case Vlong: case Vvlong:
-            return tok.val.i;
-        case Vun|Vint : case Vun|Vlong : case Vun|Vvlong:
-            return tok.val.ui;
-        case Vrune:
-            return tok.val.r;
-        case Vchar:
-            return tok.val.c;
-        default:
-            errorat(lx->pos, "invalid literal of type '%s' in conditional macro", tokens[tok.kind & ~Vmask]); 
-            return 0;
-        }
-
-    case Aident:
-        sym = lookup(&lx->sym, tok.val.s);
-        if (!sym) {
-            /* calling lex directly would expand the operand here 
-             * manually lex the result
-             */
-            if (strcmp(tok.val.s, "defined") == 0) {
-                b = getnsbyte(lx);
-                if (b == '\n') {
-                    errorat(lx->pos, "new line in defined operand");
-                    return 0;
-                }
-                s = lx->buf;
-                if (b == '(') {
-                    b = getnsbyte(lx); 
-                    while (b != ')') {
-                        if (b == '\n') {
-                            errorat(lx->pos, "new line inside defined operand");
-                            return 0;
-                        }
-                        if (b == '(') {
-                            errorat(lx->pos, "nested parens not allowed inside defined operator");
-                            return 0;
-                        }
-                        if (!isspace(b))
-                            *s++ = b;
-                        b = getbyte(lx);
-                    }
-                } else {
-                    while (!isspace(b)) {
-                        *s++ = b;
-                        b    = getbyte(lx);
-
-                        if (b == '\n') {
-                            errorat(lx->pos, "new line inside defined operand");
-                            return 0;
-                        }
-                    }
-                }
-                *s = '\0';
-                s  = lx->buf;
-                intern(&s);
-                return lookup(&lx->sym, s) != nil;
-            }
-            return 0;
-        }
-        panicf("unreachable");
-        return 1;
-
-    default:
-        errorat(lx->pos, "opand: invalid token found in macro conditional: '%s'", tokens[tok.kind & Vmask]); 
-        return 0;
-    }
-}
-
-// recursively evaluates a macro
-// reduced set of operators allowed here
-static
-vlong
-evalmacro(Lexer *lx, byte prec)
-{
-    int   b;
-    vlong l, r;
-    Token tok;
-
-    l = opand(lx);
-    for (;;) {
-        b = getnsbyte(lx);
-        // NOTE: Either this or we pass in what are stopping byte is
-        //       New line should always stop us...
-        //       Is there any case where we SHOULDN'T STOP ON ')'?
-        if (b == '\n' || b == ')') {
-            ungetbyte(lx);
-            break;
-        }
-        ungetbyte(lx);
-
-        tok = lex(lx);
-        // simplified jump table of precedence
-        // unpacked to evaluate inline
-        switch (tok.kind & Vmask) {
-        case Astar: 
-            if (prec > 10) {
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 10 + 1);
-            l = l * r;
-            continue;
-
-        case Adiv: 
-            if (prec > 10) {
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 10 + 1);
-            l = l / r;
-            continue;
-
-        case Amod:
-            if (prec > 10) {
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 10 + 1);
-            l = l % r;
-            continue;
-
-        case Aadd: 
-            if (prec > 9) {
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 9 + 1);
-            l = l + r;
-            continue;
-
-        case Asub: 
-            if (prec > 9) {
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 9 + 1);
-            l = l - r;
-            continue;
-
-        case Alsft: 
-            if (prec > 8) {
-                ungetbyte(lx);
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 8 + 1);
-            l = l << r;
-            continue;
-
-        case Arsft: 
-            if (prec > 8) {
-                ungetbyte(lx);
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 8 + 1);
-            l = l >> r;
-            continue;
-
-        case Alt: 
-            if (prec > 7) {
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 7 + 1);
-            l = l < r;
-            continue;
-
-        case Agt: 
-            if (prec > 7) {
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 7 + 1);
-            l = l > r;
-            continue;
-
-        case Agteq: 
-            if (prec > 7) {
-                ungetbyte(lx);
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 7 + 1);
-            l = l >= r;
-            continue;
-
-        case Alteq:
-            if (prec > 7) {
-                ungetbyte(lx);
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 7 + 1);
-            l = l >= r;
-            continue;
-
-        case Aeq: 
-            if (prec > 6) {
-                ungetbyte(lx);
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 6 + 1);
-            l = l == r;
-            continue;
-
-        case Aneq:
-            if (prec > 6) {
-                ungetbyte(lx);
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 6 + 1);
-            l = l != r;
-            continue;
-
-        case Aand:
-            if (prec > 5) {
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 5 + 1);
-            l = l & r;
-            continue;
-
-        case Axor:
-            if (prec > 4) {
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 4 + 1);
-            l = l ^ r;
-            continue;
-
-        case Aor:
-            if (prec > 3) {
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 3 + 1);
-            l = l | r;
-            continue;
-
-        case Aandand:
-            if (prec > 2) {
-                ungetbyte(lx);
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 2 + 1);
-            l = l && r;
-            continue;
-
-        case Aoror:
-            if (prec > 1) {
-                ungetbyte(lx);
-                ungetbyte(lx);
-                return l;
-            }
-            r = evalmacro(lx, 1 + 1);
-            l = l || r;
-            continue;
-
-        default:
-            errorat(lx->pos, "eval: invalid token found in macro conditional '%s'", tokens[tok.kind & Vmask]);
-            abort();
-            return 0;
-        }
-    }
-
-    return l;
-}
-
-// -----------------------------------------------------------------------
-// preprocessor magic numbers
-
-enum
-{
-    PPbeg  = 0x02,
-    PParg  = 0x03,
-    PPcat  = 0x04,
-    PPstr  = 0x05,
-
-    PPnarg = 30,
-};
-
-#define PPvar 0x80u
-
-// -----------------------------------------------------------------------
-// preprocessor functions
-
-/* #endif */
-static
-error
-ppend(Lexer *lx)
-{
-    int b;
-    do {
-        b = getnsbyte(lx);
-    } while (b > 0 && b != '\n');
-
-    if (b == '\n')
-        lx->pos.line++;
-
-    return 0;
-}
-
-
-/* #undef */
-static
-error
-ppund(Lexer *lx)
-{
-    string s;
-    error err;
-
-    s = ident(lx);
-    intern(&s);
-    lx->b = lx->buf;
-
-    err = forget(&lx->sym, s);
-    if (err) 
-        warnat(lx->pos, "attempting to undefine unrecognized symbol '%s'", s);
-
-    ppend(lx);
-    return 0;
-}
-
-/* #define */
-static
-error
-ppdef(Lexer *lx)
-{
-    int    b;
-    Sym   *sym;
-    int    i, j, n, dot;
-    string s, a, base, end, buf, args[PPnarg];
-
-    s = ident(lx);
-    if (!s) {
-        errorat(lx->pos, "failed to parse defined identifer");
-        goto Bad;
-    }
-    intern(&s);
-    printf("DEFINING %s\n", s);
-    lx->b = lx->buf;
-
-    sym = lookup(&lx->sym, s);
-    if (sym)
-        warnat(lx->pos, "macro redefined: '%s'", sym->name);
-
-    n   = 0;
-    dot = 0;
-    b   = getbyte(lx);
-    if (b == '(') {
-        b = getnsbyte(lx);
-        if (b != ')') {
-            ungetbyte(lx);
-            for (;;) {
-                // NOTE: This is a pointer into the lx->buffer.
-                //       Can't reset lx->b while we hold the args!
-                a = identdots(lx, &dot);
-                if (a == nil) {
-                    errorat(lx->pos, "macro syntax error: improper argument");
-                    goto Bad;
-                }
-                if (n >= PPnarg) {
-                    errorat(lx->pos, "macro syntax error: too many arguments: %d > %d", n, PPnarg);
-                    goto Bad;
-                }
-
-                args[n++] = a;
-                b = getnsbyte(lx);
-
-                if (b == ')')
-                    break;
-                if (b != ',') {
-                    errorat(lx->pos, "macro syntax error: bad token in argument '%b'", b);
-                    goto Bad;
-                }
-            }
-        }
-        b = getbyte(lx);
-    }
-
-    if (isspace(b))
-        if (b != '\n')
-            b = getnsbyte(lx);
-
-    base = lx->b;
-    end  = lx->buf + arrlen(lx->buf);
-    if (base >= end) {
-        errorat(lx->pos, "out of macro buffer space!");
-        goto Bad;
-    }
-    buf  = str·makef("%c%c", n, PPbeg);
-    for (;;) {
-        if (isalpha(b) || b == '_') {
-            lx->b    = base;
-            *lx->b++ = b;
-
-            b = getbyte(lx);
-            while (isalnum(b) || b == '_') {
-                *lx->b++ = b;
-                if (lx->b >= end) {
-                    errorat(lx->pos, "out of macro buffer space!");
-                    goto Bad;
-                }
-                b = getbyte(lx);
-            }
-            *lx->b++ = '\0';
-
-            for (i = 0; i < n; i++) {
-                if (strcmp(base, args[i]) == 0) {
-                    goto Arg;
-                }
-            }
-            str·appendlen(&buf, (lx->b - base - 1), base);
-            continue;
-        Arg:
-            str·appendbyte(&buf, PParg);
-            str·appendbyte(&buf, 'a' + i);
-            continue;
-        }
-
-        if (b == '/') {
-            b = getbyte(lx);
-            if (b == '/') {
-                while (b = getbyte(lx), b != '\n');
-                continue;
-            }
-            if (b == '*') {
-                b = getbyte(lx);
-                for (;;) {
-                    if (b == '*') {
-                        b = getbyte(lx);
-                        if (b != '/')
-                            continue;
-                        b = getbyte(lx);
-                        break;
-                    }
-                    if (b == '\n') {
-                        errorat(lx->pos, "comment and newline found in define statement of %s", s);
-                        break;
-                    }
-                    b = getbyte(lx);
-                }
-                continue;
-            }
-            str·appendbyte(&buf, '/');
-            continue;
-        }
-
-        if (b == '\\') {
-            b = getbyte(lx);
-            /* unix */
-            if (b == '\n') {
-                lx->pos.line++;
-                b = getbyte(lx);
-                continue;
-            }
-            /* windows */
-            if (b == '\r') {
-                b = getbyte(lx);
-                if (b == '\n') {
-                    lx->pos.line++;
-                    b = getbyte(lx);
-                    continue;
-                }
-            }
-            str·appendbyte(&buf, '\\');
-        }
-        if (b == '\n') {
-            lx->pos.line++;
-            break;
-        }
-
-        if (b == '#') {
-            b = getnsbyte(lx);
-            if (b == '#') {
-                str·appendbyte(&buf, PPcat);
-                b = getbyte(lx);
-                continue;
-            }
-
-            lx->b = base;
-            while (isalnum(b) || b == '_') {
-                *lx->b++ = b;
-                b = getbyte(lx);
-            }
-            *lx->b = '\0';
-
-            for (i = 0; i < n; i++) {
-                if (strcmp(base, args[i]) == 0)
-                    goto Str;
-            }
-            errorat(lx->pos, "macro operator '#' must be followed by a valid variable identifier");
-            goto Bad;
-        Str:
-            str·appendbyte(&buf, PPstr);
-            str·appendbyte(&buf, 'a' + i);
-            continue;
-        }
-
-        str·appendbyte(&buf, b);
-        b = getbyte(lx);
-        if (b == EOF) {
-            errorat(lx->pos, "eof found in macro '%s'", s);
-            goto Bad;
-        }
-    }
-    if (dot) 
-        *buf |= PPvar;
-
-    lx->b = lx->buf;
-    sym   = defmacro(lx, s, buf);
-    return 0;
-Bad:
-    errorat(lx->pos, "failed parse of #define macro '%s'", s);
-    lx->b = lx->buf;
-    ppend(lx);
-    return 1;
-}
-
-/* macro expansion */
-int
-expandmacro(Lexer *lx, Sym *s, byte *dst)
-{
-    int  n, lv, nargs, dots;
-    byte b, *it, *e, *arg[PPnarg];
-
-    /* not a function macro */
-    if (s->macro[0] == '\0') {
-        if (s->macro[1] != PPbeg) {
-            errorat(lx->pos, "malformed macro");
-            goto Bad;
-        }
-        strcpy(dst, s->macro + 2);
-        return str·len(s->macro)-2;
-    }
-    dots  =  (ubyte)s->macro[0] & PPvar;
-    nargs =  (ubyte)s->macro[0] & (~PPvar); 
-
-    b = getnsbyte(lx);
-    if (b != '(') {
-        errorat(lx->pos, "macro function not given arguments");
-        goto Bad;
-    }
-
-    n = 0;
-    b = getbyte(lx);
-    if (b != ')') {
-        ungetbyte(lx);
-        lv       = 0;
-        lx->b    = lx->buf;
-        e        = lx->buf + arrlen(lx->buf) - 4;
-        arg[n++] = lx->buf;
-        for (;;) {
-            if (lx->b >= e) 
-                goto Nospace;
-            b = getbyte(lx);
-            if (b == '"') 
-                for (;;) {
-                    if (lx->b >= e) 
-                        goto Nospace;
-                    *lx->b++ = b;
-                    b = getbyte(lx);
-                    if (b == '\\') {
-                        *lx->b++ = b;
-                        b = getbyte(lx);
-                        continue;
-                    }
-                    if (b == '\n') {
-                        errorat(lx->pos, "newline found in arguments: macro '%s'", s->name);
-                        goto Bad;
-                    }
-                    if (b == '"') 
-                        break;
-                }
-            if (b == '\'') 
-                for (;;) {
-                    if (lx->b >= e)
-                        goto Nospace;
-                    *lx->b++ = b;
-                    b = getbyte(lx);
-                    if (b == '\\') {
-                        *lx->b++ = b;
-                        b = getbyte(lx);
-                        continue;
-                    }
-                    if (b == '\n') {
-                        errorat(lx->pos, "newline found in arguments: macro '%s'", s->name);
-                        goto Bad;
-                    }
-                    if (b == '"') 
-                        break;
-                }
-            if (b == '/') {
-                b = getbyte(lx);
-                switch(b) {
-                case '*':
-                    for (;;) {
-                        b = getbyte(lx);
-                        if (b == '*') {
-                            b = getbyte(lx);
-                            if (b == '/') 
-                                break;
-                        }
-                    }
-                    *lx->b++ = ' ';
-                    continue;
-                case '/':
-                    while ((b = getbyte(lx)) != '\n')
-                        ;
-                break;
-
-                default:
-                    ungetbyte(lx);
-                    b = '/';
-                }
-            }
-            if (lv == 0) {
-                if (b == ',') {
-                    if (n == nargs && dots) {
-                        *lx->b++ = ',';
-                        continue;
-                    }
-                    *lx->b++ = '\0';
-                    arg[n++] = lx->b;
-                    if (n > nargs)
-                        break;
-                    continue;
-                }
-                if (b == ')') 
-                    break;
-            }
-            if (b == '\n')
-                b = ' ';
-            *lx->b++ = b;
-            if (b == '(')
-                lv++;
-            if (b == ')')
-                lv--;
-        }
-        *lx->b = '\0';
-    }
-
-    if (n != nargs) {
-        errorat(lx->pos, "number of arguments don't match macro definition: %s", s->name);
-        *dst = '\0';
-        goto Bad;
-    }
-
-    if (s->macro[1] != PPbeg) {
-        errorat(lx->pos, "corrupted macro buffer: %s", s->name);
-        *dst = '\0';
-        goto Bad;
-    }
-
-    it = s->macro+2;
-    e  = dst; 
-    for (;;) {
-        b = *it++;
-        if (b == '\n')
-            b = ' ';
-        switch (b) {
-        case PParg:
-            b = *it++;
-            b -= 'a';
-            if (b < 0 && b > n) {
-                errorat(lx->pos, "malformed macro index: %s", s->name);
-                goto Bad;
-            }
-            strcpy(dst, arg[b]);
-            dst += strlen(arg[b]);
-
-            break;
-
-        case PPstr:
-            b = *it++;
-            b -= 'a';
-            if (b < 0 && b > n) {
-                errorat(lx->pos, "malformed macro index: %s", s->name);
-                goto Bad;
-            }
-            *dst++ = '"';
-            strcpy(dst, arg[b]);
-            *dst++ = '"';
-
-            break;
-
-        case PPcat:
-            continue;
-
-        case '\0':
-            goto End;
-
-        default:
-            *dst++ = b;
-            continue;
-        }
-    }
-End:
-    *dst = '\0';
-    return dst - e;
-Nospace:
-    errorat(lx->pos, "out of memory during macro expansion %s", s->name);
-Bad:
-    ppend(lx);
-    lx->b = lx->buf;
-    errorat(lx->pos, "failed to expand macro %s", s->name);
-    return -1;
-}
-
-/* #include */
-static
-error
-ppinc(Lexer *lx)
-{
-    int    i;
-    byte   b, end;
-    string s;
-
-    Stream *f;
-    Io     *io;
-
-    b = getnsbyte(lx);
-    if (b != '"') {
-        end = b;
-        if (b != '<') {
-            errorat(lx->pos, "unrecognized token '%c' in include directive", b);
-            goto Bad;
-        }
-        end = '>';
-    } else 
-        end = '"';
-
-    lx->b = lx->buf;
-    for (;;) {
-        b = getbyte(lx);
-        if (b == end)
-            break;
-        if (b == '\n') {
-            errorat(lx->pos, "hit end of line before include directive completed");
-            goto Bad;
-        }
-        *lx->b++ = b;
-    }
-    *lx->b = '\0';
-    s      = lx->buf;
-    intern(&s); // NOTE: we could use this to see if we already have the file
-
-    lx->b = lx->buf;
-    for (i = 0; i < C.inc.len; i++) {
-        if (i == 0 && end == '>')
-            continue;
-
-        strcpy(lx->buf, C.inc.dir[i]);
-        strcat(lx->buf, "/");
-        
-        if (strcmp(lx->buf, "./") == 0)
-            lx->buf[0] = '\0';
-        strcat(lx->buf, s);
-
-        if (os·exists(lx->buf, ReadOK)) {
-            break;
-        }
-    }
-    if (i == C.inc.len) {
-        errorat(lx->pos, "could not find file '%s' on standard include search path", s);
-        goto Bad;
-    }
-
-    io = openio(lx, lx->buf);
-    if (io != nil) {
-        pushio(lx, io);
-    }
-
-    return 0;
-
-Bad:
-    ungetbyte(lx);
-    lx->b = lx->buf;
-    errorat(lx->pos, "failed include");
-    ppend(lx);
-    return 1;
-}
-
-/* #pragma */
-static
-error
-ppprag(Lexer *lx) 
-{
-    string s;
-
-    s = ident(lx);
-    if (s == nil) {
-        errorat(lx->pos, "failed to parse pragma identifier");
-        goto Bad;
-    }
-    lx->b = lx->buf;
-    if (strcmp(s, "once") == 0) {
-        pushomit(lx, lx->io->path);
-        return 0;
-    }
-Bad:
-    lx->b = lx->buf;
-    errorat(lx->pos, "unrecognized pragma '%s'", s);
-    ppend(lx);
-    return 1;
-}
-
-/* all #if statements */
-static
-error
-ppif(Lexer *lx, int f)
-{
-    Sym *sym;
-    string s;
-    int c, l, b;
-
-Eval:
-    if (f == 0) {
-        b = evalmacro(lx, 1);
-        if (b) {
-            ppend(lx);
-            return 0;
-        }
-        goto Skip;
-    }
-
-    if (f == 1) 
-        goto Skip;
-
-    s = ident(lx);
-    if (s == nil) {
-        errorat(lx->pos, "failed to parse preprocessor identifier");
-        goto Bad;
-    }
-    intern(&s);
-    lx->b = lx->buf;
-
-    sym = lookup(&lx->sym, s);
-    if ((!sym && (f == 3)) || (sym && (f == 2)))
-        return 0;
-
-Skip:
-    b = 1;
-    l = 0;
-    for (;;) {
-        c = getbyte(lx);
-        if (c != '#') {
-            if (!isspace(c))
-                b = 0;
-            if (c == '\n') {
-                lx->pos.line++;
-                b = 1;
-            }
-            if (c == EOF) {
-                errorat(lx->pos, "EOF hit while skipping if block. Missing endif");
-                goto Bad;
-            }
-            continue;
-        }
-        if (!b)
-            continue;
-        s     = ident(lx);
-        lx->b = lx->buf;
-        if (!s) 
-            continue;
-
-        if (l == 0 && (strcmp(s, "elif") == 0)) {
-            f = 0;
-            goto Eval;
-        }
-
-        if (strcmp(s, "endif") == 0) {
-            if (l) {
-                l--;
-                continue;
-            }
-            ppend(lx);
-            return 0;
-        }
-        if (strcmp(s, "if")    == 0 || 
-            strcmp(s, "ifdef") == 0 || 
-            strcmp(s, "ifndef") == 0) {
-            l++;
-            continue;
-        }
-
-        if (l == 0 && f != 1 && strcmp(s, "else") == 0) {
-            return 0;
-        }
-    }
-
-Bad:
-    lx->b = lx->buf;
-    errorat(lx->pos, "bad syntax in preprocessor conditional directive");
-    ppend(lx);
-    return 1;
-}
-
-/* #if */
-static
-error
-ppif0(Lexer *lx)
-{
-    return ppif(lx, 0);
-}
-
-/* #else */
-static
-error
-ppif1(Lexer *lx)
-{
-    return ppif(lx, 1);
-}
-
-/* #ifdef */
-static
-error
-ppif2(Lexer *lx)
-{
-    return ppif(lx, 2);
-}
-
-/* #ifndef */
-static
-error
-ppif3(Lexer *lx)
-{
-    return ppif(lx, 3);
-}
-
-// -----------------------------------------------------------------------
-// dispatch function
-
-#define DIRECTIVE(a, b, c) c,
-error (*macros[NUM_DIRECTIVES])(Lexer*) = { DIRECTIVES };
-#undef DIRECTIVE
-
-/* reads an identifier into the lexer's buffer */
-/* caller must intern */
-
-error
-domacro(Lexer *lx)
-{
-    int    n;
-    error  err;
-    string s;
-
-    s = ident(lx);
-    intern(&s);
-    lx->b = lx->buf;
-    for (n = 0; n < NUM_DIRECTIVES; n++) {
-        if ((uintptr)s == (uintptr)directives[n]) {
-            goto Do;
-        }
-    }
-    errorat(lx->pos, "unrecognized directive name '%s'", s);
-    return 1;
-Do:
-    err = macros[n](lx);
-    return err;
-}
-
-error
-dodefine(Lexer *lx, string s)
-{
-    int    n;
-    byte   *c, *def;
-    Sym    *sym;
-
-    strcpy(lx->buf, s);
-    c = strchr(lx->buf, '=');
-    if (c) {
-        *c++ = '\0';
-        sym  = lookup(&lx->sym, lx->buf);
-        if (sym) {
-            errorf("redefinition of symbol '%s'", sym->name);
-            return 1;
-        }
-        sym  = define(&lx->sym, lx->buf, Smacro);
-        n    = strlen(c) + 2;
-        sym->macro = str·makelen("", n);
-        str·appendbyte(&sym->macro, '\0');
-        str·append(&sym->macro, c);
-    } else {
-        sym = lookup(&lx->sym, lx->buf);
-        if (sym) {
-            errorf("redefinition of symbol '%s'", sym->name);
-            return 1;
-        }
-        sym = define(&lx->sym, s, Smacro);
-        sym->macro = "\00\02";
-    }
-
-    return 0;
-}
diff --git a/sys/cmd/cc/rules.mk b/sys/cmd/cc/rules.mk
deleted file mode 100644
index 34df34d..0000000
--- a/sys/cmd/cc/rules.mk
+++ /dev/null
@@ -1,23 +0,0 @@
-include share/push.mk
-# Iterate through subdirectory tree
-
-# Local sources
-SRCS_$(d) := \
-	$(d)/pp.c  \
-	$(d)/lex.c \
-	$(d)/ast.c \
-	$(d)/bits.c \
-	$(d)/cc.c
-
-
-LIBS_$(d) :=
-BINS_$(d) := $(d)/cc
-UNTS_$(d) := 
-
-include share/paths.mk
-
-# Local rules
-$(BINS_$(d)): $(OBJS_$(d)) $(OBJ_DIR)/libn/libn.a
-	$(COMPLINK)
-
-include share/pop.mk
diff --git a/sys/cmd/cc/scratch.c b/sys/cmd/cc/scratch.c
deleted file mode 100644
index b37d9a5..0000000
--- a/sys/cmd/cc/scratch.c
+++ /dev/null
@@ -1,7 +0,0 @@
-#define XXX(a, b, c) a ## b ## c
-
-int
-main()
-{
-    XXX(d, e, f);
-}
diff --git a/sys/cmd/cc/util.c b/sys/cmd/cc/util.c
deleted file mode 100644
index cca16f2..0000000
--- a/sys/cmd/cc/util.c
+++ /dev/null
@@ -1,21 +0,0 @@
-#include "cc.h"
-
-void 
-·free(void* _, void* ptr) {
-    return free(ptr);
-}
-
-void *
-·alloc(void* _, uint n, ulong size) {
-    return malloc(n*size);
-}
-
-void *
-·calloc(void* _, uint n, ulong size) {
-    return calloc(n, size);
-}
-
-void *
-·realloc(void* _, void *ptr, uint n, ulong size) {
-    return realloc(ptr, n*size);
-}
diff --git a/sys/cmd/dwm/LICENSE b/sys/cmd/dwm/LICENSE
deleted file mode 100644
index d221f09..0000000
--- a/sys/cmd/dwm/LICENSE
+++ /dev/null
@@ -1,37 +0,0 @@
-MIT/X Consortium License
-
-© 2006-2019 Anselm R Garbe <anselm@garbe.ca>
-© 2006-2009 Jukka Salmi <jukka at salmi dot ch>
-© 2006-2007 Sander van Dijk <a dot h dot vandijk at gmail dot com>
-© 2007-2011 Peter Hartlich <sgkkr at hartlich dot com>
-© 2007-2009 Szabolcs Nagy <nszabolcs at gmail dot com>
-© 2007-2009 Christof Musik <christof at sendfax dot de>
-© 2007-2009 Premysl Hruby <dfenze at gmail dot com>
-© 2007-2008 Enno Gottox Boland <gottox at s01 dot de>
-© 2008 Martin Hurton <martin dot hurton at gmail dot com>
-© 2008 Neale Pickett <neale dot woozle dot org>
-© 2009 Mate Nagy <mnagy at port70 dot net>
-© 2010-2016 Hiltjo Posthuma <hiltjo@codemadness.org>
-© 2010-2012 Connor Lane Smith <cls@lubutu.com>
-© 2011 Christoph Lohmann <20h@r-36.net>
-© 2015-2016 Quentin Rameau <quinq@fifth.space>
-© 2015-2016 Eric Pruitt <eric.pruitt@gmail.com>
-© 2016-2017 Markus Teich <markus.teich@stusta.mhn.de>
-
-Permission is hereby granted, free of charge, to any person obtaining a
-copy of this software and associated documentation files (the "Software"),
-to deal in the Software without restriction, including without limitation
-the rights to use, copy, modify, merge, publish, distribute, sublicense,
-and/or sell copies of the Software, and to permit persons to whom the
-Software is furnished to do so, subject to the following conditions:
-
-The above copyright notice and this permission notice shall be included in
-all copies or substantial portions of the Software.
-
-THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.  IN NO EVENT SHALL
-THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
-FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
-DEALINGS IN THE SOFTWARE.
diff --git a/sys/cmd/dwm/client.c b/sys/cmd/dwm/client.c
deleted file mode 100644
index fa04f5f..0000000
--- a/sys/cmd/dwm/client.c
+++ /dev/null
@@ -1,657 +0,0 @@
-#include "dwm.h"
-
-void
-applyrules(Client *c)
-{
-	char *class, *instance;
-	uint i;
-	Rule *r;
-	Monitor *m;
-	XClassHint ch = { nil, nil };
-
-	c->isfloating = 0;
-	c->tags       = 0;
-    c->noswallow  = -1;
-
-	/* rule matching */
-	XGetClassHint(dpy, c->win, &ch);
-	class    = ch.res_class ? ch.res_class : broken;
-	instance = ch.res_name  ? ch.res_name  : broken;
-
-	for (i = 0; i < arrlen(rules); i++) {
-		r = &rules[i];
-		if ((!r->title || strstr(c->name, r->title))
-		&& (!r->class || strstr(class, r->class))
-		&& (!r->instance || strstr(instance, r->instance)))
-		{
-            c->isterm     = r->isterm;
-            c->noswallow  = r->noswallow;
-			c->isfloating = r->isfloating;
-			c->tags      |= r->tags;
-			for (m = mons; m && m->num != r->monitor; m = m->next)
-                ;
-			if (m)
-				c->mon = m;
-		}
-	}
-	if (ch.res_class)
-		XFree(ch.res_class);
-	if (ch.res_name)
-		XFree(ch.res_name);
-	c->tags = c->tags & TAGMASK ? c->tags & TAGMASK : c->mon->tagset[c->mon->seltags];
-}
-
-int
-applysizehints(Client *c, int *x, int *y, int *w, int *h, int interact)
-{
-	int baseismin;
-	Monitor *m = c->mon;
-
-	/* set minimum possible */
-	*w = MAX(1, *w);
-	*h = MAX(1, *h);
-	if (interact) {
-		if (*x > sw)
-			*x = sw - WIDTH(c);
-		if (*y > sh)
-			*y = sh - HEIGHT(c);
-		if (*x + *w + 2 * c->bw < 0)
-			*x = 0;
-		if (*y + *h + 2 * c->bw < 0)
-			*y = 0;
-	} else {
-		if (*x >= m->wx + m->ww)
-			*x = m->wx + m->ww - WIDTH(c);
-		if (*y >= m->wy + m->wh)
-			*y = m->wy + m->wh - HEIGHT(c);
-		if (*x + *w + 2 * c->bw <= m->wx)
-			*x = m->wx;
-		if (*y + *h + 2 * c->bw <= m->wy)
-			*y = m->wy;
-	}
-	if (*h < bh)
-		*h = bh;
-	if (*w < bh)
-		*w = bh;
-	if (resizehints || c->isfloating || !c->mon->lt[c->mon->sellt]->arrange) {
-		/* see last two sentences in ICCCM 4.1.2.3 */
-		baseismin = c->basew == c->minw && c->baseh == c->minh;
-		if (!baseismin) { /* temporarily remove base dimensions */
-			*w -= c->basew;
-			*h -= c->baseh;
-		}
-		/* adjust for aspect limits */
-		if (c->mina > 0 && c->maxa > 0) {
-			if (c->maxa < (float)*w / *h)
-				*w = *h * c->maxa + 0.5;
-			else if (c->mina < (float)*h / *w)
-				*h = *w * c->mina + 0.5;
-		}
-		if (baseismin) { /* increment calculation requires this */
-			*w -= c->basew;
-			*h -= c->baseh;
-		}
-		/* adjust for increment value */
-		if (c->incw)
-			*w -= *w % c->incw;
-		if (c->inch)
-			*h -= *h % c->inch;
-		/* restore base dimensions */
-		*w = MAX(*w + c->basew, c->minw);
-		*h = MAX(*h + c->baseh, c->minh);
-		if (c->maxw)
-			*w = MIN(*w, c->maxw);
-		if (c->maxh)
-			*h = MIN(*h, c->maxh);
-	}
-	return *x != c->x || *y != c->y || *w != c->w || *h != c->h;
-}
-
-void
-attach(Client *c)
-{
-	c->next = c->mon->clients;
-	c->mon->clients = c;
-}
-
-void
-enqueue(Client *c)
-{
-    Client *l;
-
-    for (l = c->mon->clients; l && l->next; l = l->next)
-        ;
-
-    if (l) {
-        l->next = c;
-        c->next = nil;
-    }
-}
-
-void
-attachbottom(Client *c)
-{
-	Client **tc;
-	c->next = nil;
-	for (tc = &c->mon->clients; *tc; tc = &(*tc)->next)
-        ;
-	*tc = c;
-}
-
-void
-attachstack(Client *c)
-{
-	c->snext = c->mon->stack;
-	c->mon->stack = c;
-}
-
-void
-enqueuestack(Client *c)
-{
-    Client *l;
-    for (l = c->mon->clients; l && l->next; l = l->next)
-        ;
-
-    if (l) {
-        l->snext = c;
-        c->snext = nil;
-    }
-}
-
-void
-configure(Client *c)
-{
-	XConfigureEvent ce;
-
-	ce.type              = ConfigureNotify;
-	ce.display           = dpy;
-	ce.event             = c->win;
-	ce.window            = c->win;
-	ce.x                 = c->x;
-	ce.y                 = c->y;
-	ce.width             = c->w;
-	ce.height            = c->h;
-	ce.border_width      = c->bw;
-	ce.above             = None;
-	ce.override_redirect = False;
-	XSendEvent(dpy, c->win, False, StructureNotifyMask, (XEvent *)&ce);
-}
-
-void
-detach(Client *c)
-{
-	Client **tc;
-
-	for (tc = &c->mon->clients; *tc && *tc != c; tc = &(*tc)->next)
-        ;
-	*tc = c->next;
-}
-
-void
-detachstack(Client *c)
-{
-	Client **tc, *t;
-
-	for (tc = &c->mon->stack; *tc && *tc != c; tc = &(*tc)->snext)
-        ;
-
-	*tc = c->snext;
-
-	if (c == c->mon->sel) {
-		for (t = c->mon->stack; t && !ISVISIBLE(t); t = t->snext)
-            ;
-		c->mon->sel = t;
-	}
-}
-
-void
-focus(Client *c)
-{
-	if (!c || !ISVISIBLE(c))
-		for (c = selmon->stack; c && !ISVISIBLE(c); c = c->snext)
-            ;
-	if (selmon->sel && selmon->sel != c)
-		unfocus(selmon->sel, 0);
-	if (c) {
-		if (c->mon != selmon)
-			selmon = c->mon;
-		if (c->isurgent)
-			seturgent(c, 0);
-		detachstack(c);
-		attachstack(c);
-		grabbuttons(c, 1);
-		XSetWindowBorder(dpy, c->win, scheme[SchemeSel][ColBorder].pixel);
-		setfocus(c);
-	} else {
-		XSetInputFocus(dpy, root, RevertToPointerRoot, CurrentTime);
-		XDeleteProperty(dpy, root, netatom[NetActiveWindow]);
-	}
-	selmon->sel = c;
-	drawbars();
-}
-
-Atom
-getatomprop(Client *c, Atom prop)
-{
-	int di;
-	unsigned long dl;
-	uchar *p = nil;
-	Atom da, atom = None;
-
-	if (XGetWindowProperty(dpy, c->win, prop, 0L, sizeof atom, False, XA_ATOM,
-		&da, &di, &dl, &dl, &p) == Success && p) {
-		atom = *(Atom *)p;
-		XFree(p);
-	}
-	return atom;
-}
-
-void
-grabbuttons(Client *c, int focused)
-{
-	updatenumlockmask();
-	{
-		uint i, j;
-		uint modifiers[] = { 0, LockMask, numlockmask, numlockmask|LockMask };
-		XUngrabButton(dpy, AnyButton, AnyModifier, c->win);
-		if (!focused)
-			XGrabButton(dpy, AnyButton, AnyModifier, c->win, False,
-				BUTTONMASK, GrabModeSync, GrabModeSync, None, None);
-		for (i = 0; i < arrlen(buttons); i++)
-			if (buttons[i].click == ClkClientWin)
-				for (j = 0; j < arrlen(modifiers); j++)
-					XGrabButton(dpy, buttons[i].button,
-						buttons[i].mask | modifiers[j],
-						c->win, False, BUTTONMASK,
-						GrabModeAsync, GrabModeSync, None, None);
-	}
-}
-
-Client *
-nexttiled(Client *c)
-{
-	for (; c && (c->isfloating || !ISVISIBLE(c)); c = c->next)
-        ;
-	return c;
-}
-
-void
-pop(Client *c)
-{
-	detach(c);
-	attach(c);
-	focus(c);
-	arrange(c->mon);
-}
-
-void
-resize(Client *c, int x, int y, int w, int h, int interact)
-{
-	if (applysizehints(c, &x, &y, &w, &h, interact))
-		resizeclient(c, x, y, w, h);
-}
-
-
-void
-resizeclient(Client *c, int x, int y, int w, int h)
-{
-	XWindowChanges wc;
-
-	c->oldx = c->x; c->x = wc.x = x;
-	c->oldy = c->y; c->y = wc.y = y;
-	c->oldw = c->w; c->w = wc.width = w;
-	c->oldh = c->h; c->h = wc.height = h;
-	wc.border_width = c->bw;
-	XConfigureWindow(dpy, c->win, CWX|CWY|CWWidth|CWHeight|CWBorderWidth, &wc);
-	configure(c);
-	XSync(dpy, False);
-}
-
-void
-sendtomon(Client *c, Monitor *m)
-{
-	if (c->mon == m)
-		return;
-	unfocus(c, 1);
-	detach(c);
-	detachstack(c);
-	c->mon = m;
-	c->tags = m->tagset[m->seltags]; /* assign tags of target monitor */
-	/* attach(c); */
-    attachbottom(c);
-	attachstack(c);
-	focus(nil);
-	arrange(nil);
-}
-
-void
-setclientstate(Client *c, long state)
-{
-	long data[] = { state, None };
-
-	XChangeProperty(dpy, c->win, wmatom[WMState], wmatom[WMState], 32,
-		PropModeReplace, (uchar *)data, 2);
-}
-
-int
-sendevent(Client *c, Atom proto)
-{
-	int n;
-	Atom *protocols;
-	int exists = 0;
-	XEvent ev;
-
-	if (XGetWMProtocols(dpy, c->win, &protocols, &n)) {
-		while (!exists && n--)
-			exists = protocols[n] == proto;
-		XFree(protocols);
-	}
-	if (exists) {
-		ev.type = ClientMessage;
-		ev.xclient.window = c->win;
-		ev.xclient.message_type = wmatom[WMProtocols];
-		ev.xclient.format = 32;
-		ev.xclient.data.l[0] = proto;
-		ev.xclient.data.l[1] = CurrentTime;
-		XSendEvent(dpy, c->win, False, NoEventMask, &ev);
-	}
-	return exists;
-}
-
-void
-setfocus(Client *c)
-{
-	if (!c->neverfocus) {
-		XSetInputFocus(dpy, c->win, RevertToPointerRoot, CurrentTime);
-		XChangeProperty(dpy, root, netatom[NetActiveWindow],
-			XA_WINDOW, 32, PropModeReplace,
-			(uchar *) &(c->win), 1);
-	}
-	sendevent(c, wmatom[WMTakeFocus]);
-}
-
-void
-setfullscreen(Client *c, int fullscreen)
-{
-    static uint32 opacity = 0xFFFFFFFFul;
-	if (fullscreen && !c->isfullscreen) {
-		XChangeProperty(dpy, c->win, netatom[NetWMState], XA_ATOM, 32,
-			PropModeReplace, (uchar*)&netatom[NetWMFullscreen], 1);
-        XChangeProperty(dpy, c->win, netatom[NetWMWindowOpacity], XA_CARDINAL, 32, PropModeReplace, (uchar *)&opacity, 1L);
-
-		c->isfullscreen = 1;
-		c->oldstate     = c->isfloating;
-		c->oldbw        = c->bw;
-		c->bw           = 0;
-		c->isfloating   = 1;
-
-		resizeclient(c, c->mon->mx, c->mon->my, c->mon->mw, c->mon->mh);
-
-		XRaiseWindow(dpy, c->win);
-	} else if (!fullscreen && c->isfullscreen){
-		XChangeProperty(dpy, c->win, netatom[NetWMState], XA_ATOM, 32,
-			PropModeReplace, (uchar*)nil, 0);
-        XDeleteProperty(dpy, c->win, netatom[NetWMWindowOpacity]);
-
-		c->isfullscreen = 0;
-		c->isfloating   = c->oldstate;
-		c->bw = c->oldbw;
-		c->x  = c->oldx;
-		c->y  = c->oldy;
-		c->w  = c->oldw;
-		c->h  = c->oldh;
-		resizeclient(c, c->x, c->y, c->w, c->h);
-		arrange(c->mon);
-	}
-}
-
-void
-seturgent(Client *c, int urg)
-{
-	XWMHints *wmh;
-
-	c->isurgent = urg;
-	if (!(wmh = XGetWMHints(dpy, c->win)))
-		return;
-	wmh->flags = urg ? (wmh->flags | XUrgencyHint) : (wmh->flags & ~XUrgencyHint);
-	XSetWMHints(dpy, c->win, wmh);
-	XFree(wmh);
-}
-
-void
-showhide(Client *c)
-{
-	if (!c)
-		return;
-	if (ISVISIBLE(c)) {
-		/* show clients top down */
-		XMoveWindow(dpy, c->win, c->x, c->y);
-		if ((!c->mon->lt[c->mon->sellt]->arrange || c->isfloating) && !c->isfullscreen)
-			resize(c, c->x, c->y, c->w, c->h, 0);
-		showhide(c->snext);
-	} else {
-		/* hide clients bottom up */
-		showhide(c->snext);
-		XMoveWindow(dpy, c->win, WIDTH(c) * -2, c->y);
-	}
-}
-
-void
-swallow(Client *p, Client *c)
-{
-    Client *s;
-
-
-    if (c->noswallow > 0 || c->isterm)
-        return;
-    if (c->noswallow < 0 && !swallowfloating && c->isfloating)
-        return;
-
-    detach(c);
-    detachstack(c);
-
-    setclientstate(c, WithdrawnState);
-    XUnmapWindow(dpy, p->win);
-
-    p->swallowing = c;
-    c->mon = p->mon;
-
-    Window w = p->win;
-    p->win = c->win;
-    c->win = w;
-
-    XChangeProperty(dpy, c->win, netatom[NetClientList], XA_WINDOW, 32, PropModeReplace,
-        (unsigned char *) &(p->win), 1);
-
-    updatetitle(p);
-    s = scanner ? c : p;
-    XMoveResizeWindow(dpy, p->win, s->x, s->y, s->w, s->h);
-    arrange(p->mon);
-    configure(p);
-    updateclientlist();
-}
-
-Client *
-termof(Client *w)
-{
-	Client *c;
-	Monitor *m;
-
-	if (!w->pid || w->isterm)
-		return NULL;
-
-	for (m = mons; m; m = m->next) {
-		for (c = m->clients; c; c = c->next) {
-			if (c->isterm && !c->swallowing && c->pid && isdescendent(c->pid, w->pid))
-				return c;
-		}
-	}
-
-	return NULL;
-}
-
-void
-unfocus(Client *c, int setfocus)
-{
-	if (!c)
-		return;
-	grabbuttons(c, 0);
-	XSetWindowBorder(dpy, c->win, scheme[SchemeNorm][ColBorder].pixel);
-	if (setfocus) {
-		XSetInputFocus(dpy, root, RevertToPointerRoot, CurrentTime);
-		XDeleteProperty(dpy, root, netatom[NetActiveWindow]);
-	}
-}
-
-void
-unmanage(Client *c, int destroyed)
-{
-    Client *s;
-	Monitor *m = c->mon;
-	XWindowChanges wc;
-
-    if (c->swallowing) {
-        unswallow(c);
-        return;
-    }
-
-    s = swallowing(c->win);
-    if (s) {
-        free(s->swallowing);
-        s->swallowing = nil;
-        arrange(m);
-        focus(nil);
-        return;
-     }
-
-
-	detach(c);
-	detachstack(c);
-
-	if (!destroyed) {
-		wc.border_width = c->oldbw;
-		XGrabServer(dpy); /* avoid race conditions */
-		XSetErrorHandler(xerrordummy);
-		XConfigureWindow(dpy, c->win, CWBorderWidth, &wc); /* restore border */
-		XUngrabButton(dpy, AnyButton, AnyModifier, c->win);
-		setclientstate(c, WithdrawnState);
-		XSync(dpy, False);
-		XSetErrorHandler(xerror);
-		XUngrabServer(dpy);
-	}
-	free(c);
-	focus(nil);
-	updateclientlist();
-	arrange(m);
-
-    if (!s) {
-        // arrange(m);
-        focus(nil);
-        updateclientlist();
-    }
-}
-
-void
-unswallow(Client *c)
-{
-	c->win = c->swallowing->win;
-
-	free(c->swallowing);
-	c->swallowing = nil;
-
-	XDeleteProperty(dpy, c->win, netatom[NetClientList]);
-
-	/* unfullscreen the client */
-	setfullscreen(c, 0);
-	updatetitle(c);
-	arrange(c->mon);
-	XMapWindow(dpy, c->win);
-	XMoveResizeWindow(dpy, c->win, c->x, c->y, c->w, c->h);
-	setclientstate(c, NormalState);
-	focus(nil);
-	arrange(c->mon);
-}
-
-
-void
-updatesizehints(Client *c)
-{
-	long msize;
-	XSizeHints size;
-
-	if (!XGetWMNormalHints(dpy, c->win, &size, &msize))
-		/* size is uninitialized, ensure that size.flags aren't used */
-		size.flags = PSize;
-	if (size.flags & PBaseSize) {
-		c->basew = size.base_width;
-		c->baseh = size.base_height;
-	} else if (size.flags & PMinSize) {
-		c->basew = size.min_width;
-		c->baseh = size.min_height;
-	} else
-		c->basew = c->baseh = 0;
-	if (size.flags & PResizeInc) {
-		c->incw = size.width_inc;
-		c->inch = size.height_inc;
-	} else
-		c->incw = c->inch = 0;
-	if (size.flags & PMaxSize) {
-		c->maxw = size.max_width;
-		c->maxh = size.max_height;
-	} else
-		c->maxw = c->maxh = 0;
-	if (size.flags & PMinSize) {
-		c->minw = size.min_width;
-		c->minh = size.min_height;
-	} else if (size.flags & PBaseSize) {
-		c->minw = size.base_width;
-		c->minh = size.base_height;
-	} else
-		c->minw = c->minh = 0;
-	if (size.flags & PAspect) {
-		c->mina = (float)size.min_aspect.y / size.min_aspect.x;
-		c->maxa = (float)size.max_aspect.x / size.max_aspect.y;
-	} else
-		c->maxa = c->mina = 0.0;
-	c->isfixed = (c->maxw && c->maxh && c->maxw == c->minw && c->maxh == c->minh);
-}
-
-void
-updatetitle(Client *c)
-{
-	if (!gettextprop(c->win, netatom[NetWMName], c->name, sizeof c->name))
-		gettextprop(c->win, XA_WM_NAME, c->name, sizeof c->name);
-	if (c->name[0] == '\0') /* hack to mark broken clients */
-		strcpy(c->name, broken);
-}
-
-void
-updatewindowtype(Client *c)
-{
-	Atom state = getatomprop(c, netatom[NetWMState]);
-	Atom wtype = getatomprop(c, netatom[NetWMWindowType]);
-
-	if (state == netatom[NetWMFullscreen])
-		setfullscreen(c, 1);
-	if (wtype == netatom[NetWMWindowTypeDialog])
-		c->isfloating = 1;
-}
-
-void
-updatewmhints(Client *c)
-{
-	XWMHints *wmh;
-
-	if ((wmh = XGetWMHints(dpy, c->win))) {
-		if (c == selmon->sel && wmh->flags & XUrgencyHint) {
-			wmh->flags &= ~XUrgencyHint;
-			XSetWMHints(dpy, c->win, wmh);
-		} else
-			c->isurgent = (wmh->flags & XUrgencyHint) ? 1 : 0;
-		if (wmh->flags & InputHint)
-			c->neverfocus = !wmh->input;
-		else
-			c->neverfocus = 0;
-		XFree(wmh);
-	}
-}
diff --git a/sys/cmd/dwm/config.h b/sys/cmd/dwm/config.h
deleted file mode 100644
index 1f82b1f..0000000
--- a/sys/cmd/dwm/config.h
+++ /dev/null
@@ -1,141 +0,0 @@
-/* See LICENSE file for copyright and license details. */
-#define VERSION "1"
-
-/* appearance */
-static uint borderpx          = 2;        /* border pixel of windows */
-static uint gapx              = 4;        /* gaps between windows */
-static uint snap              = 32;       /* snap pixel */
-static int  swallowfloating   = 0;        /* 1 will swallow floating by default */
-static int  showbar           = 1;        /* 0 means no bar */
-static int  topbar            = 1;        /* 0 means bottom bar */
-static char *fonts[]          = { "consolas:size=16" };
-static char col_gray1[]       = "#504945";
-static char col_gray2[]       = "#282828";
-static char col_gray3[]       = "#fbf1c7";
-static char col_gray4[]       = "#504945";
-static char col_cyan[]        = "#83a598";
-static char *colors[][3]      = 
-{
-	/*               fg         bg         border   */
-	[SchemeNorm] = { col_gray3, col_gray1, col_gray2 },
-	[SchemeSel]  = { col_gray4, col_cyan,  col_cyan  },
-};
-
-/* tagging */
-static char *tags[] = { "1", "2", "3", "4", "5", "6", "7", "8", "9" };
-
-static Rule rules[] = {
-	/* xprop(1):
-	 *	WM_CLASS(STRING) = instance, class
-	 *	WM_NAME(STRING) = title
-	 */
-	/* class         instance    title       tags mask     isfloating   isterminal    noswallow      monitor */
-	{ "Gimp",          nil,       nil,        0,            1,           0,           0,              -1 },
-	{ "Inkscape",      nil,       nil,        0,            1,           0,           0,              -1 },
-	{ "zoom",          nil,       nil,        0,            1,           0,           0,              -1 },
-	{ "qutebrowser",   nil,       nil,        0,            0,           0,           0,              -1 },
-	{ "term-256color", nil,       nil,        0,            0,           1,          -1,              -1 },
-};
-
-/* layout(s) */
-static float mfact     = 0.55; /* factor of master area size [0.05..0.95] */
-static int nmaster     = 1;    /* number of clients in master area */
-static int resizehints = 1;    /* 1 means respect size hints in tiled resizals */
-
-static Layout layouts[] = {
-	/* symbol     arrange function */
-	{ "[]=",      tile },    /* first entry is default */
-	{ "><>",      nil },     /* no layout function means floating behavior */
-	{ "[M]",      monocle },
-};
-
-/* key definitions */
-#define MODKEY Mod4Mask
-#define TAGKEYS(KEY,TAG) \
-	{ MODKEY,                       KEY,      view,           {.ui = 1 << TAG} }, \
-	{ MODKEY|ControlMask,           KEY,      toggleview,     {.ui = 1 << TAG} }, \
-	{ MODKEY|ShiftMask,             KEY,      tag,            {.ui = 1 << TAG} }, \
-	{ MODKEY|ControlMask|ShiftMask, KEY,      toggletag,      {.ui = 1 << TAG} },
-
-/* commands */
-static char *menucmd[]  = { "menu_run", nil };
-static char *termcmd[]  = { "term", nil };
-static char *webscmd[]  = { "qutebrowser", nil };
-static char scratchname[] = "scratchpad";
-static char *scratchcmd[] = { "term", "-t", scratchname, "-g", "120x34", nil };
-static char *upvolcmd[] = { "vol", "+5%",  nil };
-static char *lovolcmd[] = { "vol", "-5%",  nil };
-static char *novolcmd[] = { "vol", "mute", nil };
-
-#define XK_lovol XF86XK_AudioLowerVolume
-#define XK_upvol XF86XK_AudioRaiseVolume
-#define XK_novol XF86XK_AudioMute
-
-static Key keys[] = {
-	/* modifier                     key        function        argument */
-	{ MODKEY,                       XK_d,      spawn,          {.v = menucmd } },
-	{ MODKEY,                       XK_Return, spawn,          {.v = termcmd } },
-	{ MODKEY,                       XK_q,      spawn,          {.v = webscmd } },
-	{ 0,                            XK_upvol,  spawn,          {.v = upvolcmd} },
-	{ 0,                            XK_lovol,  spawn,          {.v = lovolcmd} },
-	{ 0,                            XK_novol,  spawn,          {.v = novolcmd} },
-	{ MODKEY,                       XK_s,      togglescratch,  {.v = scratchcmd} },
-	{ MODKEY,                       XK_b,      togglebar,      {0} },
-	{ MODKEY,                       XK_f,      togglefocus,    {0} },
-	{ MODKEY,                       XK_Up,     focusstack,     {.i = +1 } },
-	{ MODKEY,                       XK_Down,   focusstack,     {.i = -1 } },
-	{ MODKEY|ShiftMask,             XK_Up,     rotatestack,    {.i = +1 } },
-	{ MODKEY|ShiftMask,             XK_Down,   rotatestack,    {.i = -1 } },
-	{ MODKEY,                       XK_i,      incnmaster,     {.i = +1 } },
-	{ MODKEY,                       XK_o,      incnmaster,     {.i = -1 } },
-	{ MODKEY,                       XK_h,      focusdirection, {.i = 'l'} },
-	{ MODKEY,                       XK_l,      focusdirection, {.i = 'r'} },
-	{ MODKEY,                       XK_k,      focusdirection, {.i = 'u'} },
-	{ MODKEY,                       XK_j,      focusdirection, {.i = 'd'} },
-	{ MODKEY|ShiftMask,             XK_h,      setmfact,       {.f = -0.05} },
-	{ MODKEY|ShiftMask,             XK_l,      setmfact,       {.f = +0.05} },
-	{ MODKEY|ShiftMask,             XK_k,      rotatestack,    {.i = -1 } },
-	{ MODKEY|ShiftMask,             XK_j,      rotatestack,    {.i = +1 } },
-	{ MODKEY|ShiftMask,             XK_Return, zoom,           {0} },
-	{ MODKEY,                       XK_Tab,    view,           {0} },
-	{ MODKEY|ShiftMask,             XK_q,      killclient,     {0} },
-	{ MODKEY|ShiftMask,             XK_t,      setlayout,      {.v = &layouts[0]} },
-	{ MODKEY|ShiftMask,             XK_f,      setlayout,      {.v = &layouts[1]} },
-	{ MODKEY|ShiftMask,             XK_m,      setlayout,      {.v = &layouts[2]} },
-	{ MODKEY,                       XK_space,  setlayout,      {0} },
-	{ MODKEY|ShiftMask,             XK_space,  togglefloating, {0} },
-	{ MODKEY,                       XK_0,      view,           {.ui = ~0 } },
-	{ MODKEY|ShiftMask,             XK_0,      tag,            {.ui = ~0 } },
-	{ MODKEY,                       XK_comma,  focusmon,       {.i = -1 } },
-	{ MODKEY,                       XK_period, focusmon,       {.i = +1 } },
-	{ MODKEY|ShiftMask,             XK_comma,  tagmon,         {.i = -1 } },
-	{ MODKEY|ShiftMask,             XK_period, tagmon,         {.i = +1 } },
-	TAGKEYS(                        XK_1,                      0)
-	TAGKEYS(                        XK_2,                      1)
-	TAGKEYS(                        XK_3,                      2)
-	TAGKEYS(                        XK_4,                      3)
-	TAGKEYS(                        XK_5,                      4)
-	TAGKEYS(                        XK_6,                      5)
-	TAGKEYS(                        XK_7,                      6)
-	TAGKEYS(                        XK_8,                      7)
-	TAGKEYS(                        XK_9,                      8)
-	{ MODKEY|ShiftMask,             XK_e,      quit,           {0} },
-};
-
-/* button definitions */
-/* click can be ClkTagBar, ClkLtSymbol, ClkStatusText, ClkWinTitle, ClkClientWin, or ClkRootWin */
-static Button buttons[] = {
-	/* click                event mask      button          function        argument */
-	{ ClkLtSymbol,          0,              Button1,        setlayout,      {0} },
-	{ ClkLtSymbol,          0,              Button3,        setlayout,      {.v = &layouts[2]} },
-	{ ClkWinTitle,          0,              Button2,        zoom,           {0} },
-	{ ClkStatusText,        0,              Button2,        spawn,          {.v = termcmd } },
-	{ ClkClientWin,         MODKEY,         Button1,        movemouse,      {0} },
-	{ ClkClientWin,         MODKEY,         Button2,        togglefloating, {0} },
-	{ ClkClientWin,         MODKEY,         Button3,        resizemouse,    {0} },
-	{ ClkTagBar,            0,              Button1,        view,           {0} },
-	{ ClkTagBar,            0,              Button3,        toggleview,     {0} },
-	{ ClkTagBar,            MODKEY,         Button1,        tag,            {0} },
-	{ ClkTagBar,            MODKEY,         Button3,        toggletag,      {0} },
-};
-
diff --git a/sys/cmd/dwm/drw.c b/sys/cmd/dwm/drw.c
deleted file mode 100644
index a6d6902..0000000
--- a/sys/cmd/dwm/drw.c
+++ /dev/null
@@ -1,376 +0,0 @@
-/* See LICENSE file for copyright and license details. */
-#include "dwm.h"
-
-Drw *
-drw_create(Display *dpy, int screen, Window root, unsigned int w, unsigned int h)
-{
-	Drw *drw = ecalloc(1, sizeof(Drw));
-
-	drw->dpy      = dpy;
-	drw->screen   = screen;
-	drw->root     = root;
-	drw->w        = w;
-	drw->h        = h;
-	drw->drawable = XCreatePixmap(dpy, root, w, h, DefaultDepth(dpy, screen));
-	drw->gc       = XCreateGC(dpy, root, 0, NULL);
-	XSetLineAttributes(dpy, drw->gc, 1, LineSolid, CapButt, JoinMiter);
-
-	return drw;
-}
-
-void
-drw_resize(Drw *drw, unsigned int w, unsigned int h)
-{
-	if (!drw)
-		return;
-
-	drw->w = w;
-	drw->h = h;
-	if (drw->drawable)
-		XFreePixmap(drw->dpy, drw->drawable);
-	drw->drawable = XCreatePixmap(drw->dpy, drw->root, w, h, DefaultDepth(drw->dpy, drw->screen));
-}
-
-void
-drw_free(Drw *drw)
-{
-	XFreePixmap(drw->dpy, drw->drawable);
-	XFreeGC(drw->dpy, drw->gc);
-	free(drw);
-}
-
-/* This function is an implementation detail. Library users should use
- * drw_fontset_create instead.
- */
-static Fnt *
-xfont_create(Drw *drw, char *fontname, FcPattern *fontpattern)
-{
-	Fnt *font;
-	XftFont *xfont = NULL;
-	FcPattern *pattern = NULL;
-
-	if (fontname) {
-		/* Using the pattern found at font->xfont->pattern does not yield the
-		 * same substitution results as using the pattern returned by
-		 * FcNameParse; using the latter results in the desired fallback
-		 * behaviour whereas the former just results in missing-character
-		 * rectangles being drawn, at least with some fonts. */
-		if (!(xfont = XftFontOpenName(drw->dpy, drw->screen, fontname))) {
-			fprintf(stderr, "error, cannot load font from name: '%s'\n", fontname);
-			return NULL;
-		}
-		if (!(pattern = FcNameParse((FcChar8 *) fontname))) {
-			fprintf(stderr, "error, cannot parse font name to pattern: '%s'\n", fontname);
-			XftFontClose(drw->dpy, xfont);
-			return NULL;
-		}
-	} else if (fontpattern) {
-		if (!(xfont = XftFontOpenPattern(drw->dpy, fontpattern))) {
-			fprintf(stderr, "error, cannot load font from pattern.\n");
-			return NULL;
-		}
-	} else {
-		fatal("no font specified.");
-	}
-
-	/* Do not allow using color fonts. This is a workaround for a BadLength
-	 * error from Xft with color glyphs. Modelled on the Xterm workaround. See
-	 * https://bugzilla.redhat.com/show_bug.cgi?id=1498269
-	 * https://lists.suckless.org/dev/1701/30932.html
-	 * https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=916349
-	 * and lots more all over the internet.
-	 */
-	FcBool iscol;
-	if(FcPatternGetBool(xfont->pattern, FC_COLOR, 0, &iscol) == FcResultMatch && iscol) {
-		XftFontClose(drw->dpy, xfont);
-		return NULL;
-	}
-
-	font = ecalloc(1, sizeof(Fnt));
-	font->xfont = xfont;
-	font->pattern = pattern;
-	font->h = xfont->ascent + xfont->descent;
-	font->dpy = drw->dpy;
-
-	return font;
-}
-
-static void
-xfont_free(Fnt *font)
-{
-	if (!font)
-		return;
-	if (font->pattern)
-		FcPatternDestroy(font->pattern);
-	XftFontClose(font->dpy, font->xfont);
-	free(font);
-}
-
-Fnt*
-drw_fontset_create(Drw* drw, char *fonts[], size_t fontcount)
-{
-	Fnt *cur, *ret = NULL;
-	size_t i;
-
-	if (!drw || !fonts)
-		return NULL;
-
-	for (i = 1; i <= fontcount; i++) {
-		if ((cur = xfont_create(drw, fonts[fontcount - i], NULL))) {
-			cur->next = ret;
-			ret = cur;
-		}
-	}
-	return (drw->fonts = ret);
-}
-
-void
-drw_fontset_free(Fnt *font)
-{
-	if (font) {
-		drw_fontset_free(font->next);
-		xfont_free(font);
-	}
-}
-
-void
-drw_clr_create(Drw *drw, Clr *dest, char *clrname)
-{
-	if (!drw || !dest || !clrname)
-		return;
-
-	if (!XftColorAllocName(drw->dpy, DefaultVisual(drw->dpy, drw->screen),
-	                       DefaultColormap(drw->dpy, drw->screen),
-	                       clrname, dest))
-		fatal("error, cannot allocate color '%s'", clrname);
-}
-
-/* Wrapper to create color schemes. The caller has to call free(3) on the
- * returned color scheme when done using it. */
-Clr *
-drw_scm_create(Drw *drw, char *clrnames[], size_t clrcount)
-{
-	size_t i;
-	Clr *ret;
-
-	/* need at least two colors for a scheme */
-	if (!drw || !clrnames || clrcount < 2 || !(ret = ecalloc(clrcount, sizeof(XftColor))))
-		return NULL;
-
-	for (i = 0; i < clrcount; i++)
-		drw_clr_create(drw, &ret[i], clrnames[i]);
-	return ret;
-}
-
-void
-drw_setfontset(Drw *drw, Fnt *set)
-{
-	if (drw)
-		drw->fonts = set;
-}
-
-void
-drw_setscheme(Drw *drw, Clr *scm)
-{
-	if (drw)
-		drw->scheme = scm;
-}
-
-void
-drw_rect(Drw *drw, int x, int y, unsigned int w, unsigned int h, int filled, int invert)
-{
-	if (!drw || !drw->scheme)
-		return;
-	XSetForeground(drw->dpy, drw->gc, invert ? drw->scheme[ColBg].pixel : drw->scheme[ColFg].pixel);
-	if (filled)
-		XFillRectangle(drw->dpy, drw->drawable, drw->gc, x, y, w, h);
-	else
-		XDrawRectangle(drw->dpy, drw->drawable, drw->gc, x, y, w - 1, h - 1);
-}
-
-int
-drw_text(Drw *drw, int x, int y, unsigned int w, unsigned int h, unsigned int lpad, char *text, int invert)
-{
-	char buf[1024];
-	int ty;
-	unsigned int ew;
-	XftDraw *d = NULL;
-	Fnt *usedfont, *curfont, *nextfont;
-	size_t i, len;
-	int utf8strlen, utf8charlen, render = x || y || w || h;
-	rune utf8codepoint = 0;
-	char *utf8str;
-	FcCharSet *fccharset;
-	FcPattern *fcpattern;
-	FcPattern *match;
-	XftResult result;
-	int charexists = 0;
-
-	if (!drw || (render && !drw->scheme) || !text || !drw->fonts)
-		return 0;
-
-	if (!render) {
-		w = ~w;
-	} else {
-		XSetForeground(drw->dpy, drw->gc, drw->scheme[invert ? ColFg : ColBg].pixel);
-		XFillRectangle(drw->dpy, drw->drawable, drw->gc, x, y, w, h);
-		d = XftDrawCreate(drw->dpy, drw->drawable,
-		                  DefaultVisual(drw->dpy, drw->screen),
-		                  DefaultColormap(drw->dpy, drw->screen));
-		x += lpad;
-		w -= lpad;
-	}
-
-	usedfont = drw->fonts;
-	while (1) {
-		utf8strlen = 0;
-		utf8str = text;
-		nextfont = NULL;
-		while (*text) {
-			utf8charlen = utf8·decode(text, &utf8codepoint);
-			for (curfont = drw->fonts; curfont; curfont = curfont->next) {
-				charexists = charexists || XftCharExists(drw->dpy, curfont->xfont, utf8codepoint);
-				if (charexists) {
-					if (curfont == usedfont) {
-						utf8strlen += utf8charlen;
-						text += utf8charlen;
-					} else {
-						nextfont = curfont;
-					}
-					break;
-				}
-			}
-
-			if (!charexists || nextfont)
-				break;
-			else
-				charexists = 0;
-		}
-
-		if (utf8strlen) {
-			drw_font_getexts(usedfont, utf8str, utf8strlen, &ew, NULL);
-			/* shorten text if necessary */
-			for (len = MIN(utf8strlen, sizeof(buf) - 1); len && ew > w; len--)
-				drw_font_getexts(usedfont, utf8str, len, &ew, NULL);
-
-			if (len) {
-				memcpy(buf, utf8str, len);
-				buf[len] = '\0';
-				if (len < utf8strlen)
-					for (i = len; i && i > len - 3; buf[--i] = '.')
-						; /* NOP */
-
-				if (render) {
-					ty = y + (h - usedfont->h) / 2 + usedfont->xfont->ascent;
-					XftDrawStringUtf8(d, &drw->scheme[invert ? ColBg : ColFg],
-					                  usedfont->xfont, x, ty, (XftChar8 *)buf, len);
-				}
-				x += ew;
-				w -= ew;
-			}
-		}
-
-		if (!*text) {
-			break;
-		} else if (nextfont) {
-			charexists = 0;
-			usedfont = nextfont;
-		} else {
-			/* Regardless of whether or not a fallback font is found, the
-			 * character must be drawn. */
-			charexists = 1;
-
-			fccharset = FcCharSetCreate();
-			FcCharSetAddChar(fccharset, utf8codepoint);
-
-			if (!drw->fonts->pattern) {
-				/* Refer to the comment in xfont_create for more information. */
-				fatal("the first font in the cache must be loaded from a font string.");
-			}
-
-			fcpattern = FcPatternDuplicate(drw->fonts->pattern);
-			FcPatternAddCharSet(fcpattern, FC_CHARSET, fccharset);
-			FcPatternAddBool(fcpattern, FC_SCALABLE, FcTrue);
-			FcPatternAddBool(fcpattern, FC_COLOR, FcFalse);
-
-			FcConfigSubstitute(NULL, fcpattern, FcMatchPattern);
-			FcDefaultSubstitute(fcpattern);
-			match = XftFontMatch(drw->dpy, drw->screen, fcpattern, &result);
-
-			FcCharSetDestroy(fccharset);
-			FcPatternDestroy(fcpattern);
-
-			if (match) {
-				usedfont = xfont_create(drw, NULL, match);
-				if (usedfont && XftCharExists(drw->dpy, usedfont->xfont, utf8codepoint)) {
-					for (curfont = drw->fonts; curfont->next; curfont = curfont->next)
-						; /* NOP */
-					curfont->next = usedfont;
-				} else {
-					xfont_free(usedfont);
-					usedfont = drw->fonts;
-				}
-			}
-		}
-	}
-	if (d)
-		XftDrawDestroy(d);
-
-	return x + (render ? w : 0);
-}
-
-void
-drw_map(Drw *drw, Window win, int x, int y, unsigned int w, unsigned int h)
-{
-	if (!drw)
-		return;
-
-	XCopyArea(drw->dpy, drw->drawable, win, drw->gc, x, y, w, h, x, y);
-	XSync(drw->dpy, False);
-}
-
-unsigned int
-drw_fontset_getwidth(Drw *drw, char *text)
-{
-	if (!drw || !drw->fonts || !text)
-		return 0;
-	return drw_text(drw, 0, 0, 0, 0, 0, text, 0);
-}
-
-void
-drw_font_getexts(Fnt *font, char *text, unsigned int len, unsigned int *w, unsigned int *h)
-{
-	XGlyphInfo ext;
-
-	if (!font || !text)
-		return;
-
-	XftTextExtentsUtf8(font->dpy, font->xfont, (XftChar8 *)text, len, &ext);
-	if (w)
-		*w = ext.xOff;
-	if (h)
-		*h = font->h;
-}
-
-Cur *
-drw_cur_create(Drw *drw, int shape)
-{
-	Cur *cur;
-
-	if (!drw || !(cur = ecalloc(1, sizeof(Cur))))
-		return NULL;
-
-	cur->cursor = XCreateFontCursor(drw->dpy, shape);
-
-	return cur;
-}
-
-void
-drw_cur_free(Drw *drw, Cur *cursor)
-{
-	if (!cursor)
-		return;
-
-	XFreeCursor(drw->dpy, cursor->cursor);
-	free(cursor);
-}
diff --git a/sys/cmd/dwm/dwm.c b/sys/cmd/dwm/dwm.c
deleted file mode 100644
index 0567650..0000000
--- a/sys/cmd/dwm/dwm.c
+++ /dev/null
@@ -1,1185 +0,0 @@
-#include "dwm.h"
-
-/* global variables */
-char broken[] = "<broken>";
-char stext[256];
-int scanner;
-int screen;
-int sw, sh;           /* X display screen geometry width, height */
-int bh, blw = 0;      /* bar geometry */
-int lrpad;            /* sum of left and right padding for text */
-int (*xerrorxlib)(Display *, XErrorEvent *);
-uint numlockmask = 0;
-void (*handler[LASTEvent]) (XEvent *) = {
-	[ButtonPress]      = buttonpress,
-	[ClientMessage]    = clientmessage,
-	[ConfigureRequest] = configurerequest,
-	[ConfigureNotify]  = configurenotify,
-	[DestroyNotify]    = destroynotify,
-	[EnterNotify]      = enternotify,
-	[Expose]           = expose,
-	[FocusIn]          = focusin,
-	[KeyPress]         = keypress,
-	[MappingNotify]    = mappingnotify,
-	[MapRequest]       = maprequest,
-	[MotionNotify]     = motionnotify,
-	[PropertyNotify]   = propertynotify,
-	[UnmapNotify]      = unmapnotify
-};
-
-xcb_connection_t *xcon;
-
-Atom wmatom[WMLast] = {0}, netatom[NetLast] = {0};
-int running = 1;
-Cur *cursor[MouseLast] = {0};
-Clr **scheme  = nil;
-Display *dpy  = nil;
-Drw *drw      = nil;
-Monitor *mons = nil, *selmon = nil;
-Window root = {0}, wmcheckwin = {0};
-
-/* compile-time check if all tags fit into an uint bit array. */
-struct NumTags { char limitexceeded[arrlen(tags) > 31 ? -1 : 1]; };
-
-/* function implementations */
-void
-arrange(Monitor *m)
-{
-	if (m)
-		showhide(m->stack);
-	else for (m = mons; m; m = m->next)
-		showhide(m->stack);
-	if (m) {
-		arrangemon(m);
-		restack(m);
-	} else for (m = mons; m; m = m->next)
-		arrangemon(m);
-}
-
-void
-arrangemon(Monitor *m)
-{
-	strncpy(m->ltsymbol, m->lt[m->sellt]->symbol, sizeof m->ltsymbol);
-	if (m->lt[m->sellt]->arrange)
-		m->lt[m->sellt]->arrange(m);
-}
-
-void
-buttonpress(XEvent *e)
-{
-	uint i, x, click;
-	Arg arg = {0};
-	Client *c;
-	Monitor *m;
-	XButtonPressedEvent *ev = &e->xbutton;
-
-	click = ClkRootWin;
-	/* focus monitor if necessary */
-	if ((m = wintomon(ev->window)) && m != selmon) {
-		unfocus(selmon->sel, 1);
-		selmon = m;
-		focus(nil);
-	}
-	if (ev->window == selmon->barwin) {
-		i = x = 0;
-		do
-			x += TEXTW(tags[i]);
-		while (ev->x >= x && ++i < arrlen(tags));
-		if (i < arrlen(tags)) {
-			click = ClkTagBar;
-			arg.ui = 1 << i;
-		} else if (ev->x < x + blw)
-			click = ClkLtSymbol;
-		else if (ev->x > selmon->ww - TEXTW(stext))
-			click = ClkStatusText;
-		else
-			click = ClkWinTitle;
-	} else if ((c = wintoclient(ev->window))) {
-		focus(c);
-		restack(selmon);
-		XAllowEvents(dpy, ReplayPointer, CurrentTime);
-		click = ClkClientWin;
-	}
-	for (i = 0; i < arrlen(buttons); i++)
-		if (click == buttons[i].click && buttons[i].func && buttons[i].button == ev->button
-		&& CLEANMASK(buttons[i].mask) == CLEANMASK(ev->state))
-			buttons[i].func(click == ClkTagBar && buttons[i].arg.i == 0 ? &arg : &buttons[i].arg);
-}
-
-void
-checkotherwm(void)
-{
-	xerrorxlib = XSetErrorHandler(xerrorstart);
-	/* this causes an error if some other window manager is running */
-	XSelectInput(dpy, DefaultRootWindow(dpy), SubstructureRedirectMask);
-	XSync(dpy, False);
-	XSetErrorHandler(xerror);
-	XSync(dpy, False);
-}
-
-void
-cleanup(void)
-{
-	Arg a = {.ui = ~0};
-	Layout foo = { "", nil };
-	Monitor *m;
-	size_t i;
-
-	view(&a);
-	selmon->lt[selmon->sellt] = &foo;
-	for (m = mons; m; m = m->next)
-		while (m->stack)
-			unmanage(m->stack, 0);
-	XUngrabKey(dpy, AnyKey, AnyModifier, root);
-	while (mons)
-		cleanupmon(mons);
-	for (i = 0; i < MouseLast; i++)
-		drw_cur_free(drw, cursor[i]);
-	for (i = 0; i < arrlen(colors); i++)
-		free(scheme[i]);
-	XDestroyWindow(dpy, wmcheckwin);
-	drw_free(drw);
-	XSync(dpy, False);
-	XSetInputFocus(dpy, PointerRoot, RevertToPointerRoot, CurrentTime);
-	XDeleteProperty(dpy, root, netatom[NetActiveWindow]);
-}
-
-void
-cleanupmon(Monitor *mon)
-{
-	Monitor *m;
-
-	if (mon == mons)
-		mons = mons->next;
-	else {
-		for (m = mons; m && m->next != mon; m = m->next);
-		m->next = mon->next;
-	}
-	XUnmapWindow(dpy, mon->barwin);
-	XDestroyWindow(dpy, mon->barwin);
-	free(mon);
-}
-
-void
-clientmessage(XEvent *e)
-{
-	XClientMessageEvent *cme = &e->xclient;
-	Client *c = wintoclient(cme->window);
-
-	if (!c)
-		return;
-	if (cme->message_type == netatom[NetWMState]) {
-		if (cme->data.l[1] == netatom[NetWMFullscreen]
-		|| cme->data.l[2] == netatom[NetWMFullscreen])
-			setfullscreen(c, (cme->data.l[0] == 1 /* _NET_WM_STATE_ADD    */
-				|| (cme->data.l[0] == 2 /* _NET_WM_STATE_TOGGLE */ && !c->isfullscreen)));
-	} else if (cme->message_type == netatom[NetActiveWindow]) {
-		if (c != selmon->sel && !c->isurgent)
-			seturgent(c, 1);
-	}
-}
-
-void
-configurenotify(XEvent *e)
-{
-	Monitor *m;
-	Client *c;
-	XConfigureEvent *ev = &e->xconfigure;
-	int dirty;
-
-	/* TODO: updategeom handling sucks, needs to be simplified */
-	if (ev->window == root) {
-		dirty = (sw != ev->width || sh != ev->height);
-		sw = ev->width;
-		sh = ev->height;
-		if (updategeom() || dirty) {
-			drw_resize(drw, sw, bh);
-			updatebars();
-			for (m = mons; m; m = m->next) {
-				for (c = m->clients; c; c = c->next)
-					if (c->isfullscreen)
-						resizeclient(c, m->mx, m->my, m->mw, m->mh);
-				XMoveResizeWindow(dpy, m->barwin, m->wx, m->by, m->ww, bh);
-			}
-			focus(nil);
-			arrange(nil);
-		}
-	}
-}
-
-void
-configurerequest(XEvent *e)
-{
-	Client *c;
-	Monitor *m;
-	XConfigureRequestEvent *ev = &e->xconfigurerequest;
-	XWindowChanges wc;
-
-	if ((c = wintoclient(ev->window))) {
-		if (ev->value_mask & CWBorderWidth)
-			c->bw = ev->border_width;
-		else if (c->isfloating || !selmon->lt[selmon->sellt]->arrange) {
-			m = c->mon;
-			if (ev->value_mask & CWX) {
-				c->oldx = c->x;
-				c->x = m->mx + ev->x;
-			}
-			if (ev->value_mask & CWY) {
-				c->oldy = c->y;
-				c->y = m->my + ev->y;
-			}
-			if (ev->value_mask & CWWidth) {
-				c->oldw = c->w;
-				c->w = ev->width;
-			}
-			if (ev->value_mask & CWHeight) {
-				c->oldh = c->h;
-				c->h = ev->height;
-			}
-			if ((c->x + c->w) > m->mx + m->mw && c->isfloating)
-				c->x = m->mx + (m->mw / 2 - WIDTH(c) / 2); /* center in x direction */
-			if ((c->y + c->h) > m->my + m->mh && c->isfloating)
-				c->y = m->my + (m->mh / 2 - HEIGHT(c) / 2); /* center in y direction */
-			if ((ev->value_mask & (CWX|CWY)) && !(ev->value_mask & (CWWidth|CWHeight)))
-				configure(c);
-			if (ISVISIBLE(c))
-				XMoveResizeWindow(dpy, c->win, c->x, c->y, c->w, c->h);
-		} else
-			configure(c);
-	} else {
-		wc.x = ev->x;
-		wc.y = ev->y;
-		wc.width = ev->width;
-		wc.height = ev->height;
-		wc.border_width = ev->border_width;
-		wc.sibling = ev->above;
-		wc.stack_mode = ev->detail;
-		XConfigureWindow(dpy, ev->window, ev->value_mask, &wc);
-	}
-	XSync(dpy, False);
-}
-
-Monitor *
-createmon(void)
-{
-	Monitor *m;
-
-	m = ecalloc(1, sizeof(Monitor));
-	m->tagset[0] = m->tagset[1] = 1;
-	m->mfact = mfact;
-	m->nmaster = nmaster;
-	m->showbar = showbar;
-	m->topbar = topbar;
-	m->lt[0] = &layouts[0];
-	m->lt[1] = &layouts[1 % arrlen(layouts)];
-	strncpy(m->ltsymbol, layouts[0].symbol, sizeof m->ltsymbol);
-	return m;
-}
-
-void
-destroynotify(XEvent *e)
-{
-	Client *c;
-	XDestroyWindowEvent *ev = &e->xdestroywindow;
-
-	if ((c = wintoclient(ev->window)))
-		unmanage(c, 1);
-    else if ((c = swallowing(ev->window)))
-        unmanage(c->swallowing, 1);
-}
-
-Monitor *
-dirtomon(int dir)
-{
-	Monitor *m = nil;
-
-	if (dir > 0) {
-		if (!(m = selmon->next))
-			m = mons;
-	} else if (selmon == mons)
-		for (m = mons; m->next; m = m->next);
-	else
-		for (m = mons; m->next != selmon; m = m->next);
-	return m;
-}
-
-void
-drawbar(Monitor *m)
-{
-	int x, w, tw = 0;
-	int boxs = drw->fonts->h / 9;
-	int boxw = drw->fonts->h / 6 + 2;
-	uint i, occ = 0, urg = 0;
-	Client *c;
-
-	/* draw status first so it can be overdrawn by tags later */
-	if(m == selmon) { /* status is only drawn on selected monitor */
-		drw_setscheme(drw, scheme[SchemeNorm]);
-		tw = TEXTW(stext) - lrpad + 2; /* 2px right padding */
-		drw_text(drw, m->ww - tw, 0, tw, bh, 0, stext, 0);
-	}
-
-	for(c = m->clients; c; c = c->next) {
-		occ |= c->tags;
-		if (c->isurgent)
-			urg |= c->tags;
-	}
-	x = 0;
-	for(i = 0; i < arrlen(tags); i++) {
-		w = TEXTW(tags[i]);
-		drw_setscheme(drw, scheme[m->tagset[m->seltags] & 1 << i ? SchemeSel : SchemeNorm]);
-		drw_text(drw, x, 0, w, bh, lrpad / 2, tags[i], urg & 1 << i);
-		if (occ & 1 << i)
-			drw_rect(drw, x + boxs, boxs, boxw, boxw,
-				m == selmon && selmon->sel && selmon->sel->tags & 1 << i,
-				urg & 1 << i);
-		x += w;
-	}
-	w = blw = TEXTW(m->ltsymbol);
-	drw_setscheme(drw, scheme[SchemeNorm]);
-	x = drw_text(drw, x, 0, w, bh, lrpad / 2, m->ltsymbol, 0);
-
-	if((w = m->ww - tw - x) > bh) {
-		if (m->sel) {
-			drw_setscheme(drw, scheme[m == selmon ? SchemeSel : SchemeNorm]);
-			drw_text(drw, x, 0, w, bh, lrpad / 2, m->sel->name, 0);
-			if (m->sel->isfloating)
-				drw_rect(drw, x + boxs, boxs, boxw, boxw, m->sel->isfixed, 0);
-		} else {
-			drw_setscheme(drw, scheme[SchemeNorm]);
-			drw_rect(drw, x, 0, w, bh, 1, 1);
-		}
-	}
-	drw_map(drw, m->barwin, 0, 0, m->ww, bh);
-}
-
-void
-drawbars(void)
-{
-	Monitor *m;
-
-	for (m = mons; m; m = m->next)
-		drawbar(m);
-}
-
-void
-enternotify(XEvent *e)
-{
-	Client *c;
-	Monitor *m;
-	XCrossingEvent *ev = &e->xcrossing;
-
-	if ((ev->mode != NotifyNormal || ev->detail == NotifyInferior) && ev->window != root)
-		return;
-	c = wintoclient(ev->window);
-	m = c ? c->mon : wintomon(ev->window);
-	if (m != selmon) {
-		unfocus(selmon->sel, 1);
-		selmon = m;
-	} else if (!c || c == selmon->sel)
-		return;
-	focus(c);
-}
-
-void
-expose(XEvent *e)
-{
-	Monitor *m;
-	XExposeEvent *ev = &e->xexpose;
-
-	if (ev->count == 0 && (m = wintomon(ev->window)))
-		drawbar(m);
-}
-
-/* there are some broken focus acquiring clients needing extra handling */
-void
-focusin(XEvent *e)
-{
-	XFocusChangeEvent *ev = &e->xfocus;
-
-	if (selmon->sel && ev->window != selmon->sel->win)
-		setfocus(selmon->sel);
-}
-
-int
-getrootptr(int *x, int *y)
-{
-	int di;
-	uint dui;
-	Window dummy;
-
-	return XQueryPointer(dpy, root, &dummy, &dummy, x, y, &di, &di, &dui);
-}
-
-long
-getstate(Window w)
-{
-	int format;
-	long result = -1;
-	unsigned char *p = nil;
-	unsigned long n, extra;
-	Atom real;
-
-	if (XGetWindowProperty(dpy, w, wmatom[WMState], 0L, 2L, False, wmatom[WMState],
-		&real, &format, &n, &extra, (unsigned char **)&p) != Success)
-		return -1;
-	if (n != 0)
-		result = *p;
-	XFree(p);
-	return result;
-}
-
-int
-gettextprop(Window w, Atom atom, char *text, uint size)
-{
-	char **list = nil;
-	int n;
-	XTextProperty name;
-
-	if (!text || size == 0)
-		return 0;
-	text[0] = '\0';
-	if (!XGetTextProperty(dpy, w, &name, atom) || !name.nitems)
-		return 0;
-	if (name.encoding == XA_STRING)
-		strncpy(text, (char *)name.value, size - 1);
-	else {
-		if (XmbTextPropertyToTextList(dpy, &name, &list, &n) >= Success && n > 0 && *list) {
-			strncpy(text, *list, size - 1);
-			XFreeStringList(list);
-		}
-	}
-	text[size - 1] = '\0';
-	XFree(name.value);
-	return 1;
-}
-
-void
-grabkeys(void)
-{
-	updatenumlockmask();
-	{
-		uint i, j;
-		uint modifiers[] = { 0, LockMask, numlockmask, numlockmask|LockMask };
-		KeyCode code;
-
-		XUngrabKey(dpy, AnyKey, AnyModifier, root);
-		for (i = 0; i < arrlen(keys); i++)
-			if ((code = XKeysymToKeycode(dpy, keys[i].keysym)))
-				for (j = 0; j < arrlen(modifiers); j++)
-					XGrabKey(dpy, code, keys[i].mod | modifiers[j], root,
-						True, GrabModeAsync, GrabModeAsync);
-	}
-}
-
-static 
-int
-isuniquegeom(XineramaScreenInfo *unique, size_t n, XineramaScreenInfo *info)
-{
-	while (n--)
-		if (unique[n].x_org == info->x_org && unique[n].y_org == info->y_org
-		&& unique[n].width == info->width && unique[n].height == info->height)
-			return 0;
-	return 1;
-}
-
-void
-keypress(XEvent *e)
-{
-	uint i;
-	KeySym keysym;
-	XKeyEvent *ev;
-
-	ev = &e->xkey;
-	keysym = XkbKeycodeToKeysym(dpy, (KeyCode)ev->keycode, 0, 0);
-	for (i = 0; i < arrlen(keys); i++)
-		if (keysym == keys[i].keysym
-		&& CLEANMASK(keys[i].mod) == CLEANMASK(ev->state)
-		&& keys[i].func)
-			keys[i].func(&(keys[i].arg));
-}
-
-void
-manage(Window w, XWindowAttributes *wa)
-{
-	Client *c, *t = nil, *term = nil;
-	Window trans = None;
-	XWindowChanges wc;
-
-	c = ecalloc(1, sizeof(Client));
-	c->win = w;
-    c->pid = winpid(w);
-	/* geometry */
-	c->x = c->oldx = wa->x;
-	c->y = c->oldy = wa->y;
-	c->w = c->oldw = wa->width;
-	c->h = c->oldh = wa->height;
-	c->oldbw = wa->border_width;
-
-	updatetitle(c);
-	if (XGetTransientForHint(dpy, w, &trans) && (t = wintoclient(trans))) {
-		c->mon = t->mon;
-		c->tags = t->tags;
-	} else {
-		c->mon = selmon;
-		applyrules(c);
-        term = termof(c);
-	}
-
-	if (c->x + WIDTH(c) > c->mon->mx + c->mon->mw)
-		c->x = c->mon->mx + c->mon->mw - WIDTH(c);
-	if (c->y + HEIGHT(c) > c->mon->my + c->mon->mh)
-		c->y = c->mon->my + c->mon->mh - HEIGHT(c);
-	c->x = MAX(c->x, c->mon->mx);
-	/* only fix client y-offset, if the client center might cover the bar */
-	c->y = MAX(c->y, ((c->mon->by == c->mon->my) && (c->x + (c->w / 2) >= c->mon->wx)
-		&& (c->x + (c->w / 2) < c->mon->wx + c->mon->ww)) ? bh : c->mon->my);
-	c->bw = borderpx;
-
-    selmon->tagset[selmon->seltags] &= ~scratchtag;
-    if(!strcmp(c->name, scratchname)) {
-        c->mon->tagset[c->mon->seltags] |= c->tags = scratchtag;
-        c->isfloating = 1;
-        c->x = c->mon->wx + (c->mon->ww / 2 - WIDTH(c) / 2);
-        c->y = c->mon->wy + (c->mon->wh / 2 - HEIGHT(c) / 2);
-    }
-
-	wc.border_width = c->bw;
-	XConfigureWindow(dpy, w, CWBorderWidth, &wc);
-	XSetWindowBorder(dpy, w, scheme[SchemeNorm][ColBorder].pixel);
-	configure(c); /* propagates border_width, if size doesn't change */
-	updatewindowtype(c);
-	updatesizehints(c);
-	updatewmhints(c);
-	XSelectInput(dpy, w, EnterWindowMask|FocusChangeMask|PropertyChangeMask|StructureNotifyMask);
-	grabbuttons(c, 0);
-
-	if (!c->isfloating)
-		c->isfloating = c->oldstate = trans != None || c->isfixed;
-	if (c->isfloating)
-		XRaiseWindow(dpy, c->win);
-
-	/* attach(c); */
-    attachbottom(c);
-	attachstack(c);
-
-	XChangeProperty(dpy, root, netatom[NetClientList], XA_WINDOW, 32, PropModeAppend,
-		(unsigned char *) &(c->win), 1);
-	XMoveResizeWindow(dpy, c->win, c->x + 2 * sw, c->y, c->w, c->h); /* some windows require this */
-	setclientstate(c, NormalState);
-	if (c->mon == selmon)
-		unfocus(selmon->sel, 0);
-	c->mon->sel = c;
-	arrange(c->mon);
-	XMapWindow(dpy, c->win);
-    if (term)
-        swallow(term, c);
-	focus(nil);
-}
-
-void
-mappingnotify(XEvent *e)
-{
-	XMappingEvent *ev = &e->xmapping;
-
-	XRefreshKeyboardMapping(ev);
-	if (ev->request == MappingKeyboard)
-		grabkeys();
-}
-
-void
-maprequest(XEvent *e)
-{
-	static XWindowAttributes wa;
-	XMapRequestEvent *ev = &e->xmaprequest;
-
-	if (!XGetWindowAttributes(dpy, ev->window, &wa))
-		return;
-	if (wa.override_redirect)
-		return;
-	if (!wintoclient(ev->window))
-		manage(ev->window, &wa);
-}
-
-void
-monocle(Monitor *m)
-{
-	uint n = 0;
-	Client *c;
-
-	for (c = m->clients; c; c = c->next)
-		if (ISVISIBLE(c))
-			n++;
-	if (n > 0) /* override layout symbol */
-		snprintf(m->ltsymbol, sizeof m->ltsymbol, "[%d]", n);
-	for (c = nexttiled(m->clients); c; c = nexttiled(c->next))
-		resize(c, m->wx, m->wy, m->ww - 2 * c->bw, m->wh - 2 * c->bw, 0);
-}
-
-void
-motionnotify(XEvent *e)
-{
-	static Monitor *mon = nil;
-	Monitor *m;
-	XMotionEvent *ev = &e->xmotion;
-
-	if (ev->window != root)
-		return;
-	if ((m = recttomon(ev->x_root, ev->y_root, 1, 1)) != mon && mon) {
-		unfocus(selmon->sel, 1);
-		selmon = m;
-		focus(nil);
-	}
-	mon = m;
-}
-
-void
-propertynotify(XEvent *e)
-{
-	Client *c;
-	Window trans;
-	XPropertyEvent *ev = &e->xproperty;
-
-	if ((ev->window == root) && (ev->atom == XA_WM_NAME))
-		updatestatus();
-	else if (ev->state == PropertyDelete)
-		return; /* ignore */
-	else if ((c = wintoclient(ev->window))) {
-		switch(ev->atom) {
-		default: break;
-		case XA_WM_TRANSIENT_FOR:
-			if (!c->isfloating && (XGetTransientForHint(dpy, c->win, &trans)) &&
-				(c->isfloating = (wintoclient(trans)) != nil))
-				arrange(c->mon);
-			break;
-		case XA_WM_NORMAL_HINTS:
-			updatesizehints(c);
-			break;
-		case XA_WM_HINTS:
-			updatewmhints(c);
-			drawbars();
-			break;
-		}
-		if (ev->atom == XA_WM_NAME || ev->atom == netatom[NetWMName]) {
-			updatetitle(c);
-			if (c == c->mon->sel)
-				drawbar(c->mon);
-		}
-		if (ev->atom == netatom[NetWMWindowType])
-			updatewindowtype(c);
-	}
-}
-
-Monitor *
-recttomon(int x, int y, int w, int h)
-{
-	Monitor *m, *r = selmon;
-	int a, area = 0;
-
-	for (m = mons; m; m = m->next)
-		if ((a = INTERSECT(x, y, w, h, m)) > area) {
-			area = a;
-			r = m;
-		}
-	return r;
-}
-
-void
-restack(Monitor *m)
-{
-	Client *c;
-	XEvent ev;
-	XWindowChanges wc;
-
-	drawbar(m);
-	if (!m->sel)
-		return;
-	if (m->sel->isfloating || !m->lt[m->sellt]->arrange)
-		XRaiseWindow(dpy, m->sel->win);
-	if (m->lt[m->sellt]->arrange) {
-		wc.stack_mode = Below;
-		wc.sibling = m->barwin;
-		for (c = m->stack; c; c = c->snext)
-			if (!c->isfloating && ISVISIBLE(c)) {
-				XConfigureWindow(dpy, c->win, CWSibling|CWStackMode, &wc);
-				wc.sibling = c->win;
-			}
-	}
-	XSync(dpy, False);
-	while (XCheckMaskEvent(dpy, EnterWindowMask, &ev));
-}
-
-void
-run(void)
-{
-	XEvent ev;
-	/* main event loop */
-	XSync(dpy, False);
-	while (running && !XNextEvent(dpy, &ev))
-		if (handler[ev.type])
-			handler[ev.type](&ev); /* call handler */
-}
-
-void
-scan(void)
-{
-	uint i, num;
-	Window d1, d2, *wins = nil;
-	XWindowAttributes wa;
-    char swin[256];
-
-    scanner = 1;
-
-	if (XQueryTree(dpy, root, &d1, &d2, &wins, &num)) {
-		for (i = 0; i < num; i++) {
-			if (!XGetWindowAttributes(dpy, wins[i], &wa)
-			|| wa.override_redirect || XGetTransientForHint(dpy, wins[i], &d1))
-				continue;
-			if (wa.map_state == IsViewable || getstate(wins[i]) == IconicState)
-				manage(wins[i], &wa);
-            else if (gettextprop(wins[i], netatom[NetClientList], swin, sizeof swin))
-                manage(wins[i], &wa);
-		}
-		for (i = 0; i < num; i++) { /* now the transients */
-			if (!XGetWindowAttributes(dpy, wins[i], &wa))
-				continue;
-			if (XGetTransientForHint(dpy, wins[i], &d1)
-			&& (wa.map_state == IsViewable || getstate(wins[i]) == IconicState))
-				manage(wins[i], &wa);
-		}
-		if (wins)
-			XFree(wins);
-	}
-
-    scanner = 0;
-}
-
-void
-setup(void)
-{
-	int i;
-	XSetWindowAttributes wa;
-	Atom utf8string;
-
-	/* clean up any zombies immediately */
-	sigchld(0);
-
-	/* init screen */
-	screen = DefaultScreen(dpy);
-	sw   = DisplayWidth(dpy, screen);
-	sh   = DisplayHeight(dpy, screen);
-	root = RootWindow(dpy, screen);
-	drw  = drw_create(dpy, screen, root, sw, sh);
-	if (!drw_fontset_create(drw, fonts, arrlen(fonts)))
-		fatal("no fonts could be loaded.");
-
-	lrpad = drw->fonts->h;
-	bh    = drw->fonts->h + 2;
-	updategeom();
-
-	/* init atoms */
-	utf8string          = XInternAtom(dpy, "UTF8_STRING", False);
-	wmatom[WMProtocols] = XInternAtom(dpy, "WM_PROTOCOLS", False);
-	wmatom[WMDelete]    = XInternAtom(dpy, "WM_DELETE_WINDOW", False);
-	wmatom[WMState]     = XInternAtom(dpy, "WM_STATE", False);
-	wmatom[WMTakeFocus] = XInternAtom(dpy, "WM_TAKE_FOCUS", False);
-
-	netatom[NetActiveWindow]       = XInternAtom(dpy, "_NET_ACTIVE_WINDOW", False);
-	netatom[NetSupported]          = XInternAtom(dpy, "_NET_SUPPORTED", False);
-	netatom[NetWMName]             = XInternAtom(dpy, "_NET_WM_NAME", False);
-	netatom[NetWMState]            = XInternAtom(dpy, "_NET_WM_STATE", False);
-	netatom[NetWMCheck]            = XInternAtom(dpy, "_NET_SUPPORTING_WM_CHECK", False);
-	netatom[NetWMFullscreen]       = XInternAtom(dpy, "_NET_WM_STATE_FULLSCREEN", False);
-	netatom[NetWMWindowType]       = XInternAtom(dpy, "_NET_WM_WINDOW_TYPE", False);
-	netatom[NetWMWindowOpacity]    = XInternAtom(dpy, "_NET_WM_WINDOW_OPACITY", False);
-	netatom[NetWMWindowTypeDialog] = XInternAtom(dpy, "_NET_WM_WINDOW_TYPE_DIALOG", False);
-	netatom[NetClientList]         = XInternAtom(dpy, "_NET_CLIENT_LIST", False);
-
-	/* init cursors */
-	cursor[MouseNormal] = drw_cur_create(drw, XC_left_ptr);
-	cursor[MouseResize] = drw_cur_create(drw, XC_sizing);
-	cursor[MouseMove]   = drw_cur_create(drw, XC_fleur);
-
-	/* init appearance */
-	scheme = ecalloc(arrlen(colors), sizeof(Clr *));
-	for (i = 0; i < arrlen(colors); i++)
-		scheme[i] = drw_scm_create(drw, colors[i], 3);
-
-	/* init bars */
-	updatebars();
-	updatestatus();
-
-	/* supporting window for NetWMCheck */
-	wmcheckwin = XCreateSimpleWindow(dpy, root, 0, 0, 1, 1, 0, 0, 0);
-	XChangeProperty(dpy, wmcheckwin, netatom[NetWMCheck], XA_WINDOW, 32,
-		PropModeReplace, (uchar *) &wmcheckwin, 1);
-	XChangeProperty(dpy, wmcheckwin, netatom[NetWMName], utf8string, 8,
-		PropModeReplace, (uchar *) "dwm", 3);
-	XChangeProperty(dpy, root, netatom[NetWMCheck], XA_WINDOW, 32,
-		PropModeReplace, (uchar *) &wmcheckwin, 1);
-	/* EWMH support per view */
-	XChangeProperty(dpy, root, netatom[NetSupported], XA_ATOM, 32,
-		PropModeReplace, (uchar *) netatom, NetLast);
-	XDeleteProperty(dpy, root, netatom[NetClientList]);
-	/* select events */
-	wa.cursor = cursor[MouseNormal]->cursor;
-	wa.event_mask = SubstructureRedirectMask|SubstructureNotifyMask
-		|ButtonPressMask|PointerMotionMask|EnterWindowMask
-		|LeaveWindowMask|StructureNotifyMask|PropertyChangeMask;
-	XChangeWindowAttributes(dpy, root, CWEventMask|CWCursor, &wa);
-	XSelectInput(dpy, root, wa.event_mask);
-	grabkeys();
-	focus(nil);
-}
-
-
-void
-sigchld(int unused)
-{
-	if (signal(SIGCHLD, sigchld) == SIG_ERR)
-		fatal("can't install SIGCHLD handler:");
-	while (0 < waitpid(-1, nil, WNOHANG));
-}
-
-Client *
-swallowing(Window w)
-{
-	Client *c;
-	Monitor *m;
-
-	for (m = mons; m; m = m->next) {
-		for (c = m->clients; c; c = c->next) {
-			if (c->swallowing && c->swallowing->win == w)
-				return c;
-		}
-	}
-
-	return nil;
-}
-
-void
-tile(Monitor *m)
-{
-	uint i, n, h, r, mw, my, ty;
-	Client *c;
-
-	for (n = 0, c = nexttiled(m->clients); c; c = nexttiled(c->next), n++)
-        ;
-
-	if (n == 0)
-		return;
-
-	if (n > m->nmaster)
-		mw = m->nmaster ? (m->ww+gapx) * m->mfact : 0;
-	else
-		mw = m->ww - gapx;
-
-	for (i = 0, my = ty = gapx, c = nexttiled(m->clients); c; c = nexttiled(c->next), i++)
-		if (i < m->nmaster) {
-            r = MIN(n, m->nmaster) - i;
-			h = (m->wh - my)/r - gapx;
-			resize(c, m->wx + gapx, m->wy + my, mw - (2*c->bw) - gapx, h - (2*c->bw), 0);
-			if (my + HEIGHT(c) + gapx < m->wh)
-				my += HEIGHT(c) + gapx;
-		} else {
-            r = (n-i);
-			h = (m->wh - ty)/r - gapx;
-			resize(c, m->wx + mw + gapx, m->wy + ty, m->ww - mw - (2*c->bw) - (2*gapx), h - (2*c->bw), 0);
-			if (ty + HEIGHT(c) + gapx < m->wh)
-				ty += HEIGHT(c) + gapx;
-		}
-}
-
-void
-unmapnotify(XEvent *e)
-{
-	Client *c;
-	XUnmapEvent *ev = &e->xunmap;
-
-	if ((c = wintoclient(ev->window))) {
-		if (ev->send_event)
-			setclientstate(c, WithdrawnState);
-		else
-			unmanage(c, 0);
-	}
-}
-
-void
-updatebars(void)
-{
-	Monitor *m;
-	XSetWindowAttributes wa = {
-		.override_redirect = True,
-		.background_pixmap = ParentRelative,
-		.event_mask = ButtonPressMask|ExposureMask
-	};
-	XClassHint ch = {"dwm", "dwm"};
-	for (m = mons; m; m = m->next) {
-		if (m->barwin)
-			continue;
-		m->barwin = XCreateWindow(dpy, root, m->wx, m->by, m->ww, bh, 0, DefaultDepth(dpy, screen),
-				CopyFromParent, DefaultVisual(dpy, screen),
-				CWOverrideRedirect|CWBackPixmap|CWEventMask, &wa);
-		XDefineCursor(dpy, m->barwin, cursor[MouseNormal]->cursor);
-		XMapRaised(dpy, m->barwin);
-		XSetClassHint(dpy, m->barwin, &ch);
-	}
-}
-
-void
-updatebarpos(Monitor *m)
-{
-	m->wy = m->my;
-	m->wh = m->mh;
-	if (m->showbar) {
-		m->wh -= bh;
-		m->by = m->topbar ? m->wy : m->wy + m->wh;
-		m->wy = m->topbar ? m->wy + bh : m->wy;
-	} else
-		m->by = -bh;
-}
-
-void
-updateclientlist()
-{
-	Client *c;
-	Monitor *m;
-
-	XDeleteProperty(dpy, root, netatom[NetClientList]);
-	for (m = mons; m; m = m->next)
-		for (c = m->clients; c; c = c->next)
-			XChangeProperty(dpy, root, netatom[NetClientList],
-				XA_WINDOW, 32, PropModeAppend,
-				(unsigned char *) &(c->win), 1);
-}
-
-int
-updategeom(void)
-{
-	int dirty = 0;
-
-	if (XineramaIsActive(dpy)) {
-		int i, j, n, nn;
-		Client *c;
-		Monitor *m;
-		XineramaScreenInfo *info = XineramaQueryScreens(dpy, &nn);
-		XineramaScreenInfo *unique = nil;
-
-		for (n = 0, m = mons; m; m = m->next, n++);
-		/* only consider unique geometries as separate screens */
-		unique = ecalloc(nn, sizeof(XineramaScreenInfo));
-		for (i = 0, j = 0; i < nn; i++)
-			if (isuniquegeom(unique, j, &info[i]))
-				memcpy(&unique[j++], &info[i], sizeof(XineramaScreenInfo));
-		XFree(info);
-		nn = j;
-		if (n <= nn) { /* new monitors available */
-			for (i = 0; i < (nn - n); i++) {
-				for (m = mons; m && m->next; m = m->next);
-				if (m)
-					m->next = createmon();
-				else
-					mons = createmon();
-			}
-			for (i = 0, m = mons; i < nn && m; m = m->next, i++)
-				if (i >= n
-				|| unique[i].x_org != m->mx || unique[i].y_org != m->my
-				|| unique[i].width != m->mw || unique[i].height != m->mh)
-				{
-					dirty  = 1;
-					m->num = i;
-					m->mx = m->wx = unique[i].x_org;
-					m->my = m->wy = unique[i].y_org;
-					m->mw = m->ww = unique[i].width;
-					m->mh = m->wh = unique[i].height;
-					updatebarpos(m);
-				}
-		} else { /* less monitors available nn < n */
-			for (i = nn; i < n; i++) {
-				for (m = mons; m && m->next; m = m->next);
-				while ((c = m->clients)) {
-					dirty = 1;
-					m->clients = c->next;
-					detachstack(c);
-					c->mon = mons;
-					/* attach(c); */
-                    attachbottom(c);
-					attachstack(c);
-				}
-				if (m == selmon)
-					selmon = mons;
-				cleanupmon(m);
-			}
-		}
-		free(unique);
-	} else
-	{ /* default monitor setup */
-		if (!mons)
-			mons = createmon();
-		if (mons->mw != sw || mons->mh != sh) {
-			dirty = 1;
-			mons->mw = mons->ww = sw;
-			mons->mh = mons->wh = sh;
-			updatebarpos(mons);
-		}
-	}
-	if (dirty) {
-		selmon = mons;
-		selmon = wintomon(root);
-	}
-	return dirty;
-}
-
-void
-updatenumlockmask(void)
-{
-	uint i, j;
-	XModifierKeymap *modmap;
-
-	numlockmask = 0;
-	modmap = XGetModifierMapping(dpy);
-	for (i = 0; i < 8; i++)
-		for (j = 0; j < modmap->max_keypermod; j++)
-			if (modmap->modifiermap[i * modmap->max_keypermod + j]
-				== XKeysymToKeycode(dpy, XK_Num_Lock))
-				numlockmask = (1 << i);
-	XFreeModifiermap(modmap);
-}
-
-void
-updatestatus(void)
-{
-	if (!gettextprop(root, XA_WM_NAME, stext, sizeof(stext)))
-		strcpy(stext, "dwm-"VERSION);
-	drawbar(selmon);
-}
-
-pid_t
-winpid(Window w)
-{
-	pid_t result = 0;
-
-	xcb_res_client_id_spec_t spec = {0};
-	spec.client = w;
-	spec.mask = XCB_RES_CLIENT_ID_MASK_LOCAL_CLIENT_PID;
-
-	xcb_generic_error_t *e = NULL;
-	xcb_res_query_client_ids_cookie_t c = xcb_res_query_client_ids(xcon, 1, &spec);
-	xcb_res_query_client_ids_reply_t *r = xcb_res_query_client_ids_reply(xcon, c, &e);
-
-	if (!r)
-		return (pid_t)0;
-
-	xcb_res_client_id_value_iterator_t i = xcb_res_query_client_ids_ids_iterator(r);
-	for (; i.rem; xcb_res_client_id_value_next(&i)) {
-		spec = i.data->spec;
-		if (spec.mask & XCB_RES_CLIENT_ID_MASK_LOCAL_CLIENT_PID) {
-			uint32_t *t = xcb_res_client_id_value_value(i.data);
-			result = *t;
-			break;
-		}
-	}
-
-	free(r);
-
-	if (result == (pid_t)-1)
-		result = 0;
-
-	return result;
-}
-
-Client *
-wintoclient(Window w)
-{
-	Client *c;
-	Monitor *m;
-
-	for (m = mons; m; m = m->next)
-		for (c = m->clients; c; c = c->next)
-			if (c->win == w)
-				return c;
-	return nil;
-}
-
-Monitor *
-wintomon(Window w)
-{
-	int x, y;
-	Client *c;
-	Monitor *m;
-
-	if (w == root && getrootptr(&x, &y))
-		return recttomon(x, y, 1, 1);
-	for (m = mons; m; m = m->next)
-		if (w == m->barwin)
-			return m;
-	if ((c = wintoclient(w)))
-		return c->mon;
-	return selmon;
-}
-
-/* There's no way to check accesses to destroyed windows, thus those cases are
- * ignored (especially on UnmapNotify's). Other types of errors call Xlibs
- * default error handler, which may call exit. */
-int
-xerror(Display *dpy, XErrorEvent *ee)
-{
-	if (ee->error_code == BadWindow
-	|| (ee->request_code == X_SetInputFocus && ee->error_code == BadMatch)
-	|| (ee->request_code == X_PolyText8 && ee->error_code == BadDrawable)
-	|| (ee->request_code == X_PolyFillRectangle && ee->error_code == BadDrawable)
-	|| (ee->request_code == X_PolySegment && ee->error_code == BadDrawable)
-	|| (ee->request_code == X_ConfigureWindow && ee->error_code == BadMatch)
-	|| (ee->request_code == X_GrabButton && ee->error_code == BadAccess)
-	|| (ee->request_code == X_GrabKey && ee->error_code == BadAccess)
-	|| (ee->request_code == X_CopyArea && ee->error_code == BadDrawable))
-		return 0;
-	fprintf(stderr, "dwm: fatal error: request code=%d, error code=%d\n",
-		ee->request_code, ee->error_code);
-	return xerrorxlib(dpy, ee); /* may call exit */
-}
-
-int
-xerrordummy(Display *dpy, XErrorEvent *ee)
-{
-	return 0;
-}
-
-/* Startup Error handler to check if another window manager
- * is already running. */
-int
-xerrorstart(Display *dpy, XErrorEvent *ee)
-{
-	fatal("dwm: another window manager is already running");
-	return -1;
-}
-
-int
-main(int argc, char *argv[])
-{
-	if (argc == 2 && !strcmp("-v", argv[1]))
-		fatal("dwm-"VERSION);
-	else if (argc != 1)
-		fatal("usage: dwm [-v]");
-	if (!setlocale(LC_CTYPE, "") || !XSupportsLocale())
-		fputs("warning: no locale support\n", stderr);
-	if (!(dpy = XOpenDisplay(nil)))
-		fatal("dwm: cannot open display");
-    if (!(xcon = XGetXCBConnection(dpy)))
-        fatal("dwm: cannot get xcb connection");
-
-	checkotherwm();
-	setup();
-
-#ifdef __OpenBSD__
-	if (pledge("stdio rpath proc exec", nil) == -1)
-		fatal("pledge");
-#endif /* __OpenBSD__ */
-
-	scan();
-	run();
-	cleanup();
-
-	XCloseDisplay(dpy);
-	return 0;
-}
diff --git a/sys/cmd/dwm/dwm.h b/sys/cmd/dwm/dwm.h
deleted file mode 100644
index afec1f2..0000000
--- a/sys/cmd/dwm/dwm.h
+++ /dev/null
@@ -1,384 +0,0 @@
-/* See LICENSE file for copyright and license details. */
-#pragma once
-#include <u.h>
-#include <base.h>
-#include <libutf.h>
-
-#include <errno.h>
-#include <locale.h>
-#include <signal.h>
-#include <stdarg.h>
-#include <stdio.h>
-#include <stdlib.h>
-#include <string.h>
-#include <unistd.h>
-#include <sys/types.h>
-#include <sys/wait.h>
-
-#include <X11/cursorfont.h>
-#include <X11/Xatom.h>
-#include <X11/Xlib.h>
-#include <X11/XKBlib.h>
-#include <X11/Xproto.h>
-#include <X11/Xutil.h>
-#include <X11/Xlib-xcb.h>
-#include <xcb/res.h>
-#include <X11/extensions/Xinerama.h>
-#include <X11/Xft/Xft.h>
-#include <X11/XF86keysym.h>
-
-/* macros */
-#define BUTTONMASK              (ButtonPressMask|ButtonReleaseMask)
-#define CLEANMASK(mask)         (mask & ~(numlockmask|LockMask) & (ShiftMask|ControlMask|Mod1Mask|Mod2Mask|Mod3Mask|Mod4Mask|Mod5Mask))
-#define INTERSECT(x,y,w,h,m)    (MAX(0, MIN((x)+(w),(m)->wx+(m)->ww) - MAX((x),(m)->wx)) \
-                               * MAX(0, MIN((y)+(h),(m)->wy+(m)->wh) - MAX((y),(m)->wy)))
-#define ISVISIBLE(C)            ((C->tags & C->mon->tagset[C->mon->seltags]))
-#define MOUSEMASK               (BUTTONMASK|PointerMotionMask)
-#define WIDTH(X)                ((X)->w + 2 * (X)->bw)
-#define HEIGHT(X)               ((X)->h + 2 * (X)->bw)
-#define TAGMASK                 ((1 << arrlen(tags)) - 1)
-#define TEXTW(X)                (drw_fontset_getwidth(drw, (X)) + lrpad)
-#define BETWEEN(X, A, B)        ((A) <= (X) && (X) <= (B))
-
-
-/* enums */
-enum 
-{
-    MouseNormal, 
-    MouseResize, 
-    MouseMove, 
-    MouseLast,
-}; /* mouse states */ 
-
-enum 
-{ 
-    SchemeNorm, 
-    SchemeSel 
-}; /* color schemes */ 
-
-enum 
-{ 
-    NetSupported, 
-    NetWMName, 
-    NetWMState, 
-    NetWMCheck,
-    NetWMFullscreen, 
-    NetActiveWindow, 
-    NetWMWindowType,
-    NetWMWindowTypeDialog, 
-    NetWMWindowOpacity,
-    NetClientList, 
-    NetLast 
-}; /* EWMH atoms */
-
-enum 
-{ 
-    WMProtocols, 
-    WMDelete, 
-    WMState, 
-    WMTakeFocus, 
-    WMLast 
-}; /* default atoms */
-
-enum 
-{ 
-    ClkTagBar, 
-    ClkLtSymbol, 
-    ClkStatusText, 
-    ClkWinTitle,
-    ClkClientWin, 
-    ClkRootWin, 
-    ClkLast 
-}; /* clicks */
-
-enum 
-{ 
-    ColFg, 
-    ColBg, 
-    ColBorder 
-}; /* color scheme index */
-
-typedef struct Monitor  Monitor;
-typedef struct Layout   Layout;
-typedef struct Client   Client;
-typedef struct Keyboard Keyboard;
-typedef struct Button   Button;
-typedef struct Key      Key;
-typedef struct Rule     Rule;
-typedef union  Arg      Arg;
-
-union Arg {
-	int i;
-	uint ui;
-	float f;
-	void *v;
-};
-
-struct Button {
-	uint click;
-	uint mask;
-	uint button;
-	void (*func)(Arg *arg);
-	Arg arg;
-};
-
-struct Client {
-	char name[256];
-	float mina, maxa;
-	int  x, y, w, h;
-	int  oldx, oldy, oldw, oldh;
-	int  basew, baseh, incw, inch, maxw, maxh, minw, minh;
-	int  bw, oldbw;
-	uint tags;
-	int  isfixed, isfloating, isurgent, neverfocus, oldstate, isfullscreen, isterm, noswallow;
-    pid_t pid;
-	Client  *next;
-	Client  *snext;
-    Client  *swallowing;
-	Monitor *mon;
-	Window   win;
-};
-
-struct Key {
-	uint mod;
-	KeySym keysym;
-	void (*func)(Arg *);
-	Arg arg;
-};
-
-struct Layout {
-	char *symbol;
-	void (*arrange)(Monitor *);
-};
-
-struct Monitor {
-	char ltsymbol[16];
-	float mfact;
-	int nmaster;
-	int num;
-	int by;               /* bar geometry */
-	int mx, my, mw, mh;   /* screen size */
-	int wx, wy, ww, wh;   /* window area  */
-	uint seltags;
-	uint sellt;
-	uint tagset[2];
-	int showbar;
-	int topbar;
-	Client *clients;
-	Client *sel;
-	Client *stack;
-	Monitor *next;
-	Window barwin;
-	Layout *lt[2];
-};
-
-struct Rule {
-	char *class;
-	char *instance;
-	char *title;
-	uint tags;
-	int isfloating;
-    int isterm;
-    int noswallow;
-	int monitor;
-};
-
-/* draw.c */
-typedef struct {
-    Cursor cursor;
-} Cur;
-
-typedef struct Fnt {
-	Display  *dpy;
-	uint      h;
-	XftFont   *xfont;
-	FcPattern *pattern;
-	struct Fnt *next;
-} Fnt;
-
-typedef XftColor Clr;
-
-typedef struct {
-	uint w, h;
-	Display *dpy;
-	int      screen;
-	Window   root;
-	Drawable drawable;
-	GC       gc;
-	Clr     *scheme;
-	Fnt     *fonts;
-} Drw;
-
-/* global state */
-
-extern char broken[];
-extern char stext[256];
-extern int scanner;
-extern int screen;
-extern int sw, sh;           
-extern int bh, blw;
-extern int lrpad;
-extern int (*xerrorxlib)(Display *, XErrorEvent *);
-extern uint numlockmask;
-extern void (*handler[LASTEvent]) (XEvent *);
-extern int scratchtag;
-
-extern xcb_connection_t *xcon;
-
-extern Atom wmatom[WMLast], netatom[NetLast];
-extern int running; 
-extern Cur   *cursor[MouseLast]; 
-extern Clr **scheme; 
-extern Display *dpy; 
-extern Drw *drw; 
-extern Monitor *mons, *selmon;
-extern Window root, wmcheckwin;
-
-// -----------------------------------------------------------------------
-// function declarations
-
-// TODO: remove declarations that don't require global existence...
-void     applyrules(Client *c);
-int      applysizehints(Client *c, int *x, int *y, int *w, int *h, int interact);
-void     arrange(Monitor *m);
-void     arrangemon(Monitor *m);
-void     attach(Client *c);
-void     enqueue(Client *c);
-void     attachbottom(Client *c);
-void     attachstack(Client *c);
-void     enqueuestack(Client *c);
-void     buttonpress(XEvent *e);
-void     checkotherwm(void);
-void     cleanup(void);
-void     cleanupmon(Monitor *mon);
-void     clientmessage(XEvent *e);
-void     configure(Client *c);
-void     configurenotify(XEvent *e);
-void     configurerequest(XEvent *e);
-Monitor *createmon(void);
-void     destroynotify(XEvent *e);
-void     detach(Client *c);
-void     detachstack(Client *c);
-Monitor *dirtomon(int dir);
-void     drawbar(Monitor *m);
-void     drawbars(void);
-void     enternotify(XEvent *e);
-void     expose(XEvent *e);
-void     focus(Client *c);
-void     focusin(XEvent *e);
-void     focusmon(Arg *arg);
-void     focusstack(Arg *arg);
-void     focusdirection(Arg *arg);
-void     rotatestack(Arg *arg);
-Atom     getatomprop(Client *c, Atom prop);
-int      getrootptr(int *x, int *y);
-long     getstate(Window w);
-int      gettextprop(Window w, Atom atom, char *text, uint size);
-void     grabbuttons(Client *c, int focused);
-void     grabkeys(void);
-void     incnmaster(Arg *arg);
-void     keypress(XEvent *e);
-void     killclient(Arg *arg);
-void     manage(Window w, XWindowAttributes *wa);
-void     mappingnotify(XEvent *e);
-void     maprequest(XEvent *e);
-void     monocle(Monitor *m);
-void     motionnotify(XEvent *e);
-void     movemouse(Arg *arg);
-Client  *nexttiled(Client *c);
-void     pop(Client *);
-void     propertynotify(XEvent *e);
-void     quit(Arg *arg);
-Monitor *recttomon(int x, int y, int w, int h);
-void     resize(Client *c, int x, int y, int w, int h, int interact);
-void     resizeclient(Client *c, int x, int y, int w, int h);
-void     resizemouse(Arg *arg);
-void     restack(Monitor *m);
-void     run(void);
-void     scan(void);
-int      sendevent(Client *c, Atom proto);
-void     sendtomon(Client *c, Monitor *m);
-void     setclientstate(Client *c, long state);
-void     setfocus(Client *c);
-void     setfullscreen(Client *c, int fullscreen);
-void     setlayout(Arg *arg);
-void     setmfact(Arg *arg);
-void     setup(void);
-void     seturgent(Client *c, int urg);
-void     showhide(Client *c);
-void     sigchld(int unused);
-void     swallow(Client *p, Client *c);
-Client  *swallowing(Window w);
-void     spawn(Arg *arg);
-void     tag(Arg *arg);
-void     tagmon(Arg *arg);
-Client  *termof(Client *c);
-void     tile(Monitor *);
-void     togglebar(Arg *arg);
-void     togglefocus(Arg *arg);
-void     togglefloating(Arg *arg);
-void     togglescratch(Arg *arg);
-void     toggletag(Arg *arg);
-void     toggleview(Arg *arg);
-void     unfocus(Client *c, int setfocus);
-void     unmanage(Client *c, int destroyed);
-void     unmapnotify(XEvent *e);
-void     unswallow(Client *c);
-void     updatebarpos(Monitor *m);
-void     updatebars(void);
-void     updateclientlist(void);
-int      updategeom(void);
-void     updatenumlockmask(void);
-void     updatesizehints(Client *c);
-void     updatestatus(void);
-void     updatetitle(Client *c);
-void     updatewindowtype(Client *c);
-void     updatewmhints(Client *c);
-void     view(Arg *arg);
-pid_t    winpid(Window w);
-Client  *wintoclient(Window w);
-Monitor *wintomon(Window w);
-int      xerror(Display *dpy, XErrorEvent *ee);
-int      xerrordummy(Display *dpy, XErrorEvent *ee);
-int      xerrorstart(Display *dpy, XErrorEvent *ee);
-void     zoom(Arg *arg);
-
-#include "config.h"
-
-/* draw.c */
-
-/* Drawable abstraction */
-Drw *drw_create(Display *dpy, int screen, Window win, uint w, uint h);
-void drw_resize(Drw *drw, uint w, uint h);
-void drw_free(Drw *drw);
-
-/* Fnt abstraction */
-Fnt *drw_fontset_create(Drw* drw, char *fonts[], size_t fontcount);
-void drw_fontset_free(Fnt* set);
-uint drw_fontset_getwidth(Drw *drw, char *text);
-void drw_font_getexts(Fnt *font, char *text, uint len, uint *w, uint *h);
-
-/* Colorscheme abstraction */
-void   drw_clr_create(Drw *drw, Clr *dest, char *clrname);
-Clr *drw_scm_create(Drw *drw, char *clrnames[], size_t clrcount);
-
-/* Cursor abstraction */
-Cur *drw_cur_create(Drw *drw, int shape);
-void drw_cur_free(Drw *drw, Cur *cursor);
-
-/* Drawing context manipulation */
-void drw_setfontset(Drw *drw, Fnt *set);
-void drw_setscheme(Drw *drw, Clr *scm);
-
-/* Drawing functions */
-void drw_rect(Drw *drw, int x, int y, uint w, uint h, int filled, int invert);
-int  drw_text(Drw *drw, int x, int y, uint w, uint h, uint lpad, char *text, int invert);
-
-/* Map functions */
-void drw_map(Drw *drw, Window win, int x, int y, uint w, uint h);
-
-/* util.c */
-void  fatal(char *fmt, ...);
-void *ecalloc(size_t nmemb, size_t size);
-pid_t getparentproc(pid_t p);
-pid_t isdescendent(pid_t p, pid_t c);
diff --git a/sys/cmd/dwm/hook.c b/sys/cmd/dwm/hook.c
deleted file mode 100644
index 9758965..0000000
--- a/sys/cmd/dwm/hook.c
+++ /dev/null
@@ -1,489 +0,0 @@
-#include "dwm.h"
-
-int scratchtag = 1 << arrlen(tags);
-
-void
-focusmon(Arg *arg)
-{
-	Monitor *m;
-
-	if (!mons->next)
-		return;
-	if ((m = dirtomon(arg->i)) == selmon)
-		return;
-	unfocus(selmon->sel, 0);
-	selmon = m;
-	focus(nil);
-}
-
-void
-focusstack(Arg *arg)
-{
-	Client *c = nil, *i;
-
-	if (!selmon->sel)
-		return;
-	if (arg->i > 0) {
-		for(c = selmon->sel->next; c && !ISVISIBLE(c); c = c->next);
-		if(!c)
-			for(c = selmon->clients; c && !ISVISIBLE(c); c = c->next);
-	} else {
-		for(i = selmon->clients; i != selmon->sel; i = i->next)
-			if(ISVISIBLE(i))
-				c = i;
-		if(!c)
-			for(; i; i = i->next)
-				if (ISVISIBLE(i))
-					c = i;
-	}
-	if(c) {
-		focus(c);
-		restack(selmon);
-	}
-}
-
-void
-focusdirection(Arg *arg)
-{
-    Monitor *m;
-    Client *it, *c;
-    int x, y, cx, cy;
-
-    if(!selmon || !selmon->sel)
-        return;
-
-    c = selmon->sel;
-    x = c->x, y = c->y;
-
-    c = nil;
-    switch(arg->i) {
-    case 'l':
-        cx = INT_MIN;
-        cy = y;
-        for(m=mons; m; m=m->next) {
-            for(it=m->clients; it; it = it->next) {
-                if(ISVISIBLE(it) && (it->x < x)) {
-                    if((it->x > cx) || ((it->x == cx) && abs(y-it->y) < abs(y-cy))) {
-                        c  = it;
-                        cx = it->x;
-                        cy = it->y;
-                    }
-                }
-            }
-        }
-        break;
-
-    case 'r':
-        cx = INT_MAX;
-        cy = y;
-        for(m=mons; m; m=m->next) {
-            for(it=m->clients; it; it = it->next) {
-                if(ISVISIBLE(it) && (it->x > x)) {
-                    if((it->x < cx) || ((it->x == cx) && abs(y-it->y) < abs(y-cy))) {
-                        c  = it;
-                        cx = it->x;
-                        cy = it->y;
-                    }
-                }
-            }
-        }
-        break;
-
-    case 'u':
-        cx = x;
-        cy = INT_MIN;
-        for(m=mons; m; m=m->next) {
-            for(it=m->clients; it; it = it->next) {
-                if(ISVISIBLE(it) && (it->y < y)) {
-                    if((it->y > cy) || ((it->y == cy) && abs(x-it->x) < abs(x-cx))) {
-                        c  = it;
-                        cx = it->x;
-                        cy = it->y;
-                    }
-                }
-            }
-        }
-        break;
-
-    case 'd':
-        cx = x;
-        cy = INT_MAX;
-        for(m=mons; m; m=m->next) {
-            for(it=m->clients; it; it = it->next) {
-                if(ISVISIBLE(it) && (it->y > y)) {
-                    if((it->y < cy) || ((it->y == cy) && abs(x-it->x) < abs(x-cx))) {
-                        c  = it;
-                        cx = it->x;
-                        cy = it->y;
-                    }
-                }
-            }
-        }
-        break;
-
-    default:
-        ;
-    }
-
-    if(c) {
-        focus(c);
-        restack(selmon);
-        if(c->mon != selmon)
-            restack(c->mon);
-    }
-}
-
-void
-rotatestack(Arg *arg)
-{
-    Client *c = nil, *f;
-
-    if (!selmon->sel)
-        return;
-
-    f = selmon->sel;
-    if (arg->i > 0) {
-        for (c = nexttiled(selmon->clients); c && nexttiled(c->next); c = nexttiled(c->next))
-            ;
-
-        if (c) {
-            detach(c);
-            attach(c);
-            detachstack(c);
-            attachstack(c);
-        }
-    } else {
-        if ((c = nexttiled(selmon->clients))) {
-            detach(c);
-            enqueue(c);
-            detachstack(c);
-            enqueuestack(c);
-        }
-    }
-
-    if (c) {
-        arrange(selmon);
-        focus(f);
-        restack(selmon);
-    }
-}
-
-
-void
-incnmaster(Arg *arg)
-{
-	selmon->nmaster = MAX(selmon->nmaster + arg->i, 0);
-	arrange(selmon);
-}
-
-void
-killclient(Arg *arg)
-{
-	if (!selmon->sel)
-		return;
-	if (!sendevent(selmon->sel, wmatom[WMDelete])) {
-		XGrabServer(dpy);
-		XSetErrorHandler(xerrordummy);
-		XSetCloseDownMode(dpy, DestroyAll);
-		XKillClient(dpy, selmon->sel->win);
-		XSync(dpy, False);
-		XSetErrorHandler(xerror);
-		XUngrabServer(dpy);
-	}
-}
-
-void
-movemouse(Arg *arg)
-{
-	int x, y, ocx, ocy, nx, ny;
-	Client *c;
-	Monitor *m;
-	XEvent ev;
-	Time lasttime = 0;
-
-	if (!(c = selmon->sel))
-		return;
-	if (c->isfullscreen) /* no support moving fullscreen windows by mouse */
-		return;
-	restack(selmon);
-	ocx = c->x;
-	ocy = c->y;
-	if (XGrabPointer(dpy, root, False, MOUSEMASK, GrabModeAsync, GrabModeAsync,
-		None, cursor[MouseMove]->cursor, CurrentTime) != GrabSuccess)
-		return;
-	if (!getrootptr(&x, &y))
-		return;
-	do {
-		XMaskEvent(dpy, MOUSEMASK|ExposureMask|SubstructureRedirectMask, &ev);
-		switch(ev.type) {
-		case ConfigureRequest:
-		case Expose:
-		case MapRequest:
-			handler[ev.type](&ev);
-			break;
-		case MotionNotify:
-			if ((ev.xmotion.time - lasttime) <= (1000 / 60))
-				continue;
-			lasttime = ev.xmotion.time;
-
-			nx = ocx + (ev.xmotion.x - x);
-			ny = ocy + (ev.xmotion.y - y);
-			if (abs(selmon->wx - nx) < snap)
-				nx = selmon->wx;
-			else if (abs((selmon->wx + selmon->ww) - (nx + WIDTH(c))) < snap)
-				nx = selmon->wx + selmon->ww - WIDTH(c);
-			if (abs(selmon->wy - ny) < snap)
-				ny = selmon->wy;
-			else if (abs((selmon->wy + selmon->wh) - (ny + HEIGHT(c))) < snap)
-				ny = selmon->wy + selmon->wh - HEIGHT(c);
-			if (!c->isfloating && selmon->lt[selmon->sellt]->arrange
-			&& (abs(nx - c->x) > snap || abs(ny - c->y) > snap))
-				togglefloating(nil);
-			if (!selmon->lt[selmon->sellt]->arrange || c->isfloating)
-				resize(c, nx, ny, c->w, c->h, 1);
-			break;
-		}
-	} while (ev.type != ButtonRelease);
-	XUngrabPointer(dpy, CurrentTime);
-	if ((m = recttomon(c->x, c->y, c->w, c->h)) != selmon) {
-		sendtomon(c, m);
-		selmon = m;
-		focus(nil);
-	}
-}
-
-void
-quit(Arg *arg)
-{
-	running = 0;
-}
-
-void
-resizemouse(Arg *arg)
-{
-	int ocx, ocy, nw, nh;
-	Client *c;
-	Monitor *m;
-	XEvent ev;
-	Time lasttime = 0;
-
-	if (!(c = selmon->sel))
-		return;
-	if (c->isfullscreen) /* no support resizing fullscreen windows by mouse */
-		return;
-	restack(selmon);
-	ocx = c->x;
-	ocy = c->y;
-	if (XGrabPointer(dpy, root, False, MOUSEMASK, GrabModeAsync, GrabModeAsync,
-		None, cursor[MouseResize]->cursor, CurrentTime) != GrabSuccess)
-		return;
-	XWarpPointer(dpy, None, c->win, 0, 0, 0, 0, c->w + c->bw - 1, c->h + c->bw - 1);
-	do {
-		XMaskEvent(dpy, MOUSEMASK|ExposureMask|SubstructureRedirectMask, &ev);
-		switch(ev.type) {
-		case ConfigureRequest:
-		case Expose:
-		case MapRequest:
-			handler[ev.type](&ev);
-			break;
-		case MotionNotify:
-			if ((ev.xmotion.time - lasttime) <= (1000 / 60))
-				continue;
-			lasttime = ev.xmotion.time;
-
-			nw = MAX(ev.xmotion.x - ocx - 2 * c->bw + 1, 1);
-			nh = MAX(ev.xmotion.y - ocy - 2 * c->bw + 1, 1);
-			if (c->mon->wx + nw >= selmon->wx && c->mon->wx + nw <= selmon->wx + selmon->ww
-			&& c->mon->wy + nh >= selmon->wy && c->mon->wy + nh <= selmon->wy + selmon->wh)
-			{
-				if (!c->isfloating && selmon->lt[selmon->sellt]->arrange
-				&& (abs(nw - c->w) > snap || abs(nh - c->h) > snap))
-					togglefloating(nil);
-			}
-			if (!selmon->lt[selmon->sellt]->arrange || c->isfloating)
-				resize(c, c->x, c->y, nw, nh, 1);
-			break;
-		}
-	} while (ev.type != ButtonRelease);
-	XWarpPointer(dpy, None, c->win, 0, 0, 0, 0, c->w + c->bw - 1, c->h + c->bw - 1);
-	XUngrabPointer(dpy, CurrentTime);
-	while (XCheckMaskEvent(dpy, EnterWindowMask, &ev));
-	if ((m = recttomon(c->x, c->y, c->w, c->h)) != selmon) {
-		sendtomon(c, m);
-		selmon = m;
-		focus(nil);
-	}
-}
-
-void
-setlayout(Arg *arg)
-{
-	if (!arg || !arg->v || arg->v != selmon->lt[selmon->sellt])
-		selmon->sellt ^= 1;
-	if (arg && arg->v)
-		selmon->lt[selmon->sellt] = (Layout *)arg->v;
-	strncpy(selmon->ltsymbol, selmon->lt[selmon->sellt]->symbol, sizeof selmon->ltsymbol);
-	if (selmon->sel)
-		arrange(selmon);
-	else
-		drawbar(selmon);
-}
-
-/* arg > 1.0 will set mfact absolutely */
-void
-setmfact(Arg *arg)
-{
-	float f;
-
-	if (!arg || !selmon->lt[selmon->sellt]->arrange)
-		return;
-	f = arg->f < 1.0 ? arg->f + selmon->mfact : arg->f - 1.0;
-	if (f < 0.05 || f > 0.95)
-		return;
-	selmon->mfact = f;
-	arrange(selmon);
-}
-
-void
-spawn(Arg *arg)
-{
-    selmon->tagset[selmon->seltags] &= ~scratchtag;
-
-	if (fork() == 0) {
-		if (dpy)
-			close(ConnectionNumber(dpy));
-		setsid();
-		execvp(((char **)arg->v)[0], (char **)arg->v);
-		fprintf(stderr, "dwm: execvp %s", ((char **)arg->v)[0]);
-		perror(" failed");
-		exit(EXIT_SUCCESS);
-	}
-}
-
-void
-tag(Arg *arg)
-{
-	if (selmon->sel && arg->ui & TAGMASK) {
-		selmon->sel->tags = arg->ui & TAGMASK;
-		focus(nil);
-		arrange(selmon);
-	}
-}
-
-void
-tagmon(Arg *arg)
-{
-	if (!selmon->sel || !mons->next)
-		return;
-	sendtomon(selmon->sel, dirtomon(arg->i));
-}
-
-void
-togglebar(Arg *arg)
-{
-	selmon->showbar = !selmon->showbar;
-	updatebarpos(selmon);
-	XMoveResizeWindow(dpy, selmon->barwin, selmon->wx, selmon->by, selmon->ww, bh);
-	arrange(selmon);
-}
-
-void
-togglefloating(Arg *arg)
-{
-	if (!selmon->sel)
-		return;
-	if (selmon->sel->isfullscreen) /* no support for fullscreen windows */
-		return;
-	selmon->sel->isfloating = !selmon->sel->isfloating || selmon->sel->isfixed;
-	if (selmon->sel->isfloating)
-		resize(selmon->sel, selmon->sel->x, selmon->sel->y,
-			selmon->sel->w, selmon->sel->h, 0);
-	arrange(selmon);
-}
-
-void
-togglescratch(Arg *arg)
-{
-    Client *c;
-    uint f = 0;
-
-    for(c = selmon->clients; c && !(f = (c->tags & scratchtag)); c = c->next)
-        ;
-
-    if(f) {
-        f = selmon->tagset[selmon->seltags] ^ scratchtag;
-        if(f) {
-            selmon->tagset[selmon->seltags] = f;
-            focus(nil);
-            arrange(selmon);
-        }
-        if(ISVISIBLE(c)) {
-            focus(c);
-            restack(selmon);
-        }
-    } else
-        spawn(arg);
-
-}
-
-void
-toggletag(Arg *arg)
-{
-	uint newtags;
-	if (!selmon->sel)
-		return;
-
-	newtags = selmon->sel->tags ^ (arg->ui & TAGMASK);
-	if (newtags) {
-		selmon->sel->tags = newtags;
-		focus(nil);
-        arrange(selmon);
-	}
-}
-
-void
-togglefocus(Arg *arg)
-{
-    if (selmon->sel)
-        setfullscreen(selmon->sel, !selmon->sel->isfullscreen);
-
-    togglebar(arg);
-}
-
-void
-toggleview(Arg *arg)
-{
-	uint newtagset = selmon->tagset[selmon->seltags] ^ (arg->ui & TAGMASK);
-
-	if (newtagset) {
-		selmon->tagset[selmon->seltags] = newtagset;
-		focus(nil);
-		arrange(selmon);
-	}
-}
-
-void
-view(Arg *arg)
-{
-	if ((arg->ui & TAGMASK) == selmon->tagset[selmon->seltags])
-		return;
-	selmon->seltags ^= 1; /* toggle sel tagset */
-	if (arg->ui & TAGMASK)
-		selmon->tagset[selmon->seltags] = arg->ui & TAGMASK;
-	focus(nil);
-	arrange(selmon);
-}
-
-void
-zoom(Arg *arg)
-{
-	Client *c = selmon->sel;
-
-	if (!selmon->lt[selmon->sellt]->arrange
-	|| (selmon->sel && selmon->sel->isfloating))
-		return;
-	if (c == nexttiled(selmon->clients))
-		if (!c || !(c = nexttiled(c->next)))
-			return;
-	pop(c);
-}
diff --git a/sys/cmd/dwm/rules.mk b/sys/cmd/dwm/rules.mk
deleted file mode 100644
index 79c4548..0000000
--- a/sys/cmd/dwm/rules.mk
+++ /dev/null
@@ -1,28 +0,0 @@
-include share/push.mk
-# Iterate through subdirectory tree
-
-# Local sources
-SRCS_$(d) :=    \
-	$(d)/drw.c  \
-	$(d)/hook.c \
-	$(d)/client.c \
-	$(d)/util.c \
-	$(d)/dwm.c  
-BINS_$(d) := $(d)/dwm
-
-include share/paths.mk
-
-# Local rules
-include share/dynamic.mk
-$(BINS_$(d)): TCFLAGS = \
-			`$(PKG) --cflags fontconfig` \
-			`$(PKG) --cflags freetype2`
-$(BINS_$(d)): TCLIBS = \
-	`$(PKG) --libs fontconfig` \
-    `$(PKG) --libs freetype2`  \
-	-lX11 -lXinerama -lXft -lX11-xcb -lxcb -lxcb-res
-
-$(BINS_$(d)): $(OBJS_$(d))  $(OBJ_DIR)/sys/libutf/libutf.a $(OBJ_DIR)/sys/base/base.a
-	$(COMPLINK)
-
-include share/pop.mk
diff --git a/sys/cmd/dwm/util.c b/sys/cmd/dwm/util.c
deleted file mode 100644
index 0db71cc..0000000
--- a/sys/cmd/dwm/util.c
+++ /dev/null
@@ -1,66 +0,0 @@
-/* See LICENSE file for copyright and license details. */
-#include "dwm.h"
-
-void
-fatal(char *fmt, ...) {
-    va_list args;
-
-    va_start(args, fmt);
-    vfprintf(stderr, fmt, args);
-    va_end(args);
-
-    if(fmt[0] && fmt[strlen(fmt)-1] == ':') {
-        fputc(' ', stderr);
-        perror(NULL);
-    } else {
-        fputc('\n', stderr);
-    }
-
-    exit(1);
-}
-
-void *
-ecalloc(size_t nmemb, size_t size)
-{
-	void *p;
-
-	if (!(p = calloc(nmemb, size)))
-		fatal("calloc:");
-	return p;
-}
-
-pid_t
-getparentprocess(pid_t p)
-{
-	uint v = 0;
-
-#if defined(__linux__)
-	io·Stream *f;
-	char buf[256];
-	snprintf(buf, sizeof(buf) - 1, "/proc/%u/stat", (unsigned)p);
-
-	if (!(f = fopen(buf, "r")))
-		return (pid_t)0;
-
-	if (fscanf(f, "%*u %*s %*c %u", (unsigned *)&v) != 1)
-		v = (pid_t)0;
-	fclose(f);
-#elif defined(__FreeBSD__)
-	struct kinfo_proc *proc = kinfo_getproc(p);
-	if (!proc)
-		return (pid_t)0;
-
-	v = proc->ki_ppid;
-	free(proc);
-#endif
-	return (pid_t)v;
-}
-
-int
-isdescendent(pid_t p, pid_t c)
-{
-	while (p != c && c != 0)
-		c = getparentprocess(c);
-
-	return (int)c;
-}
diff --git a/sys/cmd/filter/filter.c b/sys/cmd/filter/filter.c
deleted file mode 100644
index abc9a88..0000000
--- a/sys/cmd/filter/filter.c
+++ /dev/null
@@ -1,104 +0,0 @@
-/* See LICENSE file for copyright and license details. */
-#include <u.h>
-#include <base.h>
-
-#include <dirent.h>
-#include <sys/stat.h>
-
-#define FLAG(x)  (flag[(x)-'a'])
-
-static void filter(const char *, const char *);
-static void usage(void);
-
-static int match = 0;
-static int flag[26];
-static struct stat old, new;
-
-static 
-void
-filter(const char *path, const char *name)
-{
-	struct stat st, ln;
-
-	if ((!stat(path, &st) && (FLAG('a') || name[0] != '.')        /* hidden files      */
-	&& (!FLAG('b') || S_ISBLK(st.st_mode))                        /* block special     */
-	&& (!FLAG('c') || S_ISCHR(st.st_mode))                        /* character special */
-	&& (!FLAG('d') || S_ISDIR(st.st_mode))                        /* directory         */
-	&& (!FLAG('e') || access(path, F_OK) == 0)                    /* exists            */
-	&& (!FLAG('f') || S_ISREG(st.st_mode))                        /* regular file      */
-	&& (!FLAG('g') || st.st_mode & S_ISGID)                       /* set-group-id flag */
-	&& (!FLAG('h') || (!lstat(path, &ln) && S_ISLNK(ln.st_mode))) /* symbolic link     */
-	&& (!FLAG('n') || st.st_mtime > new.st_mtime)                 /* newer than file   */
-	&& (!FLAG('o') || st.st_mtime < old.st_mtime)                 /* older than file   */
-	&& (!FLAG('p') || S_ISFIFO(st.st_mode))                       /* named pipe        */
-	&& (!FLAG('r') || access(path, R_OK) == 0)                    /* readable          */
-	&& (!FLAG('s') || st.st_size > 0)                             /* not empty         */
-	&& (!FLAG('u') || st.st_mode & S_ISUID)                       /* set-user-id flag  */
-	&& (!FLAG('w') || access(path, W_OK) == 0)                    /* writable          */
-	&& (!FLAG('x') || access(path, X_OK) == 0)) != FLAG('v')) {   /* executable        */
-		if (FLAG('q'))
-			exit(0);
-		match = 1;
-		puts(name);
-	}
-}
-
-static void
-usage(void)
-{
-	fprintf(stderr, "usage: %s [-abcdefghlpqrsuvwx] "
-	        "[-n file] [-o file] [file...]\n", argv0);
-	exit(2); /* like test(1) return > 1 on error */
-}
-
-int
-main(int argc, char *argv[])
-{
-	struct dirent *d;
-	char path[PATH_MAX], *line = NULL, *file;
-	size_t linesiz = 0;
-	ssize_t n;
-	DIR *dir;
-	int r;
-
-	ARGBEGIN {
-	case 'n': /* newer than file */
-	case 'o': /* older than file */
-		file = EARGF(usage());
-		if (!(FLAG(ARGC()) = !stat(file, (ARGC() == 'n' ? &new : &old))))
-			perror(file);
-		break;
-	default:
-		/* miscellaneous operators */
-		if (strchr("abcdefghlpqrsuvwx", ARGC()))
-			FLAG(ARGC()) = 1;
-		else
-			usage(); /* unknown flag */
-	} ARGEND;
-
-	if (!argc) {
-		/* read list from stdin */
-		while ((n = getline(&line, &linesiz, stdin)) > 0) {
-			if (n && line[n - 1] == '\n')
-				line[n - 1] = '\0';
-			filter(line, line);
-		}
-		free(line);
-	} else {
-		for (; argc; argc--, argv++) {
-			if (FLAG('l') && (dir = opendir(*argv))) {
-				/* filter directory contents */
-				while ((d = readdir(dir))) {
-					r = snprintf(path, sizeof path, "%s/%s",
-					             *argv, d->d_name);
-					if (r >= 0 && (size_t)r < sizeof path)
-						filter(path, d->d_name);
-				}
-				closedir(dir);
-			} else {
-				filter(*argv, *argv);
-			}
-		}
-	}
-	return match ? 0 : 1;
-}
diff --git a/sys/cmd/filter/rules.mk b/sys/cmd/filter/rules.mk
deleted file mode 100644
index 31bb257..0000000
--- a/sys/cmd/filter/rules.mk
+++ /dev/null
@@ -1,13 +0,0 @@
-include share/push.mk
-
-# Local sources
-SRCS_$(d) := $(d)/filter.c
-BINS_$(d) := $(d)/filter
-
-include share/paths.mk
-
-# Local rules
-$(BINS_$(d)): $(OBJS_$(d)) $(OBJ_DIR)/sys/base/base.a
-	$(COMPLINK)
-
-include share/pop.mk
diff --git a/sys/cmd/ic/LICENSE b/sys/cmd/ic/LICENSE
deleted file mode 100644
index a5816a8..0000000
--- a/sys/cmd/ic/LICENSE
+++ /dev/null
@@ -1,23 +0,0 @@
-MIT/X Consortium License
-
-(C)opyright 2014-2018 Hiltjo Posthuma <hiltjo at codemadness dot org>
-(C)opyright 2005-2006 Anselm R. Garbe <garbeam@wmii.de>
-(C)opyright 2005-2011 Nico Golde <nico at ngolde dot de>
-
-Permission is hereby granted, free of charge, to any person obtaining a
-copy of this software and associated documentation files (the "Software"),
-to deal in the Software without restriction, including without limitation
-the rights to use, copy, modify, merge, publish, distribute, sublicense,
-and/or sell copies of the Software, and to permit persons to whom the
-Software is furnished to do so, subject to the following conditions:
-
-The above copyright notice and this permission notice shall be included in
-all copies or substantial portions of the Software.
-
-THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.  IN NO EVENT SHALL
-THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
-FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
-DEALINGS IN THE SOFTWARE.
diff --git a/sys/cmd/ic/ic.1 b/sys/cmd/ic/ic.1
deleted file mode 100644
index 3302dad..0000000
--- a/sys/cmd/ic/ic.1
+++ /dev/null
@@ -1,100 +0,0 @@
-.TH II 1 ic\-VERSION
-.SH NAME
-ic \- irc it or irc improved
-.SH DESCRIPTION
-.B ic
-is a minimalistic FIFO and filesystem based IRC client.
-It creates an irc directory tree with server, channel and
-nick name directories.
-In every directory a FIFO file (in) and normal file (out)
-is placed. This will be for example ~/irc/irc.freenode.net/.
-The in file is used to communicate with the servers and the out
-files includes the server messages. For every channel and every nick
-name there will be new in and out files.
-The basic idea of this is to be able to communicate with an IRC
-server with basic command line tools.
-For example if you will join a channel just do echo "/j #channel" > in
-and ic creates a new channel directory with in and out file.
-.SH SYNOPSIS
-.B ic
-.RB < \-s
-.IR servername >
-.RB [ \-p
-.IR port ]
-.RB [ \-k
-.IR "environment variable" ]
-.RB [ \-i
-.IR prefix ]
-.RB [ \-n
-.IR nickname ]
-.RB [ \-f
-.IR realname ]
-.RB < \-u
-.IR sockname >
-.SH OPTIONS
-.TP
-.BI \-s " servername"
-server to connect to, for example: irc.freenode.net
-.TP
-.BI \-u " sockname"
-connect to a UNIX domain socket instead of directly to a server.
-.TP
-.BI \-p " port"
-lets you override the default port (6667)
-.TP
-.BI \-k " environment variable"
-lets you specify an environment variable that contains your IRC password, e.g. IIPASS="foobar" ic -k IIPASS.
-This is done in order to prevent other users from eavesdropping the server password via the process list.
-.TP
-.BI \-i " prefix"
-lets you override the default irc path (~/irc)
-.TP
-.BI \-n " nickname"
-lets you override the default nick ($USER)
-.TP
-.BI \-f " realname"
-lets you specify your real name associated with your nick
-.SH DIRECTORIES
-.TP
-.B ~/irc
-In this directory the irc tree will be created. In this directory you
-will find a directory for your server (default: irc.freenode.net) in
-which the FIFO and the output file will be stored.
-If you join a channel a new directory with the name of the channel
-will be created in the ~/irc/$servername/ directory.
-.SH COMMANDS
-.TP
-.BI /a " [<message>]"
-mark yourself as away
-.TP
-.BI /j " #channel/nickname [<message>]"
-join a channel or open private conversation with user
-.TP
-.BI /l " [reason]"
-leave a channel or query
-.TP
-.BI /n " nick"
-change the nick name
-.TP
-.BI /q " [reason]"
-quit ic
-.TP
-.BI /t " topic"
-set the topic of a channel
-.SH RAW COMMANDS
-.LP
-Everything which is not a command will be posted into the channel or to the server.
-So if you need /who just write /WHO as described in RFC#1459 to the server in FIFO.
-.SH SSL PROTOCOL SUPPORT
-.LP
-For TLS/SSL protocol support you can connect to a local tunnel, for example with stunnel or socat.
-.SH CONTACT
-.LP
-Subscribe to the mailinglist and write to dev (at) suckless (dot) org for suggestions, fixes, etc.
-.SH AUTHORS
-ic engineers, see LICENSE file
-.SH SEE ALSO
-.BR echo (1),
-.BR tail (1)
-.SH BUGS
-Please report them!
diff --git a/sys/cmd/ic/ic.c b/sys/cmd/ic/ic.c
deleted file mode 100644
index 7fc37d8..0000000
--- a/sys/cmd/ic/ic.c
+++ /dev/null
@@ -1,878 +0,0 @@
-/* See LICENSE file for license details. */
-#include <u.h>
-#include <base.h>
-
-#include <sys/select.h>
-#include <sys/socket.h>
-#include <sys/stat.h>
-#include <sys/types.h>
-#include <sys/un.h>
-
-#include <time.h>
-#include <signal.h>
-
-#include <netdb.h>
-#include <netinet/in.h>
-
-size_t strlcpy(char *, const char *, size_t);
-
-#define IRC_CHANNEL_MAX   200
-#define IRC_MSG_MAX       512 /* guaranteed to be <= than PIPE_BUF */
-#define PING_TIMEOUT      300
-
-enum { TOK_NICKSRV = 0, TOK_USER, TOK_CMD, TOK_CHAN, TOK_ARG, TOK_TEXT, TOK_LAST };
-
-typedef struct Channel Channel;
-struct Channel {
-	int  fdin;
-	char name[IRC_CHANNEL_MAX]; /* channel name (normalized) */
-	char inpath[PATH_MAX];      /* input path */
-	char outpath[PATH_MAX];     /* output path */
-	Channel *next;
-};
-
-static Channel * channel_add(const char *);
-static Channel * channel_find(const char *);
-static Channel * channel_join(const char *);
-static void      channel_leave(Channel *);
-static Channel * channel_new(const char *);
-static void      channel_normalize_name(char *);
-static void      channel_normalize_path(char *);
-static int       channel_open(Channel *);
-static void      channel_print(Channel *, const char *);
-static int       channel_reopen(Channel *);
-static void      channel_rm(Channel *);
-
-static void      create_dirtree(const char *);
-static void      create_filepath(char *, size_t, const char *, const char *, const char *);
-static void      ewritestr(int, const char *);
-static void      handle_channels_input(int, Channel *);
-static void      handle_server_output(int);
-static int       isnumeric(const char *);
-static void      loginkey(int, const char *);
-static void      loginuser(int, const char *, const char *);
-static void      proc_channels_input(int, Channel *, char *);
-static void      proc_channels_privmsg(int, Channel *, char *);
-static void      proc_server_cmd(int, char *);
-static int       read_line(int, char *, size_t);
-static void      run(int, const char *);
-static void      setup(void);
-static void      sighandler(int);
-static int       tcpopen(const char *, const char *);
-static size_t    tokenize(char **, size_t, char *, int);
-static int       udsopen(const char *);
-static void      usage(void);
-
-static int      isrunning = 1;
-static time_t   last_response = 0;
-static Channel *channels      = nil;
-static Channel *channelmaster = nil;
-static char     nick[32], _nick[arrlen(nick)]; /* active nickname at runtime */
-static char     ircpath[PATH_MAX]; /* irc dir (-i) */
-static char     msg[IRC_MSG_MAX];  /* message buf used for communication */
-
-static 
-void
-usage(void)
-{
-	fprintf(stderr, "usage: %s <-s host> [-i <irc dir>] [-p <port>] "
-	        "[-u <sockname>] [-n <nick>] [-k <password>] "
-	        "[-f <fullname>]\n", argv0);
-	exit(1);
-}
-
-static 
-void
-ewritestr(int fd, const char *s)
-{
-	size_t len, off = 0;
-	int w = -1;
-
-	len = strlen(s);
-	for (off = 0; off < len; off += w) {
-		if ((w = write(fd, s + off, len - off)) == -1)
-			break;
-		off += w;
-	}
-	if (w == -1) {
-		fprintf(stderr, "%s: write: %s\n", argv0, strerror(errno));
-		exit(1);
-	}
-}
-
-/* creates directories bottom-up, if necessary */
-static 
-void
-create_dirtree(const char *dir)
-{
-	char tmp[PATH_MAX], *p;
-	struct stat st;
-	size_t len;
-
-	strlcpy(tmp, dir, sizeof(tmp));
-	len = strlen(tmp);
-	if (len > 0 && tmp[len - 1] == '/')
-		tmp[len - 1] = '\0';
-
-	if ((stat(tmp, &st) != -1) && S_ISDIR(st.st_mode))
-		return; /* dir exists */
-
-	for (p = tmp + 1; *p; p++) {
-		if (*p != '/')
-			continue;
-		*p = '\0';
-		mkdir(tmp, S_IRWXU);
-		*p = '/';
-	}
-	mkdir(tmp, S_IRWXU);
-}
-
-static 
-void
-channel_normalize_path(char *s)
-{
-	for (; *s; s++) {
-		if (isalpha((unsigned char)*s))
-			*s = tolower((unsigned char)*s);
-		else if (!isdigit((unsigned char)*s) && !strchr(".#&+!-", *s))
-			*s = '_';
-	}
-}
-
-static 
-void
-channel_normalize_name(char *s)
-{
-	char *p;
-
-	while (*s == '&' || *s == '#')
-		s++;
-	for (p = s; *s; s++) {
-		if (!strchr(" ,&#\x07", *s)) {
-			*p = *s;
-			p++;
-		}
-	}
-	*p = '\0';
-}
-
-static 
-void
-create_filepath(char *filepath, size_t len, const char *path,
-	const char *channel, const char *suffix)
-{
-	int r;
-
-	if (channel[0]) {
-		r = snprintf(filepath, len, "%s/%s", path, channel);
-		if (r < 0 || (size_t)r >= len)
-			goto error;
-		create_dirtree(filepath);
-		r = snprintf(filepath, len, "%s/%s/%s", path, channel, suffix);
-		if (r < 0 || (size_t)r >= len)
-			goto error;
-	} else {
-		r = snprintf(filepath, len, "%s/%s", path, suffix);
-		if (r < 0 || (size_t)r >= len)
-			goto error;
-	}
-	return;
-
-error:
-	fprintf(stderr, "%s: path to irc directory too long\n", argv0);
-	exit(1);
-}
-
-static 
-int
-channel_open(Channel *c)
-{
-	int fd;
-	struct stat st;
-
-	/* make "in" fifo if it doesn't exist already. */
-	if (lstat(c->inpath, &st) != -1) {
-		if (!(st.st_mode & S_IFIFO))
-			return -1;
-	} else if (mkfifo(c->inpath, S_IRWXU)) {
-		return -1;
-	}
-	c->fdin = -1;
-	fd = open(c->inpath, O_RDONLY | O_NONBLOCK, 0);
-	if (fd == -1)
-		return -1;
-	c->fdin = fd;
-
-	return 0;
-}
-
-static 
-int
-channel_reopen(Channel *c)
-{
-	if (c->fdin > 2) {
-		close(c->fdin);
-		c->fdin = -1;
-	}
-	return channel_open(c);
-}
-
-static 
-Channel *
-channel_new(const char *name)
-{
-	Channel *c;
-	char channelpath[PATH_MAX];
-
-	strlcpy(channelpath, name, sizeof(channelpath));
-	channel_normalize_path(channelpath);
-
-	if (!(c = calloc(1, sizeof(Channel)))) {
-		fprintf(stderr, "%s: calloc: %s\n", argv0, strerror(errno));
-		exit(1);
-	}
-
-	strlcpy(c->name, name, sizeof(c->name));
-	channel_normalize_name(c->name);
-
-	create_filepath(c->inpath, sizeof(c->inpath), ircpath,
-	                channelpath, "in");
-	create_filepath(c->outpath, sizeof(c->outpath), ircpath,
-	                channelpath, "out");
-	return c;
-}
-
-static 
-Channel *
-channel_find(const char *name)
-{
-	Channel *c;
-	char chan[IRC_CHANNEL_MAX];
-
-	strlcpy(chan, name, sizeof(chan));
-	channel_normalize_name(chan);
-	for (c = channels; c; c = c->next) {
-		if (!strcmp(chan, c->name))
-			return c; /* already handled */
-	}
-	return nil;
-}
-
-static 
-Channel *
-channel_add(const char *name)
-{
-	Channel *c;
-
-	c = channel_new(name);
-	if (channel_open(c) == -1) {
-		fprintf(stderr, "%s: cannot create channel: %s: %s\n",
-		         argv0, name, strerror(errno));
-		free(c);
-		return nil;
-	}
-	if (!channels) {
-		channels = c;
-	} else {
-		c->next = channels;
-		channels = c;
-	}
-	return c;
-}
-
-static 
-Channel *
-channel_join(const char *name)
-{
-	Channel *c;
-
-	if (!(c = channel_find(name)))
-		c = channel_add(name);
-	return c;
-}
-
-static 
-void
-channel_rm(Channel *c)
-{
-	Channel *p;
-
-	if (channels == c) {
-		channels = channels->next;
-	} else {
-		for (p = channels; p && p->next != c; p = p->next)
-			;
-		if (p && p->next == c)
-			p->next = c->next;
-	}
-	free(c);
-}
-
-static
-void
-channel_leave(Channel *c)
-{
-	if (c->fdin > 2) {
-		close(c->fdin);
-		c->fdin = -1;
-	}
-	/* remove "in" file on leaving the channel */
-	unlink(c->inpath);
-	channel_rm(c);
-}
-
-static
-void
-loginkey(int ircfd, const char *key)
-{
-	snprintf(msg, sizeof(msg), "PASS %s\r\n", key);
-	ewritestr(ircfd, msg);
-}
-
-static 
-void
-loginuser(int ircfd, const char *host, const char *fullname)
-{
-	snprintf(msg, sizeof(msg), "NICK %s\r\nUSER %s localhost %s :%s\r\n",
-	         nick, nick, host, fullname);
-	puts(msg);
-	ewritestr(ircfd, msg);
-}
-
-static 
-int
-udsopen(const char *uds)
-{
-	struct sockaddr_un sun;
-	size_t len;
-	int fd;
-
-	if((fd = socket(AF_UNIX, SOCK_STREAM, 0)) == -1) {
-		fprintf(stderr, "%s: socket: %s\n", argv0, strerror(errno));
-		exit(1);
-	}
-
-	sun.sun_family = AF_UNIX;
-	if(strlcpy(sun.sun_path, uds, sizeof(sun.sun_path)) >= sizeof(sun.sun_path)) {
-		fprintf(stderr, "%s: UNIX domain socket path truncation\n", argv0);
-		exit(1);
-	}
-	len = strlen(sun.sun_path) + 1 + sizeof(sun.sun_family);
-	if (connect(fd, (struct sockaddr *)&sun, len) == -1) {
-		fprintf(stderr, "%s: connect: %s\n", argv0, strerror(errno));
-		exit(1);
-	}
-	return fd;
-}
-
-static 
-int
-tcpopen(const char *host, const char *service)
-{
-	struct addrinfo hints, *res = nil, *rp;
-	int fd = -1, e;
-
-	memset(&hints, 0, sizeof(hints));
-	hints.ai_family = AF_UNSPEC; /* allow IPv4 or IPv6 */
-	hints.ai_flags = AI_NUMERICSERV; /* avoid name lookup for port */
-	hints.ai_socktype = SOCK_STREAM;
-
-	if ((e = getaddrinfo(host, service, &hints, &res))) {
-		fprintf(stderr, "%s: getaddrinfo: %s\n", argv0, gai_strerror(e));
-		exit(1);
-	}
-
-	for (rp = res; rp; rp = rp->ai_next) {
-		fd = socket(rp->ai_family, rp->ai_socktype, rp->ai_protocol);
-		if (fd == -1)
-			continue;
-		if (connect(fd, rp->ai_addr, rp->ai_addrlen) == -1) {
-			close(fd);
-			fd = -1;
-			continue;
-		}
-		break; /* success */
-	}
-	if (fd == -1) {
-		fprintf(stderr, "%s: could not connect to %s:%s: %s\n",
-			argv0, host, service, strerror(errno));
-		exit(1);
-	}
-
-	freeaddrinfo(res);
-	return fd;
-}
-
-static
-int
-isnumeric(const char *s)
-{
-	errno = 0;
-	strtol(s, nil, 10);
-	return errno == 0;
-}
-
-static 
-size_t
-tokenize(char **result, size_t reslen, char *str, int delim)
-{
-	char *p = nil, *n = nil;
-	size_t i = 0;
-
-	for (n = str; *n == ' '; n++)
-		;
-	p = n;
-	while (*n != '\0') {
-		if (i >= reslen)
-			return 0;
-		if (i > TOK_CHAN - TOK_CMD && result[0] && isnumeric(result[0]))
-			delim = ':'; /* workaround non-RFC compliant messages */
-		if (*n == delim) {
-			*n = '\0';
-			result[i++] = p;
-			p = ++n;
-		} else {
-			n++;
-		}
-	}
-	/* add last entry */
-	if (i < reslen && p < n && p && *p)
-		result[i++] = p;
-	return i; /* number of tokens */
-}
-
-static 
-void
-channel_print(Channel *c, const char *buf)
-{
-	FILE *fp = nil;
-	time_t t = time(nil);
-
-	if (!(fp = fopen(c->outpath, "a")))
-		return;
-	fprintf(fp, "%lu %s\n", (unsigned long)t, buf);
-	fclose(fp);
-}
-
-static 
-void
-proc_channels_privmsg(int ircfd, Channel *c, char *buf)
-{
-	snprintf(msg, sizeof(msg), "<%s> %s", nick, buf);
-	channel_print(c, msg);
-	snprintf(msg, sizeof(msg), "PRIVMSG %s :%s\r\n", c->name, buf);
-	ewritestr(ircfd, msg);
-}
-
-static
-void
-proc_channels_input(int ircfd, Channel *c, char *buf)
-{
-	char *p = nil;
-	size_t buflen;
-
-	if (buf[0] == '\0')
-		return;
-	if (buf[0] != '/') {
-		proc_channels_privmsg(ircfd, c, buf);
-		return;
-	}
-
-	msg[0] = '\0';
-	if ((buflen = strlen(buf)) < 2)
-		return;
-	if (buf[2] == ' ' || buf[2] == '\0') {
-		switch (buf[1]) {
-		case 'j': /* join */
-			if (buflen < 3)
-				return;
-			if ((p = strchr(&buf[3], ' '))) /* password parameter */
-				*p = '\0';
-			if ((buf[3] == '#') || (buf[3] == '&') || (buf[3] == '+') ||
-				(buf[3] == '!'))
-			{
-				/* password protected channel */
-				if (p)
-					snprintf(msg, sizeof(msg), "JOIN %s %s\r\n", &buf[3], p + 1);
-				else
-					snprintf(msg, sizeof(msg), "JOIN %s\r\n", &buf[3]);
-				channel_join(&buf[3]);
-			} else if (p) {
-				if ((c = channel_join(&buf[3])))
-					proc_channels_privmsg(ircfd, c, p + 1);
-				return;
-			}
-			break;
-		case 't': /* topic */
-			if (buflen >= 3)
-				snprintf(msg, sizeof(msg), "TOPIC %s :%s\r\n", c->name, &buf[3]);
-			break;
-		case 'a': /* away */
-			if (buflen >= 3) {
-				snprintf(msg, sizeof(msg), "-!- %s is away \"%s\"", nick, &buf[3]);
-				channel_print(c, msg);
-			}
-			if (buflen >= 3)
-				snprintf(msg, sizeof(msg), "AWAY :%s\r\n", &buf[3]);
-			else
-				snprintf(msg, sizeof(msg), "AWAY\r\n");
-			break;
-		case 'n': /* change nick */
-			if (buflen >= 3) {
-				strlcpy(_nick, &buf[3], sizeof(_nick));
-				snprintf(msg, sizeof(msg), "NICK %s\r\n", &buf[3]);
-			}
-			break;
-		case 'l': /* leave */
-			if (c == channelmaster)
-				return;
-			if (buflen >= 3)
-				snprintf(msg, sizeof(msg), "PART %s :%s\r\n", c->name, &buf[3]);
-			else
-				snprintf(msg, sizeof(msg),
-				         "PART %s :leaving\r\n", c->name);
-			ewritestr(ircfd, msg);
-			channel_leave(c);
-			return;
-			break;
-		case 'q': /* quit */
-			if (buflen >= 3)
-				snprintf(msg, sizeof(msg), "QUIT :%s\r\n", &buf[3]);
-			else
-				snprintf(msg, sizeof(msg),
-				         "QUIT %s\r\n", "bye");
-			ewritestr(ircfd, msg);
-			isrunning = 0;
-			return;
-			break;
-		default: /* raw IRC command */
-			snprintf(msg, sizeof(msg), "%s\r\n", &buf[1]);
-			break;
-		}
-	} else {
-		/* raw IRC command */
-		snprintf(msg, sizeof(msg), "%s\r\n", &buf[1]);
-	}
-	if (msg[0] != '\0')
-		ewritestr(ircfd, msg);
-}
-
-static 
-void
-proc_server_cmd(int fd, char *buf)
-{
-	Channel *c;
-	const char *channel;
-	char *argv[TOK_LAST], *cmd = nil, *p = nil;
-	unsigned int i;
-
-	if (!buf || buf[0] == '\0')
-		return;
-
-	/* clear tokens */
-	for (i = 0; i < TOK_LAST; i++)
-		argv[i] = nil;
-
-	/* check prefix */
-	if (buf[0] == ':') {
-		if (!(p = strchr(buf, ' ')))
-			return;
-		*p = '\0';
-		for (++p; *p == ' '; p++)
-			;
-		cmd = p;
-		argv[TOK_NICKSRV] = &buf[1];
-		if ((p = strchr(buf, '!'))) {
-			*p = '\0';
-			argv[TOK_USER] = ++p;
-		}
-	} else {
-		cmd = buf;
-	}
-
-	/* remove CRLFs */
-	for (p = cmd; p && *p != '\0'; p++) {
-		if (*p == '\r' || *p == '\n')
-			*p = '\0';
-	}
-
-	if ((p = strchr(cmd, ':'))) {
-		*p = '\0';
-		argv[TOK_TEXT] = ++p;
-	}
-
-	tokenize(&argv[TOK_CMD], TOK_LAST - TOK_CMD, cmd, ' ');
-
-	if (!argv[TOK_CMD] || !strcmp("PONG", argv[TOK_CMD])) {
-		return;
-	} else if (!strcmp("PING", argv[TOK_CMD])) {
-		snprintf(msg, sizeof(msg), "PONG %s\r\n", argv[TOK_TEXT]);
-		ewritestr(fd, msg);
-		return;
-	} else if (!argv[TOK_NICKSRV] || !argv[TOK_USER]) {
-		/* server command */
-		snprintf(msg, sizeof(msg), "%s%s",
-				argv[TOK_ARG] ? argv[TOK_ARG] : "",
-				argv[TOK_TEXT] ? argv[TOK_TEXT] : "");
-		channel_print(channelmaster, msg);
-		return; /* don't process further */
-	} else if (!strcmp("ERROR", argv[TOK_CMD]))
-		snprintf(msg, sizeof(msg), "-!- error %s",
-				argv[TOK_TEXT] ? argv[TOK_TEXT] : "unknown");
-	else if (!strcmp("JOIN", argv[TOK_CMD]) && (argv[TOK_CHAN] || argv[TOK_TEXT])) {
-		if (argv[TOK_TEXT])
-			argv[TOK_CHAN] = argv[TOK_TEXT];
-		snprintf(msg, sizeof(msg), "-!- %s(%s) has joined %s",
-				argv[TOK_NICKSRV], argv[TOK_USER], argv[TOK_CHAN]);
-	} else if (!strcmp("PART", argv[TOK_CMD]) && argv[TOK_CHAN]) {
-		snprintf(msg, sizeof(msg), "-!- %s(%s) has left %s",
-				argv[TOK_NICKSRV], argv[TOK_USER], argv[TOK_CHAN]);
-		/* if user itself leaves, don't write to channel (don't reopen channel). */
-		if (!strcmp(argv[TOK_NICKSRV], nick))
-			return;
-	} else if (!strcmp("MODE", argv[TOK_CMD])) {
-		snprintf(msg, sizeof(msg), "-!- %s changed mode/%s -> %s %s",
-				argv[TOK_NICKSRV],
-				argv[TOK_CHAN] ? argv[TOK_CHAN] : "",
-				argv[TOK_ARG]  ? argv[TOK_ARG] : "",
-				argv[TOK_TEXT] ? argv[TOK_TEXT] : "");
-	} else if (!strcmp("QUIT", argv[TOK_CMD])) {
-		snprintf(msg, sizeof(msg), "-!- %s(%s) has quit \"%s\"",
-				argv[TOK_NICKSRV], argv[TOK_USER],
-				argv[TOK_TEXT] ? argv[TOK_TEXT] : "");
-	} else if (!strncmp("NICK", argv[TOK_CMD], 5) && argv[TOK_TEXT] &&
-	          !strcmp(_nick, argv[TOK_TEXT])) {
-		strlcpy(nick, _nick, sizeof(nick));
-		snprintf(msg, sizeof(msg), "-!- changed nick to \"%s\"", nick);
-		channel_print(channelmaster, msg);
-	} else if (!strcmp("NICK", argv[TOK_CMD]) && argv[TOK_TEXT]) {
-		snprintf(msg, sizeof(msg), "-!- %s changed nick to %s",
-				argv[TOK_NICKSRV], argv[TOK_TEXT]);
-	} else if (!strcmp("TOPIC", argv[TOK_CMD])) {
-		snprintf(msg, sizeof(msg), "-!- %s changed topic to \"%s\"",
-				argv[TOK_NICKSRV],
-				argv[TOK_TEXT] ? argv[TOK_TEXT] : "");
-	} else if (!strcmp("KICK", argv[TOK_CMD]) && argv[TOK_ARG]) {
-		snprintf(msg, sizeof(msg), "-!- %s kicked %s (\"%s\")",
-				argv[TOK_NICKSRV], argv[TOK_ARG],
-				argv[TOK_TEXT] ? argv[TOK_TEXT] : "");
-	} else if (!strcmp("NOTICE", argv[TOK_CMD])) {
-		snprintf(msg, sizeof(msg), "-!- \"%s\"",
-				argv[TOK_TEXT] ? argv[TOK_TEXT] : "");
-	} else if (!strcmp("PRIVMSG", argv[TOK_CMD])) {
-		snprintf(msg, sizeof(msg), "<%s> %s", argv[TOK_NICKSRV],
-				argv[TOK_TEXT] ? argv[TOK_TEXT] : "");
-	} else {
-		return; /* can't read this message */
-	}
-	if (argv[TOK_CHAN] && !strcmp(argv[TOK_CHAN], nick))
-		channel = argv[TOK_NICKSRV];
-	else
-		channel = argv[TOK_CHAN];
-
-	if (!channel || channel[0] == '\0')
-		c = channelmaster;
-	else
-		c = channel_join(channel);
-	if (c)
-		channel_print(c, msg);
-}
-
-static 
-int
-read_line(int fd, char *buf, size_t bufsiz)
-{
-	size_t i = 0;
-	char c = '\0';
-
-	do {
-		if (read(fd, &c, sizeof(char)) != sizeof(char))
-			return -1;
-		buf[i++] = c;
-	} while (c != '\n' && i < bufsiz);
-	buf[i - 1] = '\0'; /* eliminates '\n' */
-	return 0;
-}
-
-static 
-void
-handle_channels_input(int ircfd, Channel *c)
-{
-	char buf[IRC_MSG_MAX];
-
-	if(read_line(c->fdin, buf, sizeof(buf)) == -1) {
-		if(channel_reopen(c) == -1)
-			channel_rm(c);
-		return;
-	}
-	proc_channels_input(ircfd, c, buf);
-}
-
-static 
-void
-handle_server_output(int ircfd)
-{
-	char buf[IRC_MSG_MAX];
-
-	if (read_line(ircfd, buf, sizeof(buf)) == -1) {
-		fprintf(stderr, "%s: remote host closed connection: %s\n",
-		        argv0, strerror(errno));
-		exit(1);
-	}
-	fprintf(stdout, "%lu %s\n", (unsigned long)time(nil), buf);
-	fflush(stdout);
-	proc_server_cmd(ircfd, buf);
-}
-
-static 
-void
-sighandler(int sig)
-{
-	if (sig == SIGTERM || sig == SIGINT)
-		isrunning = 0;
-}
-
-static 
-void
-setup(void)
-{
-	struct sigaction sa;
-
-	memset(&sa, 0, sizeof(sa));
-	sa.sa_handler = sighandler;
-	sigaction(SIGTERM, &sa, nil);
-	sigaction(SIGINT, &sa, nil);
-}
-
-static 
-void
-run(int ircfd, const char *host)
-{
-	Channel *c, *tmp;
-	fd_set rdset;
-	struct timeval tv;
-	char ping_msg[IRC_MSG_MAX];
-	int r, maxfd;
-
-	snprintf(ping_msg, sizeof(ping_msg), "PING %s\r\n", host);
-	while(isrunning) {
-		maxfd = ircfd;
-		FD_ZERO(&rdset);
-		FD_SET(ircfd, &rdset);
-		for (c = channels; c; c = c->next) {
-			if (c->fdin > maxfd)
-				maxfd = c->fdin;
-			FD_SET(c->fdin, &rdset);
-		}
-		memset(&tv, 0, sizeof(tv));
-		tv.tv_sec = 120;
-		r = select(maxfd + 1, &rdset, 0, 0, &tv);
-		if(r < 0){
-			if (errno == EINTR)
-				continue;
-			fprintf(stderr, "%s: select: %s\n", argv0, strerror(errno));
-			exit(1);
-		}else if(r == 0){
-			if (time(nil) - last_response >= PING_TIMEOUT) {
-				channel_print(channelmaster, "-!- ii shutting down: ping timeout");
-				exit(2); /* status code 2 for timeout */
-			}
-			ewritestr(ircfd, ping_msg);
-			continue;
-		}
-		if(FD_ISSET(ircfd, &rdset)) {
-			handle_server_output(ircfd);
-			last_response = time(nil);
-		}
-		for(c = channels; c; c = tmp) {
-			tmp = c->next;
-			if (FD_ISSET(c->fdin, &rdset))
-				handle_channels_input(ircfd, c);
-		}
-	}
-}
-
-int
-main(int argc, char *argv[])
-{
-	Channel *c, *tmp;
-	struct passwd *spw;
-	const char *key = nil, *fullname = nil, *host = "";
-	const char *uds = nil, *service = "6667";
-	char prefix[PATH_MAX];
-	int ircfd, r;
-
-	/* use nickname and home dir of user by default */
-	if(!(spw = getpwuid(getuid()))) {
-		fprintf(stderr, "%s: getpwuid: %s\n", argv0, strerror(errno));
-		exit(1);
-	}
-	strlcpy(nick, spw->pw_name, sizeof(nick));
-	snprintf(prefix, sizeof(prefix), "%s/irc", spw->pw_dir);
-
-	ARGBEGIN {
-	case 'f':
-		fullname = EARGF(usage());
-		break;
-	case 'i':
-		strlcpy(prefix, EARGF(usage()), sizeof(prefix));
-		break;
-	case 'k':
-		key = getenv(EARGF(usage()));
-		break;
-	case 'n':
-		strlcpy(nick, EARGF(usage()), sizeof(nick));
-		break;
-	case 'p':
-		service = EARGF(usage());
-		break;
-	case 's':
-		host = EARGF(usage());
-		break;
-	case 'u':
-		uds = EARGF(usage());
-		break;
-	default:
-		usage();
-		break;
-	} ARGEND
-
-	if(!*host)
-		usage();
-
-	if(uds)
-		ircfd = udsopen(uds);
-	else
-		ircfd = tcpopen(host, service);
-
-#ifdef __OpenBSD__
-	/* OpenBSD pledge(2) support */
-	if (pledge("stdio rpath wpath cpath dpath", nil) == -1) {
-		fprintf(stderr, "%s: pledge: %s\n", argv0, strerror(errno));
-		exit(1);
-	}
-#endif
-
-	r = snprintf(ircpath, sizeof(ircpath), "%s/%s", prefix, host);
-	if (r < 0 || (size_t)r >= sizeof(ircpath)) {
-		fprintf(stderr, "%s: path to irc directory too long\n", argv0);
-		exit(1);
-	}
-	create_dirtree(ircpath);
-
-	channelmaster = channel_add(""); /* master channel */
-	if(key)
-		loginkey(ircfd, key);
-	loginuser(ircfd, host, fullname && *fullname ? fullname : nick);
-	setup();
-	run(ircfd, host);
-	if(channelmaster)
-		channel_leave(channelmaster);
-
-	for(c = channels; c; c = tmp) {
-		tmp = c->next;
-		channel_leave(c);
-	}
-
-	return 0;
-}
diff --git a/sys/cmd/ic/rules.mk b/sys/cmd/ic/rules.mk
deleted file mode 100644
index 649c9ac..0000000
--- a/sys/cmd/ic/rules.mk
+++ /dev/null
@@ -1,14 +0,0 @@
-include share/push.mk
-# Iterate through subdirectory tree
-
-# Local sources
-SRCS_$(d) := $(d)/strlcpy.c $(d)/ic.c
-BINS_$(d) := $(d)/ic
-
-include share/paths.mk
-
-# Local rules
-$(BINS_$(d)): $(OBJS_$(d)) $(OBJ_DIR)/sys/base/base.a
-	$(COMPLINK)
-
-include share/pop.mk
diff --git a/sys/cmd/ic/strlcpy.c b/sys/cmd/ic/strlcpy.c
deleted file mode 100644
index 5af7906..0000000
--- a/sys/cmd/ic/strlcpy.c
+++ /dev/null
@@ -1,32 +0,0 @@
-/* Taken from OpenBSD */
-#include <sys/types.h>
-#include <string.h>
-
-/*
- * Copy src to string dst of size siz.  At most siz-1 characters
- * will be copied.  Always NUL terminates (unless siz == 0).
- * Returns strlen(src); if retval >= siz, truncation occurred.
- */
-size_t
-strlcpy(char *dst, const char *src, size_t siz)
-{
-	char *d = dst;
-	const char *s = src;
-	size_t n = siz;
-
-	/* Copy as many bytes as will fit */
-	if(n != 0) {
-		while(--n != 0) {
-			if((*d++ = *s++) == '\0')
-				break;
-		}
-	}
-	/* Not enough room in dst, add NUL and traverse rest of src */
-	if(n == 0) {
-		if(siz != 0)
-			*d = '\0'; /* NUL-terminate dst */
-		while(*s++)
-			;
-	}
-	return s - src - 1; /* count does not include NUL */
-}
diff --git a/sys/cmd/menu/LICENSE b/sys/cmd/menu/LICENSE
deleted file mode 100644
index 9762166..0000000
--- a/sys/cmd/menu/LICENSE
+++ /dev/null
@@ -1,30 +0,0 @@
-MIT/X Consortium License
-
-© 2006-2019 Anselm R Garbe <anselm@garbe.ca>
-© 2006-2008 Sander van Dijk <a.h.vandijk@gmail.com>
-© 2006-2007 Michał Janeczek <janeczek@gmail.com>
-© 2007 Kris Maglione <jg@suckless.org>
-© 2009 Gottox <gottox@s01.de>
-© 2009 Markus Schnalke <meillo@marmaro.de>
-© 2009 Evan Gates <evan.gates@gmail.com>
-© 2010-2012 Connor Lane Smith <cls@lubutu.com>
-© 2014-2019 Hiltjo Posthuma <hiltjo@codemadness.org>
-© 2015-2019 Quentin Rameau <quinq@fifth.space>
-
-Permission is hereby granted, free of charge, to any person obtaining a
-copy of this software and associated documentation files (the "Software"),
-to deal in the Software without restriction, including without limitation
-the rights to use, copy, modify, merge, publish, distribute, sublicense,
-and/or sell copies of the Software, and to permit persons to whom the
-Software is furnished to do so, subject to the following conditions:
-
-The above copyright notice and this permission notice shall be included in
-all copies or substantial portions of the Software.
-
-THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.  IN NO EVENT SHALL
-THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
-FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
-DEALINGS IN THE SOFTWARE.
diff --git a/sys/cmd/menu/config.h b/sys/cmd/menu/config.h
deleted file mode 100644
index 9bfd5b3..0000000
--- a/sys/cmd/menu/config.h
+++ /dev/null
@@ -1,25 +0,0 @@
-/* See LICENSE file for copyright and license details. */
-/* Default settings; can be overriden by command line. */
-#define VERSION "1.0"
-
-static int topbar = 1;                      /* -b  option; if 0, dmenu appears at bottom     */
-/* -fn option overrides fonts[0]; default X11 font or font set */
-static const char *fonts[] = {
-	"consolas:size=16"
-};
-
-static const char *prompt      = "cmds";      /* -p  option; prompt to the left of input field */
-static const char *colors[SchemeLast][2] = {
-	             /*     fg         bg       */
-	[SchemeNorm] = { "#fbf1c7", "#504945" },
-	[SchemeSel]  = { "#504945", "#83a598" },
-	[SchemeOut]  = { "#000000", "#00ffff" },
-};
-/* -l option; if nonzero, dmenu uses vertical list with given number of lines */
-static unsigned int lines      = 0;
-
-/*
- * Characters not considered part of a word while deleting words
- * e.g. " /?\"&[]"
- */
-static const char worddelimiters[] = " ";
diff --git a/sys/cmd/menu/drw.c b/sys/cmd/menu/drw.c
deleted file mode 100644
index 162fe40..0000000
--- a/sys/cmd/menu/drw.c
+++ /dev/null
@@ -1,428 +0,0 @@
-/* See LICENSE file for copyright and license details. */
-#include "menu.h"
-
-#define UTF_INVALID 0xFFFD
-#define UTF_SIZ     4
-
-static const unsigned char utfbyte[UTF_SIZ + 1] = {0x80,    0, 0xC0, 0xE0, 0xF0};
-static const unsigned char utfmask[UTF_SIZ + 1] = {0xC0, 0x80, 0xE0, 0xF0, 0xF8};
-static const long utfmin[UTF_SIZ + 1] = {       0,    0,  0x80,  0x800,  0x10000};
-static const long utfmax[UTF_SIZ + 1] = {0x10FFFF, 0x7F, 0x7FF, 0xFFFF, 0x10FFFF};
-
-static long
-utf8decodebyte(const char c, size_t *i)
-{
-	for (*i = 0; *i < (UTF_SIZ + 1); ++(*i))
-		if (((unsigned char)c & utfmask[*i]) == utfbyte[*i])
-			return (unsigned char)c & ~utfmask[*i];
-	return 0;
-}
-
-static size_t
-utf8validate(long *u, size_t i)
-{
-	if (!BETWEEN(*u, utfmin[i], utfmax[i]) || BETWEEN(*u, 0xD800, 0xDFFF))
-		*u = RuneErr;
-	for (i = 1; *u > utfmax[i]; ++i)
-		;
-	return i;
-}
-
-static size_t
-utf8decode(const char *c, long *u, size_t clen)
-{
-	size_t i, j, len, type;
-	long udecoded;
-
-	*u = RuneErr;
-	if (!clen)
-		return 0;
-	udecoded = utf8decodebyte(c[0], &len);
-	if (!BETWEEN(len, 1, UTF_SIZ))
-		return 1;
-	for (i = 1, j = 1; i < clen && j < len; ++i, ++j) {
-		udecoded = (udecoded << 6) | utf8decodebyte(c[i], &type);
-		if (type)
-			return j;
-	}
-	if (j < len)
-		return 0;
-	*u = udecoded;
-	utf8validate(u, len);
-
-	return len;
-}
-
-Drw *
-drw_create(Display *dpy, int screen, Window root, unsigned int w, unsigned int h)
-{
-	Drw *drw = ecalloc(1, sizeof(Drw));
-
-	drw->dpy = dpy;
-	drw->screen = screen;
-	drw->root = root;
-	drw->w = w;
-	drw->h = h;
-	drw->drawable = XCreatePixmap(dpy, root, w, h, DefaultDepth(dpy, screen));
-	drw->gc = XCreateGC(dpy, root, 0, NULL);
-	XSetLineAttributes(dpy, drw->gc, 1, LineSolid, CapButt, JoinMiter);
-
-	return drw;
-}
-
-void
-drw_resize(Drw *drw, unsigned int w, unsigned int h)
-{
-	if (!drw)
-		return;
-
-	drw->w = w;
-	drw->h = h;
-	if (drw->drawable)
-		XFreePixmap(drw->dpy, drw->drawable);
-	drw->drawable = XCreatePixmap(drw->dpy, drw->root, w, h, DefaultDepth(drw->dpy, drw->screen));
-}
-
-void
-drw_free(Drw *drw)
-{
-	XFreePixmap(drw->dpy, drw->drawable);
-	XFreeGC(drw->dpy, drw->gc);
-	free(drw);
-}
-
-/* This function is an implementation detail. Library users should use
- * drw_fontset_create instead.
- */
-static Fnt *
-xfont_create(Drw *drw, const char *fontname, FcPattern *fontpattern)
-{
-	Fnt *font;
-	XftFont *xfont = NULL;
-	FcPattern *pattern = NULL;
-
-	if (fontname) {
-		/* Using the pattern found at font->xfont->pattern does not yield the
-		 * same substitution results as using the pattern returned by
-		 * FcNameParse; using the latter results in the desired fallback
-		 * behaviour whereas the former just results in missing-character
-		 * rectangles being drawn, at least with some fonts. */
-		if (!(xfont = XftFontOpenName(drw->dpy, drw->screen, fontname))) {
-			fprintf(stderr, "error, cannot load font from name: '%s'\n", fontname);
-			return NULL;
-		}
-		if (!(pattern = FcNameParse((FcChar8 *) fontname))) {
-			fprintf(stderr, "error, cannot parse font name to pattern: '%s'\n", fontname);
-			XftFontClose(drw->dpy, xfont);
-			return NULL;
-		}
-	} else if (fontpattern) {
-		if (!(xfont = XftFontOpenPattern(drw->dpy, fontpattern))) {
-			fprintf(stderr, "error, cannot load font from pattern.\n");
-			return NULL;
-		}
-	} else {
-		fatal("no font specified.");
-	}
-
-	/* Do not allow using color fonts. This is a workaround for a BadLength
-	 * error from Xft with color glyphs. Modelled on the Xterm workaround. See
-	 * https://bugzilla.redhat.com/show_bug.cgi?id=1498269
-	 * https://lists.suckless.org/dev/1701/30932.html
-	 * https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=916349
-	 * and lots more all over the internet.
-	 */
-	FcBool iscol;
-	if(FcPatternGetBool(xfont->pattern, FC_COLOR, 0, &iscol) == FcResultMatch && iscol) {
-		XftFontClose(drw->dpy, xfont);
-		return NULL;
-	}
-
-	font = ecalloc(1, sizeof(Fnt));
-	font->xfont = xfont;
-	font->pattern = pattern;
-	font->h = xfont->ascent + xfont->descent;
-	font->dpy = drw->dpy;
-
-	return font;
-}
-
-static void
-xfont_free(Fnt *font)
-{
-	if (!font)
-		return;
-	if (font->pattern)
-		FcPatternDestroy(font->pattern);
-	XftFontClose(font->dpy, font->xfont);
-	free(font);
-}
-
-Fnt*
-drw_fontset_create(Drw* drw, const char *fonts[], size_t fontcount)
-{
-	Fnt *cur, *ret = NULL;
-	size_t i;
-
-	if (!drw || !fonts)
-		return NULL;
-
-	for (i = 1; i <= fontcount; i++) {
-		if ((cur = xfont_create(drw, fonts[fontcount - i], NULL))) {
-			cur->next = ret;
-			ret = cur;
-		}
-	}
-	return (drw->fonts = ret);
-}
-
-void
-drw_fontset_free(Fnt *font)
-{
-	if (font) {
-		drw_fontset_free(font->next);
-		xfont_free(font);
-	}
-}
-
-void
-drw_clr_create(Drw *drw, Clr *dest, const char *clrname)
-{
-	if (!drw || !dest || !clrname)
-		return;
-
-	if (!XftColorAllocName(drw->dpy, DefaultVisual(drw->dpy, drw->screen),
-	                       DefaultColormap(drw->dpy, drw->screen),
-	                       clrname, dest))
-		fatal("error, cannot allocate color '%s'", clrname);
-}
-
-/* Wrapper to create color schemes. The caller has to call free(3) on the
- * returned color scheme when done using it. */
-Clr *
-drw_scm_create(Drw *drw, const char *clrnames[], size_t clrcount)
-{
-	size_t i;
-	Clr *ret;
-
-	/* need at least two colors for a scheme */
-	if (!drw || !clrnames || clrcount < 2 || !(ret = ecalloc(clrcount, sizeof(XftColor))))
-		return NULL;
-
-	for (i = 0; i < clrcount; i++)
-		drw_clr_create(drw, &ret[i], clrnames[i]);
-	return ret;
-}
-
-void
-drw_setfontset(Drw *drw, Fnt *set)
-{
-	if (drw)
-		drw->fonts = set;
-}
-
-void
-drw_setscheme(Drw *drw, Clr *scm)
-{
-	if (drw)
-		drw->scheme = scm;
-}
-
-void
-drw_rect(Drw *drw, int x, int y, unsigned int w, unsigned int h, int filled, int invert)
-{
-	if (!drw || !drw->scheme)
-		return;
-	XSetForeground(drw->dpy, drw->gc, invert ? drw->scheme[ColBg].pixel : drw->scheme[ColFg].pixel);
-	if (filled)
-		XFillRectangle(drw->dpy, drw->drawable, drw->gc, x, y, w, h);
-	else
-		XDrawRectangle(drw->dpy, drw->drawable, drw->gc, x, y, w - 1, h - 1);
-}
-
-int
-drw_text(Drw *drw, int x, int y, unsigned int w, unsigned int h, unsigned int lpad, const char *text, int invert)
-{
-	char buf[1024];
-	int ty;
-	unsigned int ew;
-	XftDraw *d = NULL;
-	Fnt *usedfont, *curfont, *nextfont;
-	size_t i, len;
-	int utf8strlen, utf8charlen, render = x || y || w || h;
-	long utf8codepoint = 0;
-	const char *utf8str;
-	FcCharSet *fccharset;
-	FcPattern *fcpattern;
-	FcPattern *match;
-	XftResult result;
-	int charexists = 0;
-
-	if (!drw || (render && !drw->scheme) || !text || !drw->fonts)
-		return 0;
-
-	if (!render) {
-		w = ~w;
-	} else {
-		XSetForeground(drw->dpy, drw->gc, drw->scheme[invert ? ColFg : ColBg].pixel);
-		XFillRectangle(drw->dpy, drw->drawable, drw->gc, x, y, w, h);
-		d = XftDrawCreate(drw->dpy, drw->drawable,
-		                  DefaultVisual(drw->dpy, drw->screen),
-		                  DefaultColormap(drw->dpy, drw->screen));
-		x += lpad;
-		w -= lpad;
-	}
-
-	usedfont = drw->fonts;
-	while (1) {
-		utf8strlen = 0;
-		utf8str = text;
-		nextfont = NULL;
-		while (*text) {
-			utf8charlen = utf8decode(text, &utf8codepoint, UTF_SIZ);
-			for (curfont = drw->fonts; curfont; curfont = curfont->next) {
-				charexists = charexists || XftCharExists(drw->dpy, curfont->xfont, utf8codepoint);
-				if (charexists) {
-					if (curfont == usedfont) {
-						utf8strlen += utf8charlen;
-						text += utf8charlen;
-					} else {
-						nextfont = curfont;
-					}
-					break;
-				}
-			}
-
-			if (!charexists || nextfont)
-				break;
-			else
-				charexists = 0;
-		}
-
-		if (utf8strlen) {
-			drw_font_getexts(usedfont, utf8str, utf8strlen, &ew, NULL);
-			/* shorten text if necessary */
-			for (len = MIN(utf8strlen, sizeof(buf) - 1); len && ew > w; len--)
-				drw_font_getexts(usedfont, utf8str, len, &ew, NULL);
-
-			if (len) {
-				memcpy(buf, utf8str, len);
-				buf[len] = '\0';
-				if (len < utf8strlen)
-					for (i = len; i && i > len - 3; buf[--i] = '.')
-						; /* NOP */
-
-				if (render) {
-					ty = y + (h - usedfont->h) / 2 + usedfont->xfont->ascent;
-					XftDrawStringUtf8(d, &drw->scheme[invert ? ColBg : ColFg],
-					                  usedfont->xfont, x, ty, (XftChar8 *)buf, len);
-				}
-				x += ew;
-				w -= ew;
-			}
-		}
-
-		if (!*text) {
-			break;
-		} else if (nextfont) {
-			charexists = 0;
-			usedfont = nextfont;
-		} else {
-			/* Regardless of whether or not a fallback font is found, the
-			 * character must be drawn. */
-			charexists = 1;
-
-			fccharset = FcCharSetCreate();
-			FcCharSetAddChar(fccharset, utf8codepoint);
-
-			if (!drw->fonts->pattern) {
-				/* Refer to the comment in xfont_create for more information. */
-				fatal("the first font in the cache must be loaded from a font string.");
-			}
-
-			fcpattern = FcPatternDuplicate(drw->fonts->pattern);
-			FcPatternAddCharSet(fcpattern, FC_CHARSET, fccharset);
-			FcPatternAddBool(fcpattern, FC_SCALABLE, FcTrue);
-			FcPatternAddBool(fcpattern, FC_COLOR, FcFalse);
-
-			FcConfigSubstitute(NULL, fcpattern, FcMatchPattern);
-			FcDefaultSubstitute(fcpattern);
-			match = XftFontMatch(drw->dpy, drw->screen, fcpattern, &result);
-
-			FcCharSetDestroy(fccharset);
-			FcPatternDestroy(fcpattern);
-
-			if (match) {
-				usedfont = xfont_create(drw, NULL, match);
-				if (usedfont && XftCharExists(drw->dpy, usedfont->xfont, utf8codepoint)) {
-					for (curfont = drw->fonts; curfont->next; curfont = curfont->next)
-						; /* NOP */
-					curfont->next = usedfont;
-				} else {
-					xfont_free(usedfont);
-					usedfont = drw->fonts;
-				}
-			}
-		}
-	}
-	if (d)
-		XftDrawDestroy(d);
-
-	return x + (render ? w : 0);
-}
-
-void
-drw_map(Drw *drw, Window win, int x, int y, unsigned int w, unsigned int h)
-{
-	if (!drw)
-		return;
-
-	XCopyArea(drw->dpy, drw->drawable, win, drw->gc, x, y, w, h, x, y);
-	XSync(drw->dpy, False);
-}
-
-unsigned int
-drw_fontset_getwidth(Drw *drw, const char *text)
-{
-	if (!drw || !drw->fonts || !text)
-		return 0;
-	return drw_text(drw, 0, 0, 0, 0, 0, text, 0);
-}
-
-void
-drw_font_getexts(Fnt *font, const char *text, unsigned int len, unsigned int *w, unsigned int *h)
-{
-	XGlyphInfo ext;
-
-	if (!font || !text)
-		return;
-
-	XftTextExtentsUtf8(font->dpy, font->xfont, (XftChar8 *)text, len, &ext);
-	if (w)
-		*w = ext.xOff;
-	if (h)
-		*h = font->h;
-}
-
-Cur *
-drw_cur_create(Drw *drw, int shape)
-{
-	Cur *cur;
-
-	if (!drw || !(cur = ecalloc(1, sizeof(Cur))))
-		return NULL;
-
-	cur->cursor = XCreateFontCursor(drw->dpy, shape);
-
-	return cur;
-}
-
-void
-drw_cur_free(Drw *drw, Cur *cursor)
-{
-	if (!cursor)
-		return;
-
-	XFreeCursor(drw->dpy, cursor->cursor);
-	free(cursor);
-}
diff --git a/sys/cmd/menu/drw.h b/sys/cmd/menu/drw.h
deleted file mode 100644
index 4c67419..0000000
--- a/sys/cmd/menu/drw.h
+++ /dev/null
@@ -1,57 +0,0 @@
-/* See LICENSE file for copyright and license details. */
-
-typedef struct {
-	Cursor cursor;
-} Cur;
-
-typedef struct Fnt {
-	Display *dpy;
-	unsigned int h;
-	XftFont *xfont;
-	FcPattern *pattern;
-	struct Fnt *next;
-} Fnt;
-
-enum { ColFg, ColBg }; /* Clr scheme index */
-typedef XftColor Clr;
-
-typedef struct {
-	unsigned int w, h;
-	Display *dpy;
-	int screen;
-	Window root;
-	Drawable drawable;
-	GC gc;
-	Clr *scheme;
-	Fnt *fonts;
-} Drw;
-
-/* Drawable abstraction */
-Drw *drw_create(Display *dpy, int screen, Window win, unsigned int w, unsigned int h);
-void drw_resize(Drw *drw, unsigned int w, unsigned int h);
-void drw_free(Drw *drw);
-
-/* Fnt abstraction */
-Fnt *drw_fontset_create(Drw* drw, const char *fonts[], size_t fontcount);
-void drw_fontset_free(Fnt* set);
-unsigned int drw_fontset_getwidth(Drw *drw, const char *text);
-void drw_font_getexts(Fnt *font, const char *text, unsigned int len, unsigned int *w, unsigned int *h);
-
-/* Colorscheme abstraction */
-void drw_clr_create(Drw *drw, Clr *dest, const char *clrname);
-Clr *drw_scm_create(Drw *drw, const char *clrnames[], size_t clrcount);
-
-/* Cursor abstraction */
-Cur *drw_cur_create(Drw *drw, int shape);
-void drw_cur_free(Drw *drw, Cur *cursor);
-
-/* Drawing context manipulation */
-void drw_setfontset(Drw *drw, Fnt *set);
-void drw_setscheme(Drw *drw, Clr *scm);
-
-/* Drawing functions */
-void drw_rect(Drw *drw, int x, int y, unsigned int w, unsigned int h, int filled, int invert);
-int drw_text(Drw *drw, int x, int y, unsigned int w, unsigned int h, unsigned int lpad, const char *text, int invert);
-
-/* Map functions */
-void drw_map(Drw *drw, Window win, int x, int y, unsigned int w, unsigned int h);
diff --git a/sys/cmd/menu/menu.c b/sys/cmd/menu/menu.c
deleted file mode 100644
index e6e4bb2..0000000
--- a/sys/cmd/menu/menu.c
+++ /dev/null
@@ -1,765 +0,0 @@
-#include "menu.h"
-
-static char text[BUFSIZ] = "";
-static char *embed;
-static int bh, mw, mh;
-static int inputw = 0, promptw, passwd = 0;
-static int lrpad; /* sum of left and right padding */
-static size_t cursor;
-static struct item *items = nil;
-static struct item *matches, *matchend;
-static struct item *prev, *curr, *next, *sel;
-static int mon = -1, screen;
-
-static Atom clip, utf8;
-static Display *dpy;
-static Window root, parentwin, win;
-static XIC xic;
-
-static Drw *drw;
-static Clr *scheme[SchemeLast];
-
-#include "config.h"
-
-static int   (*fstrncmp)(const char *, const char *, size_t) = strncmp;
-static char *(*fstrstr)(const char *, const char *) = strstr;
-
-static 
-void
-appenditem(struct item *item, struct item **list, struct item **last)
-{
-	if (*last)
-		(*last)->right = item;
-	else
-		*list = item;
-
-	item->left = *last;
-	item->right = nil;
-	*last = item;
-}
-
-static 
-void
-calcoffsets(void)
-{
-	int i, n;
-
-	if (lines > 0)
-		n = lines * bh;
-	else
-		n = mw - (promptw + inputw + TEXTW("<") + TEXTW(">"));
-	/* calculate which items will begin the next page and previous page */
-	for (i = 0, next = curr; next; next = next->right)
-		if ((i += (lines > 0) ? bh : MIN(TEXTW(next->text), n)) > n)
-			break;
-	for (i = 0, prev = curr; prev && prev->left; prev = prev->left)
-		if ((i += (lines > 0) ? bh : MIN(TEXTW(prev->left->text), n)) > n)
-			break;
-}
-
-static 
-void
-cleanup(void)
-{
-	size_t i;
-
-	XUngrabKey(dpy, AnyKey, AnyModifier, root);
-	for (i = 0; i < SchemeLast; i++)
-		free(scheme[i]);
-	drw_free(drw);
-	XSync(dpy, False);
-	XCloseDisplay(dpy);
-}
-
-static 
-char *
-cistrstr(const char *s, const char *sub)
-{
-	size_t len;
-
-	for (len = strlen(sub); *s; s++)
-		if (!strncasecmp(s, sub, len))
-			return (char *)s;
-	return nil;
-}
-
-static 
-int
-drawitem(struct item *item, int x, int y, int w)
-{
-	if (item == sel)
-		drw_setscheme(drw, scheme[SchemeSel]);
-	else if (item->out)
-		drw_setscheme(drw, scheme[SchemeOut]);
-	else
-		drw_setscheme(drw, scheme[SchemeNorm]);
-
-	return drw_text(drw, x, y, w, bh, lrpad / 2, item->text, 0);
-}
-
-static 
-void
-drawmenu(void)
-{
-	uint curpos;
-	struct item *item;
-	int x = 0, y = 0, w;
-    char *censort;
-
-	drw_setscheme(drw, scheme[SchemeNorm]);
-	drw_rect(drw, 0, 0, mw, mh, 1, 1);
-
-	if (prompt && *prompt) {
-		drw_setscheme(drw, scheme[SchemeSel]);
-		x = drw_text(drw, x, 0, promptw, bh, lrpad / 2, prompt, 0);
-	}
-	/* draw input field */
-	w = (lines > 0 || !matches) ? mw - x : inputw;
-	drw_setscheme(drw, scheme[SchemeNorm]);
-	drw_text(drw, x, 0, w, bh, lrpad / 2, text, 0);
-    if(passwd){
-        censort = ecalloc(1, sizeof(text));
-        memset(censort, '.', strlen(text));
-        drw_text(drw, x, 0, w, bh, lrpad / 2, censort, 0);
-        free(censort);
-    }
-
-	curpos = TEXTW(text) - TEXTW(&text[cursor]);
-	if ((curpos += lrpad / 2 - 1) < w) {
-		drw_setscheme(drw, scheme[SchemeNorm]);
-		drw_rect(drw, x + curpos, 2, 2, bh - 4, 1, 0);
-	}
-
-	if (lines > 0) {
-		/* draw vertical list */
-		for (item = curr; item != next; item = item->right)
-			drawitem(item, x, y += bh, mw - x);
-	} else if (matches) {
-		/* draw horizontal list */
-		x += inputw;
-		w = TEXTW("<");
-		if (curr->left) {
-			drw_setscheme(drw, scheme[SchemeNorm]);
-			drw_text(drw, x, 0, w, bh, lrpad / 2, "<", 0);
-		}
-		x += w;
-		for (item = curr; item != next; item = item->right)
-			x = drawitem(item, x, 0, MIN(TEXTW(item->text), mw - x - TEXTW(">")));
-		if (next) {
-			w = TEXTW(">");
-			drw_setscheme(drw, scheme[SchemeNorm]);
-			drw_text(drw, mw - w, 0, w, bh, lrpad / 2, ">", 0);
-		}
-	}
-	drw_map(drw, win, 0, 0, mw, mh);
-}
-
-static 
-void
-grabfocus(void)
-{
-	struct timespec ts = { .tv_sec = 0, .tv_nsec = 10000000  };
-	Window focuswin;
-	int i, revertwin;
-
-	for (i = 0; i < 100; ++i) {
-		XGetInputFocus(dpy, &focuswin, &revertwin);
-		if (focuswin == win)
-			return;
-		XSetInputFocus(dpy, win, RevertToParent, CurrentTime);
-		nanosleep(&ts, nil);
-	}
-	fatal("cannot grab focus");
-}
-
-static 
-void
-grabkeyboard(void)
-{
-	struct timespec ts = { .tv_sec = 0, .tv_nsec = 1000000  };
-	int i;
-
-	if (embed)
-		return;
-	/* try to grab keyboard, we may have to wait for another process to ungrab */
-	for (i = 0; i < 1000; i++) {
-		if (XGrabKeyboard(dpy, DefaultRootWindow(dpy), True, GrabModeAsync,
-		                  GrabModeAsync, CurrentTime) == GrabSuccess)
-			return;
-		nanosleep(&ts, nil);
-	}
-	fatal("cannot grab keyboard");
-}
-
-static 
-void
-match(void)
-{
-	static char **tokv = nil;
-	static int tokn = 0;
-
-	char buf[sizeof text], *s;
-	int i, tokc = 0;
-	size_t len, textsize;
-	struct item *item, *lprefix, *lsubstr, *prefixend, *substrend;
-
-	strcpy(buf, text);
-	/* separate input text into tokens to be matched individually */
-	for (s = strtok(buf, " "); s; tokv[tokc - 1] = s, s = strtok(nil, " "))
-		if (++tokc > tokn && !(tokv = realloc(tokv, ++tokn * sizeof *tokv)))
-			fatal("cannot realloc %u bytes:", tokn * sizeof *tokv);
-	len = tokc ? strlen(tokv[0]) : 0;
-
-	matches = lprefix = lsubstr = matchend = prefixend = substrend = nil;
-	textsize = strlen(text) + 1;
-	for (item = items; item && item->text; item++) {
-		for (i = 0; i < tokc; i++)
-			if (!fstrstr(item->text, tokv[i]))
-				break;
-		if (i != tokc) /* not all tokens match */
-			continue;
-		/* exact matches go first, then prefixes, then substrings */
-		if (!tokc || !fstrncmp(text, item->text, textsize))
-			appenditem(item, &matches, &matchend);
-		else if (!fstrncmp(tokv[0], item->text, len))
-			appenditem(item, &lprefix, &prefixend);
-		else
-			appenditem(item, &lsubstr, &substrend);
-	}
-	if (lprefix) {
-		if (matches) {
-			matchend->right = lprefix;
-			lprefix->left = matchend;
-		} else
-			matches = lprefix;
-		matchend = prefixend;
-	}
-	if (lsubstr) {
-		if (matches) {
-			matchend->right = lsubstr;
-			lsubstr->left = matchend;
-		} else
-			matches = lsubstr;
-		matchend = substrend;
-	}
-	curr = sel = matches;
-	calcoffsets();
-}
-
-static 
-void
-insert(const char *str, ssize_t n)
-{
-	if (strlen(text) + n > sizeof text - 1)
-		return;
-	/* move existing text out of the way, insert new text, and update cursor */
-	memmove(&text[cursor + n], &text[cursor], sizeof text - cursor - MAX(n, 0));
-	if (n > 0)
-		memcpy(&text[cursor], str, n);
-	cursor += n;
-	match();
-}
-
-static 
-size_t
-nextrune(int inc)
-{
-	ssize_t n;
-
-	/* return location of next utf8 rune in the given direction (+1 or -1) */
-	for (n = cursor + inc; n + inc >= 0 && (text[n] & 0xc0) == 0x80; n += inc)
-		;
-	return n;
-}
-
-static 
-void
-movewordedge(int dir)
-{
-	if (dir < 0) { /* move cursor to the start of the word*/
-		while (cursor > 0 && strchr(worddelimiters, text[nextrune(-1)]))
-			cursor = nextrune(-1);
-		while (cursor > 0 && !strchr(worddelimiters, text[nextrune(-1)]))
-			cursor = nextrune(-1);
-	} else { /* move cursor to the end of the word */
-		while (text[cursor] && strchr(worddelimiters, text[cursor]))
-			cursor = nextrune(+1);
-		while (text[cursor] && !strchr(worddelimiters, text[cursor]))
-			cursor = nextrune(+1);
-	}
-}
-
-static 
-void
-keypress(XKeyEvent *ev)
-{
-	char buf[32];
-	int len;
-	KeySym ksym;
-	Status status;
-
-	len = XmbLookupString(xic, ev, buf, sizeof buf, &ksym, &status);
-	switch (status) {
-	default: /* XLookupNone, XBufferOverflow */
-		return;
-	case XLookupChars:
-		goto insert;
-	case XLookupKeySym:
-	case XLookupBoth:
-		break;
-	}
-
-	if (ev->state & ControlMask) {
-		switch(ksym) {
-		case XK_a: ksym = XK_Home;      break;
-		case XK_b: ksym = XK_Left;      break;
-		case XK_c: ksym = XK_Escape;    break;
-		case XK_d: ksym = XK_Delete;    break;
-		case XK_e: ksym = XK_End;       break;
-		case XK_f: ksym = XK_Right;     break;
-		case XK_g: ksym = XK_Escape;    break;
-		case XK_h: ksym = XK_BackSpace; break;
-		case XK_i: ksym = XK_Tab;       break;
-		case XK_j: /* fallthrough */
-		case XK_J: /* fallthrough */
-		case XK_m: /* fallthrough */
-		case XK_M: ksym = XK_Return; ev->state &= ~ControlMask; break;
-		case XK_n: ksym = XK_Down;      break;
-		case XK_p: ksym = XK_Up;        break;
-
-		case XK_k: /* delete right */
-			text[cursor] = '\0';
-			match();
-			break;
-		case XK_u: /* delete left */
-			insert(nil, 0 - cursor);
-			break;
-		case XK_w: /* delete word */
-			while (cursor > 0 && strchr(worddelimiters, text[nextrune(-1)]))
-				insert(nil, nextrune(-1) - cursor);
-			while (cursor > 0 && !strchr(worddelimiters, text[nextrune(-1)]))
-				insert(nil, nextrune(-1) - cursor);
-			break;
-		case XK_y: /* paste selection */
-		case XK_Y:
-			XConvertSelection(dpy, (ev->state & ShiftMask) ? clip : XA_PRIMARY,
-			                  utf8, utf8, win, CurrentTime);
-			return;
-		case XK_Left:
-			movewordedge(-1);
-			goto draw;
-		case XK_Right:
-			movewordedge(+1);
-			goto draw;
-		case XK_Return:
-		case XK_KP_Enter:
-			break;
-		case XK_bracketleft:
-			cleanup();
-			exit(1);
-		default:
-			return;
-		}
-	} else if (ev->state & Mod1Mask) {
-		switch(ksym) {
-		case XK_b:
-			movewordedge(-1);
-			goto draw;
-		case XK_f:
-			movewordedge(+1);
-			goto draw;
-		case XK_g: ksym = XK_Home;  break;
-		case XK_G: ksym = XK_End;   break;
-		case XK_h: ksym = XK_Up;    break;
-		case XK_j: ksym = XK_Next;  break;
-		case XK_k: ksym = XK_Prior; break;
-		case XK_l: ksym = XK_Down;  break;
-		default:
-			return;
-		}
-	}
-
-	switch(ksym) {
-	default:
-insert:
-		if (!iscntrl(*buf))
-			insert(buf, len);
-		break;
-	case XK_Delete:
-		if (text[cursor] == '\0')
-			return;
-		cursor = nextrune(+1);
-		/* fallthrough */
-	case XK_BackSpace:
-		if (cursor == 0)
-			return;
-		insert(nil, nextrune(-1) - cursor);
-		break;
-	case XK_End:
-		if (text[cursor] != '\0') {
-			cursor = strlen(text);
-			break;
-		}
-		if (next) {
-			/* jump to end of list and position items in reverse */
-			curr = matchend;
-			calcoffsets();
-			curr = prev;
-			calcoffsets();
-			while (next && (curr = curr->right))
-				calcoffsets();
-		}
-		sel = matchend;
-		break;
-	case XK_Escape:
-		cleanup();
-		exit(1);
-	case XK_Home:
-		if (sel == matches) {
-			cursor = 0;
-			break;
-		}
-		sel = curr = matches;
-		calcoffsets();
-		break;
-	case XK_Left:
-		if (cursor > 0 && (!sel || !sel->left || lines > 0)) {
-			cursor = nextrune(-1);
-			break;
-		}
-		if (lines > 0)
-			return;
-		/* fallthrough */
-	case XK_Up:
-		if (sel && sel->left && (sel = sel->left)->right == curr) {
-			curr = prev;
-			calcoffsets();
-		}
-		break;
-	case XK_Next:
-		if (!next)
-			return;
-		sel = curr = next;
-		calcoffsets();
-		break;
-	case XK_Prior:
-		if (!prev)
-			return;
-		sel = curr = prev;
-		calcoffsets();
-		break;
-	case XK_Return:
-	case XK_KP_Enter:
-		puts((sel && !(ev->state & ShiftMask)) ? sel->text : text);
-		if (!(ev->state & ControlMask)) {
-			cleanup();
-			exit(0);
-		}
-		if (sel)
-			sel->out = 1;
-		break;
-	case XK_Right:
-		if (text[cursor] != '\0') {
-			cursor = nextrune(+1);
-			break;
-		}
-		if (lines > 0)
-			return;
-		/* fallthrough */
-	case XK_Down:
-		if (sel && sel->right && (sel = sel->right) == next) {
-			curr = next;
-			calcoffsets();
-		}
-		break;
-	case XK_Tab:
-		if (!sel)
-			return;
-		strncpy(text, sel->text, sizeof text - 1);
-		text[sizeof text - 1] = '\0';
-		cursor = strlen(text);
-		match();
-		break;
-	}
-
-draw:
-	drawmenu();
-}
-
-static 
-void
-paste(void)
-{
-	char *p, *q;
-	int di;
-	unsigned long dl;
-	Atom da;
-
-	/* we have been given the current selection, now insert it into input */
-	if (XGetWindowProperty(dpy, win, utf8, 0, (sizeof text / 4) + 1, False,
-	                   utf8, &da, &di, &dl, &dl, (unsigned char **)&p)
-	    == Success && p) {
-		insert(p, (q = strchr(p, '\n')) ? q - p : (ssize_t)strlen(p));
-		XFree(p);
-	}
-	drawmenu();
-}
-
-static
-void
-readstdin(void)
-{
-	char buf[sizeof text], *p;
-	size_t i, imax = 0, size = 0;
-	uint tmpmax = 0;
-    if(passwd){
-        inputw = lines = 0;
-        return;
-    }
-
-	/* read each line from stdin and add it to the item list */
-	for (i = 0; fgets(buf, sizeof buf, stdin); i++) {
-		if (i + 1 >= size / sizeof *items)
-			if (!(items = realloc(items, (size += BUFSIZ))))
-				fatal("cannot realloc %u bytes:", size);
-		if ((p = strchr(buf, '\n')))
-			*p = '\0';
-		if (!(items[i].text = strdup(buf)))
-			fatal("cannot strdup %u bytes:", strlen(buf) + 1);
-		items[i].out = 0;
-		drw_font_getexts(drw->fonts, buf, strlen(buf), &tmpmax, nil);
-		if (tmpmax > inputw) {
-			inputw = tmpmax;
-			imax = i;
-		}
-	}
-	if (items)
-		items[i].text = nil;
-	inputw = items ? TEXTW(items[imax].text) : 0;
-	lines = MIN(lines, i);
-}
-
-static 
-void
-run(void)
-{
-	XEvent ev;
-
-	while (!XNextEvent(dpy, &ev)) {
-		if (XFilterEvent(&ev, win))
-			continue;
-		switch(ev.type) {
-		case DestroyNotify:
-			if (ev.xdestroywindow.window != win)
-				break;
-			cleanup();
-			exit(1);
-		case Expose:
-			if (ev.xexpose.count == 0)
-				drw_map(drw, win, 0, 0, mw, mh);
-			break;
-		case FocusIn:
-			/* regrab focus from parent window */
-			if (ev.xfocus.window != win)
-				grabfocus();
-			break;
-		case KeyPress:
-			keypress(&ev.xkey);
-			break;
-		case SelectionNotify:
-			if (ev.xselection.property == utf8)
-				paste();
-			break;
-		case VisibilityNotify:
-			if (ev.xvisibility.state != VisibilityUnobscured)
-				XRaiseWindow(dpy, win);
-			break;
-		}
-	}
-}
-
-static 
-void
-setup(void)
-{
-	int x, y, i, j;
-	uint du;
-	XSetWindowAttributes swa;
-	XIM xim;
-	Window w, dw, *dws;
-	XWindowAttributes wa;
-	XClassHint ch = {"menu", "menu"};
-	XineramaScreenInfo *info;
-	Window pw;
-	int a, di, n, area = 0;
-
-	/* init appearance */
-	for (j = 0; j < SchemeLast; j++)
-		scheme[j] = drw_scm_create(drw, colors[j], 2);
-
-	clip = XInternAtom(dpy, "CLIPBOARD",   False);
-	utf8 = XInternAtom(dpy, "UTF8_STRING", False);
-
-	/* calculate menu geometry */
-	bh = drw->fonts->h + 2;
-	lines = MAX(lines, 0);
-	mh = (lines + 1) * bh;
-	i = 0;
-	if (parentwin == root && (info = XineramaQueryScreens(dpy, &n))) {
-		XGetInputFocus(dpy, &w, &di);
-		if (mon >= 0 && mon < n)
-			i = mon;
-		else if (w != root && w != PointerRoot && w != None) {
-			/* find top-level window containing current input focus */
-			do {
-				if (XQueryTree(dpy, (pw = w), &dw, &w, &dws, &du) && dws)
-					XFree(dws);
-			} while (w != root && w != pw);
-			/* find xinerama screen with which the window intersects most */
-			if (XGetWindowAttributes(dpy, pw, &wa))
-				for (j = 0; j < n; j++)
-					if ((a = INTERSECT(wa.x, wa.y, wa.width, wa.height, info[j])) > area) {
-						area = a;
-						i = j;
-					}
-		}
-		/* no focused window is on screen, so use pointer location instead */
-		if (mon < 0 && !area && XQueryPointer(dpy, root, &dw, &dw, &x, &y, &di, &di, &du))
-			for (i = 0; i < n; i++)
-				if (INTERSECT(x, y, 1, 1, info[i]))
-					break;
-
-		x = info[i].x_org;
-		y = info[i].y_org + (topbar ? 0 : info[i].height - mh);
-		mw = info[i].width;
-		XFree(info);
-	} else
-	{
-		if (!XGetWindowAttributes(dpy, parentwin, &wa))
-			fatal("could not get embedding window attributes: 0x%lx",
-			    parentwin);
-		x = 0;
-		y = topbar ? 0 : wa.height - mh;
-		mw = wa.width;
-	}
-	promptw = (prompt && *prompt) ? TEXTW(prompt) - lrpad / 4 : 0;
-	inputw = MIN(inputw, mw/3);
-	match();
-
-	/* create menu window */
-	swa.override_redirect = True;
-	swa.background_pixel = scheme[SchemeNorm][ColBg].pixel;
-	swa.event_mask = ExposureMask | KeyPressMask | VisibilityChangeMask;
-	win = XCreateWindow(dpy, parentwin, x, y, mw, mh, 0,
-	                    CopyFromParent, CopyFromParent, CopyFromParent,
-	                    CWOverrideRedirect | CWBackPixel | CWEventMask, &swa);
-	XSetClassHint(dpy, win, &ch);
-
-
-	/* input methods */
-	if ((xim = XOpenIM(dpy, nil, nil, nil)) == nil)
-		fatal("XOpenIM failed: could not open input device");
-
-	xic = XCreateIC(xim, XNInputStyle, XIMPreeditNothing | XIMStatusNothing,
-	                XNClientWindow, win, XNFocusWindow, win, nil);
-
-	XMapRaised(dpy, win);
-	if (embed) {
-		XSelectInput(dpy, parentwin, FocusChangeMask | SubstructureNotifyMask);
-		if (XQueryTree(dpy, parentwin, &dw, &w, &dws, &du) && dws) {
-			for (i = 0; i < du && dws[i] != win; ++i)
-				XSelectInput(dpy, dws[i], FocusChangeMask);
-			XFree(dws);
-		}
-		grabfocus();
-	}
-	drw_resize(drw, mw, mh);
-	drawmenu();
-}
-
-static 
-void
-usage(void)
-{
-	fputs("usage: menu [-bfivP] [-l lines] [-p prompt] [-fn font] [-m monitor]\n"
-	      "             [-nb color] [-nf color] [-sb color] [-sf color] [-w windowid]\n", stderr);
-	exit(1);
-}
-
-int
-main(int argc, char *argv[])
-{
-	XWindowAttributes wa;
-	int i, fast = 0;
-
-	for (i = 1; i < argc; i++)
-		/* these options take no arguments */
-		if (!strcmp(argv[i], "-v")) {      /* prints version information */
-			puts("menu-"VERSION);
-			exit(0);
-		} else if (!strcmp(argv[i], "-b")) /* appears at the bottom of the screen */
-			topbar = 0;
-		else if (!strcmp(argv[i], "-f"))   /* grabs keyboard before reading stdin */
-			fast = 1;
-		else if (!strcmp(argv[i], "-i")) { /* case-insensitive item matching */
-			fstrncmp = strncasecmp;
-			fstrstr = cistrstr;
-        } else if (!strcmp(argv[i], "-P")) {
-            passwd = 1;
-		} else if (i + 1 == argc)
-			usage();
-		/* these options take one argument */
-		else if (!strcmp(argv[i], "-l"))   /* number of lines in vertical list */
-			lines = atoi(argv[++i]);
-		else if (!strcmp(argv[i], "-m"))
-			mon = atoi(argv[++i]);
-		else if (!strcmp(argv[i], "-p"))   /* adds prompt to left of input field */
-			prompt = argv[++i];
-		else if (!strcmp(argv[i], "-fn"))  /* font or font set */
-			fonts[0] = argv[++i];
-		else if (!strcmp(argv[i], "-nb"))  /* normal background color */
-			colors[SchemeNorm][ColBg] = argv[++i];
-		else if (!strcmp(argv[i], "-nf"))  /* normal foreground color */
-			colors[SchemeNorm][ColFg] = argv[++i];
-		else if (!strcmp(argv[i], "-sb"))  /* selected background color */
-			colors[SchemeSel][ColBg] = argv[++i];
-		else if (!strcmp(argv[i], "-sf"))  /* selected foreground color */
-			colors[SchemeSel][ColFg] = argv[++i];
-		else if (!strcmp(argv[i], "-w"))   /* embedding window id */
-			embed = argv[++i];
-		else
-			usage();
-
-	if (!setlocale(LC_CTYPE, "") || !XSupportsLocale())
-		fputs("warning: no locale support\n", stderr);
-	if (!(dpy = XOpenDisplay(nil)))
-		fatal("cannot open display");
-	screen = DefaultScreen(dpy);
-	root = RootWindow(dpy, screen);
-	if (!embed || !(parentwin = strtol(embed, nil, 0)))
-		parentwin = root;
-	if (!XGetWindowAttributes(dpy, parentwin, &wa))
-		fatal("could not get embedding window attributes: 0x%lx",
-		    parentwin);
-	drw = drw_create(dpy, screen, root, wa.width, wa.height);
-	if (!drw_fontset_create(drw, fonts, arrlen(fonts)))
-		fatal("no fonts could be loaded.");
-	lrpad = drw->fonts->h;
-
-#ifdef __OpenBSD__
-	if (pledge("stdio rpath", nil) == -1)
-		fatal("pledge");
-#endif
-
-	if (fast && !isatty(0)) {
-		grabkeyboard();
-		readstdin();
-	} else {
-		readstdin();
-		grabkeyboard();
-	}
-	setup();
-	run();
-
-	return 1; /* unreachable */
-}
diff --git a/sys/cmd/menu/menu.h b/sys/cmd/menu/menu.h
deleted file mode 100644
index f4345bb..0000000
--- a/sys/cmd/menu/menu.h
+++ /dev/null
@@ -1,40 +0,0 @@
-/* See LICENSE file for copyright and license details. */
-#include <u.h>
-#include <base.h>
-#include <libutf.h>
-
-#include <time.h>
-#include <locale.h>
-
-#include <X11/Xlib.h>
-#include <X11/Xatom.h>
-#include <X11/Xutil.h>
-#include <X11/extensions/Xinerama.h>
-#include <X11/Xft/Xft.h>
-
-#include "drw.h"
-
-/* macros */
-#define INTERSECT(x,y,w,h,r)  (MAX(0, MIN((x)+(w),(r).x_org+(r).width)  - MAX((x),(r).x_org)) \
-                             * MAX(0, MIN((y)+(h),(r).y_org+(r).height) - MAX((y),(r).y_org)))
-#define TEXTW(X)              (drw_fontset_getwidth(drw, (X)) + lrpad)
-#define BETWEEN(X, A, B)      ((A) <= (X) && (X) <= (B))
-
-
-/* enums */
-enum { 
-    SchemeNorm, 
-    SchemeSel, 
-    SchemeOut, 
-    SchemeLast 
-}; /* color schemes */
-
-struct item {
-	char *text;
-	struct item *left, *right;
-	int out;
-};
-
-/* util.c */
-void  fatal(const char *fmt, ...);
-void *ecalloc(size_t nmemb, size_t size);
diff --git a/sys/cmd/menu/rules.mk b/sys/cmd/menu/rules.mk
deleted file mode 100644
index 1ee3ab0..0000000
--- a/sys/cmd/menu/rules.mk
+++ /dev/null
@@ -1,25 +0,0 @@
-include share/push.mk
-# Iterate through subdirectory tree
-
-# Local sources
-SRCS_$(d) := 	\
-	$(d)/menu.c \
-	$(d)/drw.c  \
-	$(d)/util.c
-
-BINS_$(d) := $(d)/menu
-
-include share/paths.mk
-
-# Local rules
-include share/dynamic.mk
-$(BINS_$(d)): TCLIBS = \
-	-lfontconfig -lXft -lXinerama -lX11 
-$(BINS_$(d)): TCINCS = \
-	`$(PKG) --cflags fontconfig` \
-	`$(PKG) --cflags freetype2`
-	
-$(BINS_$(d)): $(OBJS_$(d)) $(OBJ_DIR)/sys/base/base.a
-	$(COMPLINK)
-
-include share/pop.mk
diff --git a/sys/cmd/menu/util.c b/sys/cmd/menu/util.c
deleted file mode 100644
index 14bfe1c..0000000
--- a/sys/cmd/menu/util.c
+++ /dev/null
@@ -1,30 +0,0 @@
-/* See LICENSE file for copyright and license details. */
-#include "menu.h"
-
-void *
-ecalloc(size_t nmemb, size_t size)
-{
-	void *p;
-
-	if (!(p = calloc(nmemb, size)))
-		fatal("calloc:");
-	return p;
-}
-
-void
-fatal(const char *fmt, ...) {
-	va_list ap;
-
-	va_start(ap, fmt);
-	vfprintf(stderr, fmt, ap);
-	va_end(ap);
-
-	if (fmt[0] && fmt[strlen(fmt)-1] == ':') {
-		fputc(' ', stderr);
-		perror(NULL);
-	} else {
-		fputc('\n', stderr);
-	}
-
-	exit(1);
-}
diff --git a/sys/cmd/rc/code.c b/sys/cmd/rc/code.c
deleted file mode 100644
index 786f284..0000000
--- a/sys/cmd/rc/code.c
+++ /dev/null
@@ -1,277 +0,0 @@
-#include "rc.h"
-#include "parse.h"
-#include "exec.h"
-
-// -----------------------------------------------------------------------
-// types
-
-struct Interpreter
-{
-    int i, cap;
-    Code  *code;
-};
-
-Code *compiled = nil;
-static struct Interpreter interpreter;
-#define emiti(x) ((void)(interpreter.i != interpreter.cap || grow()), interpreter.code[interpreter.i].i = (x), interpreter.i++)
-#define emitf(x) ((void)(interpreter.i != interpreter.cap || grow()), interpreter.code[interpreter.i].f = (x), interpreter.i++)
-#define emits(x) ((void)(interpreter.i != interpreter.cap || grow()), interpreter.code[interpreter.i].s = (x), interpreter.i++)
-
-static
-int
-grow(void)
-{
-    interpreter.cap += 100;
-    interpreter.code = erealloc(interpreter.code, sizeof(*interpreter.code)*interpreter.cap);
-    memset(interpreter.code+interpreter.cap-100, 0, 100*sizeof(*interpreter.code));
-
-    return 0;
-}
-
-static
-void
-storepc(int a)
-{
-    if(interpreter.i <= a || a < 0)
-        fatal("bad address %d in interpreter", a);
-
-    interpreter.code[a].i = interpreter.i;
-}
-
-static
-void
-walk(Tree *node)
-{
-    Tree *n;
-    int addr1, addr2;
-
-    if(!node)
-        return;
-
-    switch(node->type){
-    default:
-        print(shell.err, "bad type %d in interpreter walk\n", node->type);
-        fatal("crashing\n");
-        break;
-
-    case '$':
-        emitf(Xmark);
-        walk(node->child[0]);
-        emitf(Xdollar);
-        break;
-
-    case Tcount:
-        emitf(Xmark);
-        walk(node->child[0]);
-        emitf(Xcount);
-        break;
-
-    case Tjoin:
-        emitf(Xmark);
-        walk(node->child[0]);
-        emitf(Xjoin);
-        break;
-
-    case Tindex:
-        emitf(Xmark);
-        walk(node->child[1]);
-        emitf(Xmark);
-        walk(node->child[0]);
-        emitf(Xindex);
-        break;
-
-    case ';':
-        walk(node->child[0]);
-        walk(node->child[1]);
-        break;
-
-    case '^':
-        emitf(Xmark);
-        walk(node->child[1]);
-        emitf(Xmark);
-        walk(node->child[0]);
-        emitf(Xconcatenate);
-        break;
-
-    case Tandand:
-        walk(node->child[0]);
-        emitf(Xtrue);
-        addr1 = emiti(0);
-        walk(node->child[1]);
-        storepc(addr1);
-        break;
-
-    case Toror:
-        walk(node->child[0]);
-        emitf(Xfalse);
-        addr1 = emiti(0);
-        walk(node->child[1]);
-        storepc(addr1);
-        break;
-
-    case Targs:
-        walk(node->child[1]);
-        walk(node->child[0]);
-        break;
-
-    case Tparen: case Tblock:
-        walk(node->child[0]);
-        break;
-
-    case Tbasic:
-        emitf(Xmark);
-        walk(node->child[0]);
-        emitf(Xbasic);
-        break;
-
-    case Tbang:
-        walk(node->child[0]);
-        emitf(Xbang);
-
-    case Tword:
-        emitf(Xword);
-        emits(strdup(node->str));
-        break;
-
-    case Twords:
-        walk(node->child[1]);
-        walk(node->child[0]);
-        break;
-
-    case '=':
-        for(n=node; node && node->type == '='; node = node->child[2])
-            ;
-        if(node){
-            for(node=n; node->type=='='; node = node->child[2]){
-                emitf(Xmark);
-                walk(node->child[1]);
-                emitf(Xmark);
-                walk(node->child[0]);
-                emitf(Xlocal);
-            }
-            walk(node);
-            for(node=n; node->type=='='; node = node->child[2])
-                emitf(Xunlocal);
-        }else{
-            for(node=n; node; node=node->child[2]){
-                emitf(Xmark);
-                walk(node->child[1]);
-                emitf(Xmark);
-                walk(node->child[0]);
-                emitf(Xassign);
-            }
-        }
-        node = n;
-        break;
-    /* control structures */
-    case Twhile:
-        addr1 = interpreter.i; // head of loop
-        walk(node->child[0]);
-        if(addr1 == interpreter.i)
-            fatal("TODO");
-        emitf(Xtrue);
-        addr2 = emiti(0); // goto end of loop
-
-        walk(node->child[1]);
-        emitf(Xgoto);
-        emiti(addr1);   // goto top of loop
-        storepc(addr2);
-        break;
-
-    case Tfor:
-        emitf(Xmark);
-        if(node->child[1]){ // for( x in X )
-            walk(node->child[1]);
-            // emitf(Xglob)
-        }else{              // for(X)
-            fatal("TODO");
-        }
-        emitf(Xmark); // null initial value for Xlocal
-        emitf(Xmark);
-        walk(node->child[0]);
-        emitf(Xlocal);
-
-        addr1 = emitf(Xfor);
-        addr2 = emiti(0);
-
-        walk(node->child[2]);
-        emitf(Xgoto);
-        emiti(addr1);
-        storepc(addr2);
-        emitf(Xunlocal);
-        break;
-
-    /* forks */
-    case '&':
-        emitf(Xasync);
-        addr1 = emiti(0);
-        walk(node->child[0]);
-        emitf(Xexit);
-        storepc(addr1);
-        break;
-
-    case Tsubshell:
-        emitf(Xsubshell);
-        addr1 = emiti(0);
-        walk(node->child[0]);
-        emitf(Xexit);
-        storepc(addr1);
-        break;
-
-    case Tpipe:
-        emitf(Xpipe);
-
-        emiti(node->redir.fd[0]);
-        emiti(node->redir.fd[1]);
-        addr1 = emiti(0);
-        addr2 = emiti(0);
-
-        walk(node->child[0]);
-        emitf(Xexit);
-        storepc(addr1);
-
-        walk(node->child[1]);
-        emitf(Xreturn);
-        storepc(addr2);
-
-        emitf(Xpipewait);
-
-        break;
-    }
-}
-
-// -----------------------------------------------------------------------
-// main exports
-
-void
-freecode(Code *c)
-{
-    if(--c[0].i!=0)
-        return;
-    efree(c);
-}
-
-Code *
-copycode(Code *c)
-{
-    c[0].i++;
-    return c;
-}
-
-int
-compile(Tree *node)
-{
-    flush(shell.err);
-
-    interpreter.i    = 0;
-    interpreter.code = emalloc(100*sizeof(*interpreter.code)); 
-    emiti(0); // reference count: no thread owns code yet
-
-    walk(node);
-
-    emitf(Xreturn);
-    emitf(nil);
-
-    compiled = interpreter.code;
-    return 0;
-}
diff --git a/sys/cmd/rc/exec.c b/sys/cmd/rc/exec.c
deleted file mode 100644
index 5baaf1a..0000000
--- a/sys/cmd/rc/exec.c
+++ /dev/null
@@ -1,1267 +0,0 @@
-#include "rc.h"
-#include "exec.h"
-
-#include <sys/wait.h>
-
-int yyparse(void);
-
-struct Builtin{
-	char *name;
-	void (*func)(void);
-};
-
-struct State {
-    int async;
-};
-
-static struct State state;
-
-// -----------------------------------------------------------------------
-// globals
-
-static Word nullpath = { .str="", .link=nil };
-
-struct Builtin builtin[]={
-    {"cd",    xcd},
-    {".",     xdot},
-    {"echo",  xecho},
-    {"exit",  xexit},
-    {"fg",    xfg},
-    {"jobs",  xjob},
-    0,
-};
-
-// -----------------------------------------------------------------------
-// internal
-
-/* words and lists */
-
-static
-void
-pushword(char *str)
-{
-    if(!runner->args)
-        fatal("attempt to push on empty argument stack\n");
-
-    runner->args->word = makeword(str, runner->args->word);
-}
-
-static
-void
-popword(void)
-{
-    Word *w;
-    if(!runner->args)
-        fatal("tried to pop word on empty argument stack\n");
-
-    w = runner->args->word;
-    if(!w)
-        fatal("tried to pop word but nothing there\n");
-
-    runner->args->word = w->link;
-    efree(w->str);
-    efree(w);
-}
-
-static
-Word*
-copywords(Word *a, Word *tail)
-{
-    Word *v = nil, **end;
-
-    for(end=&v; a; a = a->link,end=&(*end)->link)
-        *end = makeword(a->str, nil);
-    *end = tail;
-
-    return v;
-}
-
-static
-void
-freewords(Word *w)
-{
-    Word *n;
-    while(w){
-        efree(w->str);
-        n = w->link;
-        efree(w);
-        w = n;
-    }
-}
-
-static
-void
-freelist(Word *w)
-{
-    Word *n;
-    while(w){
-        n = w->link;
-        efree(w->str);
-        efree(w);
-        w = n;
-    }
-
-}
-
-static
-void
-pushlist(void)
-{
-    List *stack = emalloc(sizeof(*stack));
-
-    stack->word = nil;
-    stack->link = runner->args;
-
-    runner->args = stack;
-}
-
-static
-void
-poplist(void)
-{
-    List *stack = runner->args;
-    if(!stack)
-        fatal("attempted to pop an empty argument stack\n");
-
-    freelist(stack->word);
-    runner->args = stack->link;
-    efree(stack);
-}
-
-/* system interop */
-static
-Word*
-path(char *w)
-{
-    Word *path;
-
-    if(strncmp(w, "/", 1)==0
-    || strncmp(w, "./", 2)==0
-    || strncmp(w, "../", 3)==0
-    || (path = var("path")->val)==0)
-        path=&nullpath;
-
-    return path;
-}
-
-static inline
-void
-undoredirs(void)
-{
-    while(runner->redir.end != runner->redir.start)
-        Xpopredir();
-}
-
-static inline
-int
-exitsnext(void)
-{
-    Code *c = &runner->code.exe[runner->code.i];
-    while(c->f == Xpopredir)
-        c++;
-
-    return c->f == Xexit;
-}
-
-static inline
-void
-defaultsignal(void)
-{
-    signal(SIGINT,  SIG_DFL);
-    signal(SIGQUIT, SIG_DFL);
-    signal(SIGTSTP, SIG_DFL);
-    signal(SIGTTIN, SIG_DFL);
-    signal(SIGTTOU, SIG_DFL);
-    signal(SIGCHLD, SIG_DFL);
-}
-
-static inline
-void
-setpid(Thread *job, int pid)
-{
-    job->pid = pid;
-    if(job->pgid <= 0){
-        job->pgid = pid;
-        addjob(job);
-    }
-
-    setpgid(pid, job->pgid);
-}
-
-/* fork/execute helpers */
-
-static inline
-void
-initchild(Thread *job, int fg)
-{
-    int pid = getpid();
-    setpid(job, pid);
-
-    if(job->flag.user){
-        if(fg)
-            tcsetpgrp(0, job->pgid);
-        else
-            job->flag.user = 0;
-        defaultsignal();
-    }
-
-    clearwait(job);
-}
-
-static inline
-void
-initparent(Thread *job, int pid, int fg)
-{
-    setpid(job, pid);
-
-    if(job->flag.user){
-        if(!fg){
-            tcsetpgrp(0, job->pgid);
-            job->flag.user = 0;
-        }
-    }
-    addwait(job, pid);
-}
-
-static
-void
-xx(void)
-{
-    popword(); // "exec"
-    if(!runner->args->word){
-        Xerror("empty argument list");
-        return;
-    }
-
-    redirect(runner->redir.end);
-    execute(runner->args->word, path(runner->args->word->str));
-    poplist();
-}
-
-static
-int
-xforkx(void)
-{
-    int n, pid;
-
-    switch(pid=fork()){
-    case -1:
-        Xerror("try again\n");
-        return -1;
-    case 0: // child
-        initchild(runner, 1);
-
-        pushword("exec");
-        xx();
-
-        exit(2); // NOTE: unreachable: xx does not return
-    default: // parent
-        initparent(runner, pid, 0);
-
-        return pid;
-    }
-}
-
-/* redirections */
-void
-pushredir(int type, int from, int to)
-{
-    Redir *r = emalloc(sizeof(*r));
-
-    r->type = type;
-    r->from = from;
-    r->to = to;
-
-    r->link = runner->redir.end, runner->redir.end = r;
-}
-
-/* byte code */
-static
-void
-run(Code *c, int pc, Var *local, int inherit)
-{
-    Thread *new = emalloc(sizeof(*new));
-
-    new->code.i   = pc;
-    new->code.exe = copycode(c);
-
-    new->cmd.path = nil;
-    new->cmd.io   = nil;
-
-    new->args     = nil;
-    new->local    = local;
-
-    new->flag.eof  = 0;
-    if(runner){
-        new->pid       = runner->pid;
-        new->flag.user = runner->flag.user;
-        new->redir.end = new->redir.start = runner->redir.end;
-    }else{
-        new->pid       = shell.pid;
-        new->flag.user = shell.interactive;
-        new->redir.end = new->redir.start = nil;
-    }
-
-    new->wait.status = 0;
-    new->wait.len    = 0;
-    new->wait.cap    = 0;
-    new->wait.on     = nil;
-
-    new->status = 0;
-    if(inherit)
-        new->pgid = runner->pgid;
-    else
-        new->pgid = -1;
-
-    new->line     = 0;
-    new->caller   = runner;
-    new->link     = nil;
-
-    runner = new;
-}
-
-// -----------------------------------------------------------------------
-// exported builtins
-
-// XXX: find a better place for these
-Word*
-makeword(char *str, Word *link)
-{
-    Word *w = emalloc(sizeof(*w));
-
-    w->str  = strdup(str);
-    w->link = link;
-
-    return w;
-}
-
-void
-freeword(Word *word)
-{
-    Word *n;
-
-    while(word){
-        efree(word->str);
-        n = word->link;
-        efree(word);
-        word = n;
-    }
-}
-
-int
-count(Word *w)
-{
-    int n;
-    for(n = 0; w; n++)
-        w = w->link;
-    return n;
-}
-
-// -----------------------------------------------------------------------
-// builtins
-
-void
-xecho(void)
-{
-    int  fd;
-    Word *arg;
-    char *b, *s, buf[128];
-
-    fd = mapfd(1);
-    b  = buf;
-
-    popword(); // echo
-
-    // TODO: controllable flags here
-    arg = runner->args->word;
-printword:
-    s = arg->str;
-    while(*s){
-        *b++ = *s++;
-        if(b == arrend(buf)-2) // always have 2 bytes available
-            write(fd, buf, arrlen(buf)-2), b = buf;
-    }
-
-    arg = arg->link;
-    if(arg){
-        *b++ = ' ';
-        goto printword;
-    }else{
-        *b++ = '\n';
-        *b++ = 0;
-        /* fallthrough */
-    }
-    write(fd, buf, b-buf);
-
-    poplist();
-}
-
-void
-xexit(void)
-{
-    Word *arg;
-
-    popword(); // exit
-    arg = runner->args->word;
-    switch(count(arg)){
-    default:
-        print(shell.err, "invalid number of arguments to exit, exiting anyways\n");
-    case 0:
-        Xexit();
-    }
-    /* unreachable */
-}
-
-void
-xcd(void)
-{
-    Word *arg;
-    Word *cdpath;
-    char dir[512];
-
-    popword(); // cd
-
-    arg = runner->args->word;
-    switch(count(arg)){
-    default:
-        print(shell.err, "usage: cd [directory]\n");
-        break;
-    case 0:
-        arg = var("home")->val;
-        if(count(arg) >= 1){
-            if(chdir(arg->str) < 0)
-                print(shell.err, "failed cd: %s\n", strerror(errno));
-        }else{
-            print(shell.err, "ambiguous cd: $home empty\n");
-        }
-        break;
-
-    case 1:
-        // TODO: add cdpath
-        cdpath = &nullpath;
-        for(; cdpath; cdpath = cdpath->link){
-            strcpy(dir, cdpath->str);
-            if(dir[0])
-                strcat(dir,"/");
-            strcat(dir, arg->str);
-            if(chdir(dir) < 0){
-                print(shell.err, "failed cd %s: %s\n", dir, strerror(errno));
-            }
-            break;
-        }
-        break;
-    }
-
-    poplist();
-}
-
-static Code dotcmd[14] =
-{
-    [0]  = {.i = 0},
-    [1]  = {.f = Xmark},
-    [2]  = {.f = Xword},
-    [3]  = {.s = "0"},
-    [4]  = {.f =  Xlocal},
-    [5]  = {.f =  Xmark},
-    [6]  = {.f =  Xword},
-    [7]  = {.s = "*"},
-    [8]  = {.f =  Xlocal},
-    [9]  = {.f =  Xreadcmd},
-    [10] = {.f =  Xunlocal},
-    [11] = {.f =  Xunlocal},
-    [12] = {.f =  Xreturn},
-};
-
-void
-xdot(void)
-{
-    Word *p;
-    List *argv;
-    char *base;
-    int fd, iflag = 0;
-    Thread *old;
-    char file[512];
-
-    popword(); // "."
-#if 0
-    if(proc->args->word && strcmp(proc->args->word->str, "-i")==0){
-        iflag = 1;
-        popword();
-    }
-#endif
-    /* get input file */
-    if(!runner->args->word){
-        Xerror("usage: . [-i] file [arg ...]\n");
-        return;
-    }
-
-    base = strdup(runner->args->word->str);
-    popword();
-    for(fd=-1, p=path(base); p; p = p->link){
-        strcpy(file, p->str);
-
-        if(file[0])
-            strcat(file, "/");
-        strcat(file, base);
-
-        if((fd = open(file, 0))>=0)
-            break;
-    }
-
-    if(fd<0){
-        print(shell.err, "failed open: %s: ", base);
-        return;
-    }
-    /* set up for a new command loop */
-    old = runner; // store pointer to old code
-    run(dotcmd, 1, nil, 0);
-
-    /* operations on new command stack */
-    pushredir(Rclose, fd, 0);
-    runner->cmd.path = base;
-    runner->cmd.io   = openfd(fd);
-
-    /* push $* value */
-    pushlist();
-    runner->args->word = old->args->word;
-
-    /* free caller's copy of $* */
-    argv = old->args;
-    old->args = argv->link;
-    efree(argv);
-
-    /* push $0 value */
-    pushlist();
-    pushword(base);
-    //ndot++;
-}
-
-void
-xjob(void)
-{
-    int i;
-    Thread *job;
-
-    for(i=0, job = shell.jobs; job; job = job->link, i++)
-        report(job,i);
-
-    poplist();
-}
-
-void
-xfg(void)
-{
-    int     i;
-    Thread *job, *old;
-
-    popword(); // fg
-
-    /* get input job id */
-    if(!runner->args->word){
-        print(shell.err, "usage: fg [pid|\%num]\n");
-        poplist();
-        return;
-    }
-
-    i = atoi(runner->args->word->str);
-    popword(); // [pid|num]
-
-    for(job=shell.jobs; i > 0; job=job->link, --i)
-        ;
-
-    poplist(); // this goes here?
-
-    wakeup(job);
-    job->caller = runner, runner = job; // XXX: can this leave zombies?
-    foreground(job, 1);
-}
-
-void
-xboot(int argc, char *argv[])
-{
-    int i;
-    Code bootstrap[32];
-    char num[12];
-
-    i = 0;
-    bootstrap[i++].i = 1;
-    bootstrap[i++].f = Xmark;
-    bootstrap[i++].f = Xword;
-    bootstrap[i++].s="*";
-    bootstrap[i++].f = Xassign;
-    bootstrap[i++].f = Xmark;
-    bootstrap[i++].f = Xmark;
-    bootstrap[i++].f = Xword;
-    bootstrap[i++].s="*";
-    bootstrap[i++].f = Xdollar;
-    bootstrap[i++].f = Xword;
-    bootstrap[i++].s = "/dev/stdin";
-    bootstrap[i++].f = Xword;
-    bootstrap[i++].s=".";
-    bootstrap[i++].f = Xbasic;
-    bootstrap[i++].f = Xexit;
-    bootstrap[i].i = 0;
-
-    run(bootstrap, 1, nil, 0);
-    runner->pid = runner->pgid = shell.pid;
-    pushlist(); // prime bootstrap argv
-
-    argv0 = strdup(argv[0]);
-    for(i = argc-1; i > 0; --i)
-        pushword(argv[i]);
-
-    /* main interpreter loop */
-    for(;;){
-        runner->code.i++;
-        (*runner->code.exe[runner->code.i-1].f)();
-    }
-}
-
-// -----------------------------------------------------------------------
-// exported interpreter bytecode
-
-void
-Xmark(void)
-{
-    pushlist();
-}
-
-void
-Xword(void)
-{
-    pushword(runner->code.exe[runner->code.i++].s);
-}
-
-void
-Xtrue(void)
-{
-    if(!runner->status){
-        assert(runner->wait.status == Pdone);
-        runner->code.i++;
-        deljob(runner);
-        runner->pgid = -1;
-    }else
-        runner->code.i = runner->code.exe[runner->code.i].i;
-}
-
-void
-Xfalse(void)
-{
-    if(runner->status){
-        assert(runner->wait.status == Pdone);
-        runner->code.i++;
-        deljob(runner);
-        runner->pgid = -1;
-    } else
-        runner->code.i = runner->code.exe[runner->code.i].i;
-}
-
-void
-Xgoto(void)
-{
-    runner->code.i = runner->code.exe[runner->code.i].i;
-}
-
-void
-Xfor(void)
-{
-    if(!runner->args->word){
-        poplist();
-        runner->code.i = runner->code.exe[runner->code.i].i;
-    }else{
-        freelist(runner->local->val);
-
-        runner->local->val = runner->args->word;
-        runner->local->new = 1;
-        runner->args->word = runner->args->word->link;
-
-        runner->local->val->link = nil;
-        runner->code.i++;
-    }
-
-}
-
-static
-Word*
-catlist(Word *l, Word *r, Word *tail)
-{
-    Word *w;
-    char *buf;
-
-    if(l->link || r->link)
-        tail = catlist( (!l->link)?l:l->link, (!r->link)?r:r->link, tail);
-
-    buf = emalloc(strlen(l->str)+strlen(r->str)+1);
-    strcpy(buf, l->str);
-    strcat(buf, r->str);
-
-    w = makeword(buf, tail);
-    efree(buf);
-
-    return w;
-}
-
-void
-Xconcatenate(void)
-{
-    int rn, ln;
-    Word *l = runner->args->word;
-    Word *r = runner->args->link->word;
-    Word *w = runner->args->link->link->word;
-
-    ln = count(l), rn = count(r);
-    if(ln != 0 || rn != 0) {
-        if(ln == 0 || rn == 0){
-            Xerror("null list in concatenation\n");
-            return;
-        }
-        if(ln != 1 && rn != 1 && ln != rn) {
-            Xerror("mismatched list lengths in concatenation\n");
-            return;
-        }
-        w = catlist(l, r, w);
-    }
-
-    poplist();
-    poplist();
-    runner->args->word = w;
-}
-
-void
-Xdollar(void)
-{
-    int n;
-    char *s, *t;
-    Word *a, *star;
-
-    if(count(runner->args->word)!=1){
-        Xerror("variable name not singleton!\n");
-        return;
-    }
-    s = runner->args->word->str;
-    // deglob(s);
-    n = 0;
-
-    for(t = s;'0'<=*t && *t<='9';t++) 
-        n = n*10+*t-'0';
-
-    a = runner->args->link->word;
-
-    if(n==0 || *t)
-        a = copywords(var(s)->val, a);
-    else{
-        star = var("*")->val;
-        if(star && 1<=n && n<=count(star)){
-            while(--n)
-                star = star->link;
-
-            a = makeword(star->str, a);
-        }
-    }
-
-    poplist();
-    runner->args->word = a;
-}
-
-static
-Word*
-cpwords(Word *array, Word *tail, int n)
-{
-    Word *cp, **end;
-
-    cp = nil, end = &cp;
-    while(n-- > 0){
-        *end = makeword(array->str, nil);
-        end = &(*end)->link;
-        array = array->link;
-    }
-    *end = tail;
-
-    return cp;
-}
-
-
-static
-Word*
-getindex(Word *array, int len, Word *index, Word *tail)
-{
-    char *s;
-    int n, m;
-    if(!index)
-        return tail;
-
-    tail = getindex(array, len, index->link, tail);
-
-    s = index->str;
-    //deglob(s)
-
-    m = 0, n = 0;
-    while('0' <= *s && *s <= '9')
-        n = 10*n + (*s++ - '0');
-    if(*s == '-'){
-        if(*++s == 0)
-            m = len - n;
-        else{
-            while('0' <= *s && *s <= '9')
-                m = 10*m + (*s++ - '0');
-            m -= n;
-        }
-    }
-
-    if(n<1 || n > len || m < 0)
-        return tail;
-    if(n+m > len)
-        m = len-n;
-    while(--n > 0)
-        array = array->link;
-    return cpwords(array, tail, m+1);
-}
-
-void
-Xindex(void)
-{
-    char *s;
-    Word *val, *ret;
-
-    if(count(runner->args->word) != 1){
-        Xerror("variable name not a singleton");
-        return;
-    }
-    s = runner->args->word->str;
-    //deglob(s)
-    val = var(s)->val;
-    poplist();
-
-    ret = runner->args->link->word; // pointer to next stack frame
-    ret = getindex(val, count(val), runner->args->word, ret);
-    poplist();
-
-    // push result back on stack
-    runner->args->word = ret;
-}
-
-void
-Xjoin(void)
-{
-    int  n;
-    char *s;
-    Word *arg, *elt;
-
-    if(count(runner->args->word) != 1){
-        Xerror("variable name is not singleton\n");
-        return;
-    }
-
-    s = runner->args->word->str;
-    // deglob(s)
-
-    arg = var(s)->val;
-    poplist();
-
-    n = count(arg);
-    if(n==0){
-        pushword("");
-        return;
-    }
-
-    for(elt = arg; elt; elt=elt->link)
-        n += strlen(elt->str);
-
-    s = emalloc(n);
-    if(arg){
-        strcpy(s, arg->str);
-        for(elt = arg->link; elt; elt = elt->link){
-            strcat(s, " ");
-            strcat(s, elt->str);
-        }
-    }else
-        s[0] = 0;
-
-    pushword(s);
-    efree(s);
-}
-
-void
-Xassign(void)
-{
-    Var *v;
-
-    if(count(runner->args->word)!=1){
-        Xerror("variable name not singleton!\n");
-        return;
-    }
-    //deglob(runq->argv->words->word);
-    v = var(runner->args->word->str);
-    poplist();
-
-    //globlist();
-    freewords(v->val);
-    v->val = runner->args->word;
-    v->new = 1;
-    if(v->update)
-        v->update(v);
-
-    runner->args->word = nil;
-    poplist();
-}
-
-void
-Xreadcmd(void)
-{
-    Thread *root;
-    Word *prompt;
-
-    flush(shell.err);
-    root = runner;
-
-    resetprompt();
-
-    if(yyparse()){
-        // resource cleanup?
-        if(runner->flag.eof)
-            Xreturn();
-        else
-            --root->code.i;
-    }else{
-        --root->code.i;    /* re-execute Xreadcmd after codebuf runs */
-        run(compiled, 1, root->local, 0);
-    }
-
-    killzombies();
-    freeparsetree();
-}
-
-void
-Xlocal(void)
-{
-    if(count(runner->args->word)!=1){
-        Xerror("variable name must be singleton\n");
-        return;
-    }
-    //deglob(shell->args->word->str);
-
-    runner->local      = makevar(strdup(runner->args->word->str), runner->local);
-    runner->local->val = copywords(runner->args->link->word, nil);
-    runner->local->new = 1;
-
-    poplist();
-    poplist();
-}
-
-void
-Xunlocal(void)
-{
-    Var *v = runner->local, *hide;
-    if(!v)
-        fatal("Xunlocal: no locals!\n", 0);
-
-    runner->local = v->link;
-    hide = var(v->name);
-    hide->new = 1;
-
-    efree(v->name);
-    freewords(v->val);
-    efree(v);
-}
-
-void
-Xasync(void)
-{
-    int pid;
-    /*
-    int null = open("/dev/null", 0);
-    if(!null){
-        Xerror("can not open /dev/null\n");
-        return;
-    }
-    */
-
-    switch(pid=fork()){
-    case -1:
-        // close(null);
-        Xerror("fork failed: try again");
-        break;
-
-    case 0: // child in background
-        initchild(runner,0);
-        /* pushredir(Ropen, null, 0); */
-
-        run(runner->code.exe, runner->code.i+1, runner->local, 0);
-        runner->caller = nil;
-        runner->flag.user = 0;
-        break;
-
-    default: // parent in foreground
-        initparent(runner,pid,1);
-        // close(null);
-
-        runner->code.i = runner->code.exe[runner->code.i].i; /* jump to end of async command */
-        /* don't wait: continue running */
-    }
-}
-
-void
-Xsubshell(void)
-{
-    int pid, user;
-
-    user = runner->flag.user;
-    switch(pid=fork()){
-    case -1:
-        Xerror("fork failed: try again");
-        break;
-
-    case 0: // child
-        initchild(runner, 1);
-        run(runner->code.exe, runner->code.i+1, runner->local, 1);
-        runner->caller = nil;
-        break;
-
-    default: // parent
-        initparent(runner, pid, 0); // relinquish control
-        waitfor(runner, pid);       // wait until child finishes
-        if(user){
-            tcsetpgrp(0, shell.pid);
-            runner->flag.user = 1;  // take control
-        }
-
-        runner->code.i = runner->code.exe[runner->code.i].i; // jump to end of subshell command and continue execution
-    }
-}
-
-void
-Xpipewait(void)
-{
-    foreground(runner, 0);
-}
-
-void
-Xpipe(void)
-{
-    Thread *orig;
-    int pc, pid, lfd, rfd, pfd[2];
-
-    orig = runner;
-    pc   = orig->code.i;
-    lfd  = orig->code.exe[pc++].i;
-    rfd =  orig->code.exe[pc++].i;
-
-    if(pipe(pfd)<0){
-        Xerror("can't get pipe\n");
-        return;
-    }
-
-    switch(pid=fork()){
-    case -1:
-        Xerror("try again");
-        break;
-    case 0:  // child
-        initchild(runner,1);
-
-        /* child 0 (writer) forked process */
-        run(runner->code.exe, pc+2, runner->local, 1);
-        runner->caller = nil;
-
-        close(pfd[0]);
-        pushredir(Ropen, pfd[1], lfd);
-        break;
-
-    default: // parent
-        initparent(runner,pid,0);
-
-        /* child 1 (reader) subprocess*/
-        run(runner->code.exe, runner->code.exe[pc].i, runner->local, 1);
-
-        close(pfd[1]);
-        pushredir(Ropen, pfd[0], rfd);
-
-        orig->code.i = orig->code.exe[pc+1].i;
-        break;
-    }
-}
-
-void
-Xbasic(void)
-{
-    Var  *v;
-    Word *arg;
-    int pid, status;
-    struct Builtin *b;
-
-    arg = runner->args->word;
-    if(!arg){
-        Xerror("empty argument list\n");
-        return;
-    }
-
-    v = var(arg->str);
-    if(v->func){
-        return;
-    }
-
-    // see if it matches a builtin
-    for(b = builtin; b->name; b++){
-        if(strcmp(b->name, arg->str)==0){
-            b->func();
-            return;
-        }
-    }
-
-    /* if we are here then it's an external command */
-    if(exitsnext()){ // if we exit immediately, no need to fork
-        pushword("exec");
-        xx();
-        Xexit();
-    }
-
-    // run the external command
-    if((pid = xforkx()) < 0) {
-        Xerror("try again");
-        return;
-    }
-
-    poplist();
-    foreground(runner, 0); // waits for child
-}
-
-void
-Xcount(void)
-{
-    Word *arg;
-    char *str, num[12];
-
-    if(count(runner->args->word) != 1){
-        Xerror("variable name not a singleton\n");
-        return;
-    }
-
-    str = runner->args->word->str;
-    arg = var(str)->val;
-    poplist();
-
-    itoa(num, count(arg));
-    pushword(num);
-}
-
-void
-Xflat(void)
-{
-    int   len;
-    char *str;
-    Word *arg, *a;
-
-    if(count(runner->args->word)!=1){
-        Xerror("variable name is not a singleton\n");
-        return;
-    }
-
-    str = runner->args->word->str;
-    arg = var(str)->val;
-    poplist();
-
-    len = count(arg);
-    if(!len){
-        pushword("");
-        return;
-    }
-
-    for(a=arg; a; a=a->link)
-        len += strlen(a->str);
-
-    str = emalloc(len);
-    if(arg){
-        strcpy(str, arg->str);
-        for(a = arg->link; a; a = a->link){
-            strcat(str," ");
-            strcat(str,a->str);
-        }
-    }else
-        str[0] = 0;
-
-    pushword(str);
-    efree(str);
-}
-
-void
-Xbang(void)
-{
-    if(runner->status)
-        runner->status = 0;
-    else
-        runner->status = 1;
-}
-
-void
-Xpopredir(void)
-{
-    Redir *r = runner->redir.end;
-    if(!r)
-        fatal("attempted to pop a nil redir\n");
-
-    runner->redir.end = runner->redir.end->link;
-    if(r->type==Ropen)
-        close(r->from);
-
-    efree(r);
-}
-
-void
-Xreturn(void)
-{
-    Thread *curr = runner;
-
-    switch(curr->wait.status){
-    /*
-     * If our job is still running or suspended we must:
-     * 1. move program one step back to rerun Xreturn upon recall
-     * 2. return to our calling thread
-     * 3. don't free!
-     */
-     case Prun:
-         report(curr, 0);
-         curr->flag.user = 0;
-     case Pstop:
-        curr->code.i--;
-        runner = curr->caller;
-        curr->caller = nil; // detach job
-        return;
-    /*
-     * If our job has finished:
-     * 1. remove from our list
-     * 2. continue to clean up its memory
-     */
-    case Pdone:
-        deljob(curr);
-        /* fallthrough */
-    default:
-        ;
-    }
-
-    undoredirs();
-
-    while(curr->args)
-        poplist();
-    freecode(curr->code.exe);
-    efree(curr->wait.on);
-
-    runner = curr->caller;
-    efree(curr);
-    if(!runner)
-        exit(0);
-}
-
-void
-Xexit(void)
-{
-    exit(runner->status);
-}
-
-void
-Xerror(char *msg)
-{
-    print(shell.err, "rc: %s", msg);
-    flush(shell.err);
-    while(!runner->flag.user)
-        Xreturn();
-}
-
diff --git a/sys/cmd/rc/exec.h b/sys/cmd/rc/exec.h
deleted file mode 100644
index a3a6ae9..0000000
--- a/sys/cmd/rc/exec.h
+++ /dev/null
@@ -1,47 +0,0 @@
-#pragma once
-
-/*
- * opcode routines
- * arguments on stack (...)
- * arguments in line [...]
- * code in line with jump around {...}
- */
-
-void Xmark(void);           // Xmark            marks stack location for word
-void Xindex(void);          // Xindex
-void Xlocal(void);          // Xlocal(name,val) create local variable, assign value
-void Xunlocal(void);        // Xunlocal         delete local variable
-void Xdollar(void);         // Xdollar(name)    get value of name
-void Xtrue(void);           // Xtrue{...}       execute {} if true
-void Xfalse(void);          // Xfalse{...}      execute {} if false
-void Xgoto(void);           // Xgoto[addr]      goto address
-void Xfor(void);            // Xfor(var, list){... Xreturn}
-void Xreadcmd(void);        //
-void Xassign(void);
-void Xbang(void);
-void Xasync(void);
-void Xbasic(void);          // Xbasic(args) run command and wait for result
-void Xsubshell(void);
-void Xword(void);
-void Xjoin(void);
-void Xconcatenate(void);
-void Xcount(void);
-void Xflat(void);
-void Xpipe(void);
-void Xpipewait(void);
-void Xpopredir(void);
-
-void Xreturn(void);
-void Xexit(void);
-
-void Xerror(char*);
-
-/* builtin commands */
-void xcd(void);
-void xdot(void);
-void xecho(void);
-void xexit(void);
-void xfg(void);
-void xjob(void);
-
-void xboot(int argc, char *argv[]);
diff --git a/sys/cmd/rc/input.c b/sys/cmd/rc/input.c
deleted file mode 100644
index cc2383d..0000000
--- a/sys/cmd/rc/input.c
+++ /dev/null
@@ -1,1679 +0,0 @@
-#include "rc.h"

-

-#include <termios.h>

-#include <sys/ioctl.h>

-

-/* don't change order of these without modifying matrix */

-enum

-{

-    NonPrintable,

-    Alnum,

-    Punctuation,

-    Space

-};

-

-static int ascii[256] =

-{

-    0, 0, 0, 0, 0, 0, 0, 0, 0, 3, 3, 3, 3, 3, 0, 0,

-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,

-    3, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2,

-    1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2,

-    2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1,

-    1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 1,

-    2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1,

-    1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 0,

-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,

-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,

-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,

-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,

-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,

-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,

-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,

-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,

-};

-

-struct Mode

-{

-    ushort raw       : 1;

-    ushort multiline : 1;

-    ushort mask      : 1;

-    ushort defer     : 1;

-    struct {

-        ushort on : 1;

-        ushort insert : 1;

-    } vi ;

-};

-

-/*

- * the structure represents the state during line editing.

- * we pass this state to functions implementing specific editing functionalities

- */

-struct TerminalState

-{

-    int ifd;            /* terminal stdin file descriptor. */

-    int ofd;            /* terminal stdout file descriptor. */

-

-    struct{

-        char *s;        /* raw UTF-8 bytes */

-        int len;        /* number of bytes in prompt */

-        int size;       /* number of (printed) runes in prompt */

-    } prompt;

-

-    struct{

-        intptr cap;     /* capacity of edit buffer */

-        intptr len;     /* current number of bytes stored */

-        intptr pos;     /* position within edit buffer */

-        char *buf;

-    } edit;             /* edit buffer */

-

-    struct{

-        intptr cap;     /* number of columns in terminal */

-        intptr len;     /* current edited line length (in runes) */

-        intptr pos;     /* current cursor position (in runes) */

-        intptr old;     /* previous refresh cursor position (in runes) */

-    } cursor;

-

-    struct{

-        intptr cap;

-        intptr len;

-        char *buf;

-    } yank;             /* yank buffer */

-

-    intptr maxrows;     /* maximum num of rows used so far (multiline mode) */

-    intptr history;     /* index of history we are currently editing */

-};

-

-/*

- * line history (circular buffer)

- */

-struct History

-{

-    char **bot, **top, *entry[1024];

-};

-

-/* globals */

-static struct Mode    mode;

-static struct History history;

-static struct termios originalterm;

-

-enum

-{

-    KeyNil       = 0,           /* nil */

-    KeyCtrlA     = 1,           /* Ctrl+a */

-    KeyCtrlB     = 2,           /* Ctrl-b */

-    KeyCtrlC     = 3,           /* Ctrl-c */

-    KeyCtrlD     = 4,           /* Ctrl-d */

-    KeyCtrlE     = 5,           /* Ctrl-e */

-    KeyCtrlF     = 6,           /* Ctrl-f */

-    KeyCtrlH     = 8,           /* Ctrl-h */

-    KeyTab       = 9,           /* Tab */

-    KeyCtrlK     = 11,          /* Ctrl+k */

-    KeyCtrlL     = 12,          /* Ctrl+l */

-    KeyEnter     = 13,          /* Enter */

-    KeyCtrlN     = 14,          /* Ctrl-n */

-    KeyCtrlP     = 16,          /* Ctrl-p */

-    KeyCtrlT     = 20,          /* Ctrl-t */

-    KeyCtrlU     = 21,          /* Ctrl+u */

-    KeyCtrlW     = 23,          /* Ctrl+w */

-    KeyEsc       = 27,          /* Escape */

-    KeyBackspace = 127          /* Backspace */

-};

-

-static void doatexit(void);

-

-/* vi operations */

-typedef struct

-{

-    intptr buffer;

-    intptr cursor;

-} Position;

-

-typedef Position (*Noun)(struct TerminalState*, int);

-typedef void     (*Verb)(struct TerminalState*, Position);

-

-static

-int

-runetype(rune r)

-{

-    if(r<128)

-        return ascii[r];

-    if(utf8·isspace(r))

-        return Space;

-    if(utf8·isdigit(r) || utf8·isalpha(r))

-        return Alnum;

-    if(utf8·ispunct(r))

-        return Punctuation;

-

-    return NonPrintable;

-}

-

-static

-void

-normalcursor(int fd)

-{

-    write(fd,"\e[2 q",5);

-}

-

-static

-void

-insertcursor(int fd)

-{

-    write(fd,"\e[6 q",5);

-}

-

-/* raw mode: 1960 magic shit. */

-static

-int

-enterraw(int fd) 

-{

-    struct termios raw;

-

-    if(!shell.interactive)

-        goto fatal;

-

-    if(!mode.defer){

-        atexit(doatexit);

-        mode.defer = 1;

-    }

-    if(tcgetattr(fd,&originalterm) == -1) 

-        goto fatal;

-

-    raw = originalterm;  /* modify the original mode */

-

-    /* input modes: no break, no CR to NL, no parity check, no strip char,

-     * no start/stop output control. */

-    raw.c_iflag &= ~(BRKINT | ICRNL | INPCK | ISTRIP | IXON);

-    /* output modes - disable post processing */

-    raw.c_oflag &= ~(OPOST);

-    /* control modes - set 8 bit chars */

-    raw.c_cflag |= (CS8);

-    /* local modes - choing off, canonical off, no extended functions,

-     * no signal chars (^Z,^C) */

-    raw.c_lflag &= ~(ECHO | ICANON | IEXTEN | ISIG);

-    /* control chars - set return condition: min number of bytes and timer.

-     * We want read to return every single byte, without timeout. */

-    raw.c_cc[VMIN] = 1; raw.c_cc[VTIME] = 0; /* 1 byte, no timer */

-

-    /* put terminal in raw mode after flushing */

-    if(tcsetattr(fd,TCSAFLUSH,&raw) < 0)

-        goto fatal;

-

-    mode.raw = 1;

-    return 1;

-

-fatal:

-    errno = ENOTTY;

-    return 0;

-}

-

-static

-void

-exitraw(int fd)

-{

-    /* don't even check the return value as it's too late. */

-    if(mode.raw && tcsetattr(fd,TCSAFLUSH,&originalterm) != -1)

-        mode.raw = 0;

-}

-

-/* use the esc [6n escape sequence to query the horizontal cursor position

- * and return it. on error -1 is returned, on success the position of the

- * cursor. */

-static

-int

-cursorposition(int ifd, int ofd)

-{

-    char buf[32];

-    int cols, rows;

-    unsigned int i = 0;

-

-    /* Report cursor location */

-    if(write(ofd, "\x1b[6n", 4) != 4)

-        return -1;

-

-    /* Read the response: ESC [ rows ; cols R */

-    while(i < sizeof(buf)-1) {

-        if(read(ifd,buf+i,1) != 1) 

-            break;

-        if(buf[i] == 'R')

-            break;

-        i++;

-    }

-    buf[i] = '\0';

-

-    /* Parse it. */

-    if(buf[0] != KeyEsc || buf[1] != '[')

-        return -1;

-    if(sscanf(buf+2,"%d;%d",&rows,&cols) != 2)

-        return -1;

-

-    return cols;

-}

-

-/* try to get the number of columns in the current terminal, or assume 80 if it fails. */

-static

-int

-columns(int ifd, int ofd)

-{

-    struct winsize ws;

-

-    if(ioctl(1, TIOCGWINSZ, &ws) == -1 || ws.ws_col == 0){

-        /* ioctl() failed. Try to query the terminal itself. */

-        int start, cols;

-

-        /* Get the initial position so we can restore it later. */

-        start = cursorposition(ifd,ofd);

-        if(start == -1)

-            goto failed;

-

-        /* Go to right margin and get position. */

-        if(write(ofd,"\x1b[999C",6) != 6)

-            goto failed;

-        cols = cursorposition(ifd,ofd);

-        if(cols == -1)

-            goto failed;

-

-        /* Restore position. */

-        if(cols > start){

-            char esc[32];

-            snprintf(esc,32,"\x1b[%dD",cols-start);

-            if(write(ofd,esc,strlen(esc)) == -1)

-                ;

-        }

-        return cols;

-    }else

-        return ws.ws_col;

-

-failed:

-    return 80;

-}

-

-static

-void

-clear(void)

-{

-    if(write(1,"\x1b[H\x1b[2J",7) <= 0)

-        ;

-}

-

-/* beep: used for completion when there is nothing to complete or when all

- * the choices were already shown. */

-static

-void

-beep(void)

-{

-    fprintf(stderr, "\x7");

-    fflush(stderr);

-}

-

-// -----------------------------------------------------------------------

-// command history

-

-void

-inithistory(void)

-{

-    history.bot = history.top = history.entry;

-}

-

-int

-addhistory(char *line)

-{

-    char *copy;

-

-    copy = strdup(line);

-    if(!copy)

-        return 0;

-

-    *history.top++ = copy;

-    if(history.top == arrend(history.entry))

-        history.top = history.entry;

-

-    if(history.top == history.bot){

-        efree(history.bot);

-        history.bot++;

-    }

-

-    return 1;

-}

-

-static

-void

-pophistory(void)

-{

-    if(--history.top < history.entry)

-        history.top = arrend(history.entry)-1;

-    efree(*history.top);

-}

-

-static void refreshline(struct TerminalState *);

-

-static

-char **

-currenthistory(struct TerminalState *term, intptr *size)

-{

-    char **entry;

-    intptr len, head;

-

-    if(history.top > history.bot){

-        len   = history.top - history.bot;

-        entry = history.top - term->history - 1;

-    }else if(history.top < history.bot){

-        len = (arrend(history.entry) - history.bot) + (history.top - history.entry);

-        if((head=history.top - history.entry) < term->history)

-            entry = arrend(history.entry) - head;

-        else

-            entry = history.top - term->history - 1;

-    }else

-        return nil;

-

-    *size = len;

-    return entry;

-}

-

-static

-void

-usehistory(struct TerminalState *term, int d)

-{

-    rune r;

-    intptr w, len;

-    char *b, *e, **entry;

-

-    if(!(entry = currenthistory(term, &len)))

-        return;

-

-    efree(*entry);

-    *entry = strdup(term->edit.buf);

-

-    term->history += d;

-    if(term->history < 0){

-        term->history = 0;

-        return;

-    }else if(term->history >= len){

-        term->history = len - 1;

-        return;

-    }

-    entry = currenthistory(term, &len);

-

-    strncpy(term->edit.buf, *entry, term->edit.cap);

-    term->edit.buf[term->edit.cap-1] = 0;

-

-    /* update cursor/buffer positions */

-    term->edit.len = term->edit.pos = strlen(term->edit.buf);

-    for(w=0, b=term->edit.buf, e=term->edit.buf+term->edit.len; b < e; ){

-        b += utf8·decode(b, &r);

-        w += utf8·runewidth(r);

-    }

-    term->cursor.len = term->cursor.pos = w;

-

-    refreshline(term);

-}

-

-// -----------------------------------------------------------------------

-// line editing

-

-/*

- * we define a very simple "append buffer" structure, that is an heap

- * allocated string where we can append to. this is useful in order to

- * write all the escape sequences in a buffer and flush them to the standard

- * output in a single call, to avoid flickering effects.

- */

-

-struct Buffer

-{

-    int len;

-    char *b;

-};

-

-static

-void

-initbuffer(struct Buffer *ab)

-{

-    ab->b = nil;

-    ab->len = 0;

-}

-

-static

-void

-append(struct Buffer *ab, const char *s, int len)

-{

-    char *new = realloc(ab->b,ab->len+len);

-

-    if (new == nil) return;

-    memcpy(new+ab->len,s,len);

-    ab->b = new;

-    ab->len += len;

-}

-

-static

-void

-freebuffer(struct Buffer *ab)

-{

-    free(ab->b);

-}

-

-/* single line low level line refresh.

- *

- * rewrite the currently edited line accordingly to the buffer content,

- * cursor position, and number of columns of the terminal. */

-static

-void

-refreshsingleline(struct TerminalState *term)

-{

-    char esc[64];

-    struct Buffer ab;

-

-    int    n, w;

-    rune   r;

-    int    fd    = term->ofd;

-    intptr off   = term->prompt.size;

-    char   *buf  = term->edit.buf;

-    intptr len   = term->edit.len;

-    intptr pos   = term->cursor.pos;

-    intptr col   = term->cursor.len;

-

-    while((off+pos) >= term->cursor.cap){

-        n = utf8·decode(buf, &r);

-        w = utf8·runewidth(r);

-

-        buf+=n, len-=n;

-        pos-=w, col-=w;

-    }

-

-    assert(buf <= term->edit.buf + len);

-

-    while(off+col > term->cursor.cap){

-        n = utf8·decodeprev(buf+len-1, &r);

-        w = utf8·runewidth(r);

-

-        len-=n, col-=w;

-    }

-    assert(len >= 0);

-

-    initbuffer(&ab); // TODO: do we need so much malloc pressure?

-

-    /* move cursor to left edge */

-    snprintf(esc,64,"\r");

-    append(&ab,"\r",1);

-

-    /* write the prompt and the current buffer content */

-    append(&ab, term->prompt.s, term->prompt.len);

-

-    if(mode.mask == 1)

-        while(len--)

-            append(&ab,"*",1);

-    else

-        append(&ab,buf,len);

-

-    snprintf(esc,64,"\x1b[0K"); // erase to right

-    append(&ab,esc,strlen(esc));

-

-    snprintf(esc,64,"\r\x1b[%dC", (int)(off+pos)); // move cursor to original position

-    append(&ab,esc,strlen(esc));

-

-    if(write(fd,ab.b,ab.len) == -1) /* can't recover from write error. */

-        ;

-

-    freebuffer(&ab);

-}

-

-/* multi line low level line refresh.

- *

- * Rewrite the currently edited line accordingly to the buffer content,

- * cursor position, and number of columns of the terminal. */

-static

-void

-refreshmultilines(struct TerminalState *term)

-{

-#if 0

-    char esc[64];

-    int plen = term->plen;

-    int rows = (plen+term->len+term->cols-1)/term->cols; /* rows used by current buf. */

-    int rpos = (plen+term->oldpos+term->cols)/term->cols; /* cursor relative row. */

-    int rpos2; /* rpos after refresh. */

-    int col; /* colum position, zero-based. */

-    int i;

-    int old_rows = term->maxrows;

-    int fd = term->ofd, j;

-    struct Buffer ab;

-

-    /* Update maxrows if needed. */

-    if(rows > (int)term->maxrows)

-        term->maxrows = rows;

-

-    /* First step: clear all the lines used before. To do so start by

-     * going to the last row. */

-    initbuffer(&ab);

-    if(old_rows-rpos > 0){

-        snprintf(esc,64,"\x1b[%dB", old_rows-rpos);

-        append(&ab,esc,strlen(esc));

-    }

-

-    /* Now for every row clear it, go up. */

-    for(j = 0; j < old_rows-1; j++){

-        snprintf(esc,64,"\r\x1b[0K\x1b[1A");

-        append(&ab,esc,strlen(esc));

-    }

-

-    /* clean the top line. */

-    snprintf(esc,64,"\r\x1b[0K");

-    append(&ab,esc,strlen(esc));

-

-    /* Write the prompt and the current buffer content */

-    append(&ab,term->prompt,strlen(term->prompt));

-    if(mode.mask == 1){

-        for(i = 0; i < term->len; i++) append(&ab,"*",1);

-    }else

-        append(&ab,term->buf,term->len);

-

-    /* If we are at the very end of the screen with our prompt, we need to

-     * emit a newline and move the prompt to the first column. */

-    if(term->pos && term->pos == term->len && (term->pos+plen) % term->cols == 0) {

-        append(&ab,"\n",1);

-        snprintf(esc,64,"\r");

-        append(&ab,esc,strlen(esc));

-        rows++;

-        if(rows > (int)term->maxrows)

-            term->maxrows = rows;

-    }

-

-    /* Move cursor to right position. */

-    rpos2 = (plen+term->pos+term->cols)/term->cols; /* current cursor relative row. */

-

-    /* Go up till we reach the expected positon. */

-    if(rows-rpos2 > 0){

-        snprintf(esc,64,"\x1b[%dA", rows-rpos2);

-        append(&ab,esc,strlen(esc));

-    }

-

-    /* Set column. */

-    col = (plen+(int)term->pos) % (int)term->cols;

-    if(col)

-        snprintf(esc,64,"\r\x1b[%dC", col);

-    else

-        snprintf(esc,64,"\r");

-    append(&ab,esc,strlen(esc));

-

-    term->oldpos = term->pos;

-

-    if(write(fd,ab.b,ab.len) == -1) /* Can't recover from write error. */

-        ;

-

-    freebuffer(&ab);

-#endif

-}

-

-/* Calls the two low level functions refreshSingleLine() or

- * refreshMultiLine() according to the selected mode. */

-static

-void

-refreshline(struct TerminalState *term)

-{

-    if(mode.multiline)

-        refreshmultilines(term);

-    else

-        refreshsingleline(term);

-}

-

-/* insert the rune 'c' at cursor current position.

- * on error writing to the terminal -1 is returned, otherwise 0. */

-int

-insertrune(struct TerminalState *term, int n, char *c)

-{

-    int  w;

-    rune r;

-

-    utf8·decode(c, &r);

-    w = utf8·runewidth(r);

-

-    if(term->edit.len + n <= term->edit.cap){

-        if(term->edit.pos == term->edit.len){

-            memcpy(term->edit.buf+term->edit.pos, c, n);

-

-            term->edit.pos   += n, term->edit.len   += n;

-            term->cursor.pos += w, term->cursor.len += w;

-

-            term->edit.buf[term->edit.len] = '\0';

-

-            if(!mode.multiline && ((term->prompt.size+term->cursor.pos+n) <= term->cursor.cap)){

-                if(mode.mask){

-                    c = "*";

-                    n = 1;

-                }

-                if(write(term->ofd, c, n) == -1)

-                    return 0;

-            }

-            refreshline(term);

-        }else{

-            memmove(term->edit.buf+term->edit.pos+n, term->edit.buf+term->edit.pos, term->edit.len-term->edit.pos);

-            memcpy(term->edit.buf+term->edit.pos, c, n);

-

-            term->edit.pos   += n,   term->edit.len   += n;

-            term->cursor.pos += w,   term->cursor.len += w;

-

-            term->edit.buf[term->edit.len] = '\0';

-            refreshline(term);

-        }

-    }

-

-    return 1;

-}

-

-int

-insertbytes(struct TerminalState *term, int len, char *buf)

-{

-    int nr;

-    if(term->edit.len + len > term->edit.cap){

-        len = term->edit.cap - term->edit.len;

-        buf[len] = 0;

-    }

-    nr = utf8·len(buf);

-

-    if(term->edit.pos == term->cursor.len){

-        memcpy(term->edit.buf+term->edit.len, buf, len);

-

-        term->edit.pos   += len, term->edit.len   += len;

-        term->cursor.pos += nr,  term->cursor.len += nr;

-

-        // XXX: transfer the modeline here?

-        term->edit.buf[term->edit.len] = '\0';

-        refreshline(term);

-    }else{

-        memmove(term->edit.buf+term->edit.pos+len,term->edit.buf+term->edit.pos,term->edit.len-term->edit.pos);

-        memcpy(term->edit.buf+term->edit.pos, buf, len);

-

-        term->edit.pos   += len, term->edit.len   += len;

-        term->cursor.pos += nr,  term->cursor.len += nr;

-

-        term->edit.buf[term->edit.len] = '\0';

-        refreshline(term);

-    }

-

-    return 1;

-}

-

-// -----------------------------------------------------------------------

-// vi functionality

-

-/* modes */

-

-static

-void

-normalmode(int fd)

-{

-    mode.vi.insert = 0;

-    normalcursor(fd);

-}

-

-static

-void

-insertmode(int fd)

-{

-    mode.vi.insert = 1;

-    insertcursor(fd);

-}

-

-/* actions */

-

-static

-void

-move(struct TerminalState *term, Position to)

-{

-    if(to.buffer != term->edit.pos){

-        term->edit.pos   = to.buffer;

-        term->cursor.pos = to.cursor;

-        refreshline(term);

-    }

-}

-

-static

-void

-yank(struct TerminalState *term, Position to)

-{

-    intptr len, off;

-

-    if(to.buffer == term->edit.pos)

-        return; // noop

-

-    if(to.buffer > term->edit.pos){

-        len = to.buffer - term->edit.pos;

-        off = term->edit.pos;

-    }else{

-        len = term->edit.pos - to.buffer;

-        off = to.buffer;

-    }

-

-    if(term->yank.cap < len+1){

-        efree(term->yank.buf);

-        term->yank.cap = len+1;

-        term->yank.buf = emalloc(len+1);

-    }

-    term->yank.len = len;

-    memcpy(term->yank.buf, term->edit.buf+off, len);

-    term->yank.buf[len] = 0;

-}

-

-static

-void

-delete(struct TerminalState *term, Position to)

-{

-    intptr diff;

-

-    // delete characters in front of us (exclusive)

-    if(to.buffer > term->edit.pos){

-        diff = to.buffer - term->edit.pos;

-        memmove(term->edit.buf+term->edit.pos, term->edit.buf+to.buffer, term->edit.len-to.buffer+1);

-        term->edit.len -= diff;

-

-        diff = to.cursor - term->cursor.pos;

-        goto refresh;

-    }

-

-    // delete characters behind us

-    if(to.buffer < term->edit.pos){

-        diff = term->edit.pos - to.buffer;

-        memmove(term->edit.buf+to.buffer, term->edit.buf+term->edit.pos, term->edit.len-term->edit.pos+1);

-        term->edit.pos  = to.buffer;

-        term->edit.len -= diff;

-

-        diff = term->cursor.pos - to.cursor;

-        term->cursor.pos = to.cursor;

-        goto refresh;

-    }

-    // do nothing

-    return;

-

-refresh:

-    term->cursor.len -= diff;

-    refreshline(term);

-}

-/* movements */

-

-#define CURRENT(term) (Position){ .buffer=(term)->edit.pos, .cursor=(term)->cursor.pos };

-

-// move cursor to the left n boxes

-static

-Position

-left(struct TerminalState *term, int n)

-{

-    rune r;

-    int  w, d;

-    Position pos = CURRENT(term);

-    char *buf = term->edit.buf + term->edit.pos;

-

-    d = 0;

-    while(n > 0 && buf > term->edit.buf){

-        buf -= utf8·decodeprev(buf-1, &r);

-

-        w  = utf8·runewidth(r);

-        n -= w;

-        d += w;

-    }

-

-    pos.cursor = MAX(pos.cursor-d, 0);

-    pos.buffer = MAX(buf-term->edit.buf, 0);

-    return pos;

-}

-

-// move cursor to the right n boxes

-static

-Position

-right(struct TerminalState *term, int n)

-{

-    rune r;

-    int  w, d;

-    Position pos = CURRENT(term);

-

-    char *buf = term->edit.buf + term->edit.pos;

-    char *end = term->edit.buf + term->edit.len;

-

-    d = 0;

-    while(n > 0 && buf < end){

-        buf += utf8·decode(buf, &r);

-

-        w  = utf8·runewidth(r);

-        n -= w;

-        d += w;

-    }

-

-    pos.cursor = MIN(pos.cursor+d, term->cursor.len);

-    pos.buffer = MIN(buf-term->edit.buf, term->edit.len);

-    return pos;

-}

-

-static

-Position

-prevword(struct TerminalState *term, int n)

-{

-    rune r;

-    int c, w, b, d;

-    Position pos = CURRENT(term);

-

-    char *buf = term->edit.buf + term->edit.pos;

-

-    d = 0;

-    while(n-- > 0 && buf > term->edit.buf){

-    eatspace:

-        b = utf8·decodeprev(buf-1, &r);

-        w = utf8·runewidth(r);

-        if((c=runetype(r)) == Space){

-            buf -= b;

-            d   += w;

-

-            if(buf <= term->edit.buf)

-                break;

-

-            goto eatspace;

-        }

-

-    eatword:

-        if(runetype(r) == c){

-            buf -= b;

-            d   += w;

-

-            if(buf <= term->edit.buf)

-                break;

-

-            b = utf8·decodeprev(buf-1, &r);

-            w = utf8·runewidth(r);

-

-            goto eatword;

-        }

-    }

-

-    pos.cursor = MAX(pos.cursor-d, 0);

-    pos.buffer = MAX(buf-term->edit.buf, 0);

-    return pos;

-}

-

-static

-Position

-nextword(struct TerminalState *term, int n)

-{

-    rune r;

-    int  c, b, w, d;

-    Position pos = CURRENT(term);

-

-    char *buf = term->edit.buf + term->edit.pos;

-    char *end = term->edit.buf + term->edit.len;

-

-    d = 0;

-    while(n-- > 0 && buf < end){

-        b = utf8·decode(buf, &r);

-        w = utf8·runewidth(r);

-        c = runetype(r);

-    eatword:

-        if(runetype(r) == c){

-            buf += b;

-            d   += w;

-

-            if(buf >= end)

-                break;

-

-            b = utf8·decode(buf, &r);

-            w = utf8·runewidth(r);

-            goto eatword;

-        }

-    eatspace:

-        while((c=runetype(r)) == Space){

-            buf += b;

-            d   += w;

-

-            if(buf >= end)

-                break;

-

-            b = utf8·decode(buf, &r);

-            w = utf8·runewidth(r);

-            goto eatspace;

-        }

-    }

-

-    pos.cursor = MIN(pos.cursor+d, term->cursor.len);

-    pos.buffer = MIN(buf-term->edit.buf, term->edit.len);

-    return pos;

-}

-

-

-static

-Position

-prevWord(struct TerminalState *term, int n)

-{

-    rune r;

-    int c, w, b, d;

-    Position pos = CURRENT(term);

-

-    char *buf = term->edit.buf + term->edit.pos;

-

-    d = 0;

-    while(n-- > 0 && buf > term->edit.buf){

-    eatspace:

-        b = utf8·decodeprev(buf-1, &r);

-        w = utf8·runewidth(r);

-        if((c=runetype(r)) == Space){

-            buf -= b;

-            d   += w;

-

-            if(buf <= term->edit.buf)

-                break;

-

-            goto eatspace;

-        }

-

-    eatword:

-        if((c=runetype(r)) != Space){

-            buf -= b;

-            d   += w;

-

-            if(buf <= term->edit.buf)

-                break;

-

-            b = utf8·decodeprev(buf-1, &r);

-            w = utf8·runewidth(r);

-

-            goto eatword;

-        }

-    }

-

-    pos.cursor = MAX(pos.cursor-d, 0);

-    pos.buffer = MAX(buf-term->edit.buf, 0);

-    return pos;

-}

-

-static

-Position

-nextWord(struct TerminalState *term, int n)

-{

-    rune r;

-    int  b, w, d;

-    Position pos = CURRENT(term);

-

-    char *buf = term->edit.buf + term->edit.pos;

-    char *end = term->edit.buf + term->edit.len;

-

-    d = 0;

-    while(n-- > 0 && buf < end){

-    eatword:

-        b = utf8·decode(buf, &r);

-        w = utf8·runewidth(r);

-        if(runetype(r) != Space){

-            buf += b;

-            d   += w;

-

-            if(buf > end)

-                break;

-

-            goto eatword;

-        }

-

-    eatspace:

-        if(runetype(r) == Space){

-            buf += b;

-            d   += w;

-

-            if(buf > end)

-                break;

-

-            b = utf8·decode(buf, &r);

-            w = utf8·runewidth(r);

-

-            goto eatspace;

-        }

-    }

-

-    pos.cursor = MIN(pos.cursor+d, term->cursor.len);

-    pos.buffer = MIN(buf-term->edit.buf, term->edit.len);

-    return pos;

-}

-

-static

-Position

-nextend(struct TerminalState *term, int n)

-{

-    rune r;

-    int  c, b, w, d;

-    Position pos = CURRENT(term);

-

-    char *buf = term->edit.buf + term->edit.pos;

-    char *end = term->edit.buf + term->edit.len;

-

-    d = 0;

-    while(n-- > 0 && buf+1 < end){

-    eatspace:

-        b = utf8·decode(buf+1, &r);

-        w = utf8·runewidth(r);

-        while((c=runetype(r)) == Space){

-            buf += b;

-            d   += w;

-

-            if(buf+1 >= end)

-                break;

-

-            goto eatspace;

-        }

-    eatword:

-        if(runetype(r) == c){

-            buf += b;

-            d   += w;

-

-            if(buf+1 >= end)

-                break;

-

-            b = utf8·decode(buf+1, &r);

-            w = utf8·runewidth(r);

-            goto eatword;

-        }

-    }

-

-    pos.cursor = MIN(pos.cursor+d, term->cursor.len);

-    pos.buffer = MIN(buf-term->edit.buf, term->edit.len);

-    return pos;

-}

-

-static

-Position

-nextEnd(struct TerminalState *term, int n)

-{

-    rune r;

-    int  b, w, d;

-    Position pos = CURRENT(term);

-

-    char *buf = term->edit.buf + term->edit.pos;

-    char *end = term->edit.buf + term->edit.len;

-

-    d = 0;

-    while(n-- > 0 && buf+1 < end){

-    eatspace:

-        b = utf8·decode(buf+1, &r);

-        w = utf8·runewidth(r);

-        if(runetype(r) == Space){

-            buf += b;

-            d   += w;

-

-            if(buf+1 > end)

-                break;

-

-            goto eatspace;

-        }

-

-    eatword:

-        if(runetype(r) != Space){

-            buf += b;

-            d   += w;

-

-            if(buf+1 > end)

-                break;

-

-            b = utf8·decode(buf+1, &r);

-            w = utf8·runewidth(r);

-

-            goto eatword;

-        }

-    }

-

-    pos.cursor = MIN(pos.cursor+d, term->cursor.len);

-    pos.buffer = MIN(buf-term->edit.buf, term->edit.len);

-    return pos;

-}

-

-#define HOME(term) (Position){0}

-#define END(term)  (Position){(term)->edit.len, (term)->cursor.len}

-

-static

-int

-vi(struct TerminalState *term, char c)

-{

-    int n = 1;

-    Verb verb = move;

-

-action:

-    switch(c){

-    /* # of repeats */

-    case '1': case '2': case '3':

-    case '4': case '5': case '6':

-    case '7': case '8': case '9':

-        n = 0;

-        while('0' <= c && c <= '9'){

-            n = 10*n + (c-'0');

-            if(read(term->ifd, &c, 1)<1)

-                return -1;

-        }

-        goto action;

-

-    /* composable actions */

-    case 'l': verb(term, right(term, n));   break;

-    case 'h': verb(term, left(term, n));    break;

-    case '0': verb(term, HOME(term));       break;

-    case '$': verb(term, END(term));        break;

-    case 'b': verb(term, prevword(term,n)); break;

-    case 'B': verb(term, prevWord(term,n)); break;

-    case 'w': verb(term, nextword(term,n)); break;

-    case 'W': verb(term, nextWord(term,n)); break;

-    case 'e': verb(term, nextend(term,n));  break;

-    case 'E': verb(term, nextEnd(term,n));  break;

-

-    /* verb switches */

-    case 'd': // delete

-        verb = delete;

-        if(read(term->ifd, &c, 1)<1)

-            return -1;

-        /* special cases */

-        switch(c){

-        case 'd':

-            move(term, HOME(term));

-            delete(term, END(term));

-            return 0;

-        default:

-            goto action;

-        }

-    case 'y': // yank

-        verb = yank;

-        if(read(term->ifd, &c, 1)<1)

-            return -1;

-        /* special cases */

-        switch(c){

-        case 'y':

-            if(term->yank.cap < term->edit.len+1){

-                efree(term->yank.buf);

-                term->yank.len = term->edit.len;

-                term->yank.cap = term->edit.len+1;

-                term->yank.buf = emalloc(term->yank.cap);

-            }

-            memcpy(term->yank.buf, term->edit.buf, term->edit.len+1);

-            break;

-        default:

-            goto action;

-        }

-        break;

-

-    case 'p': // put

-        insertbytes(term, term->yank.len, term->yank.buf);

-        refreshline(term);

-        return 0;

-

-    /* special cases

-     * sadly I don't know a better way than to have these checks for move

-     * the vi language doesn't fully compose

-     */

-    case 'i': insertmode:

-        if(verb != move) goto unrecognized;

-        insertmode(term->ofd);

-        break;

-

-    case 'I':

-        if(verb != move) goto unrecognized;

-        move(term, HOME(term));

-        goto insertmode;

-

-    case 'a':

-        if(verb != move) goto unrecognized;

-        if(term->edit.pos < term->edit.len){

-            term->edit.pos++;

-            refreshline(term);

-        }

-        goto insertmode;

-

-    case 'A':

-        if(verb != move) goto unrecognized;

-        move(term, END(term));

-        goto insertmode;

-

-    case 'x':

-        if(verb != move) goto unrecognized;

-        delete(term, right(term, 1));

-        break;

-

-    case 'X':

-        if(verb != move) goto unrecognized;

-        delete(term, left(term, 1));

-        break;

-

-    case 'r':

-        if(verb != move) goto unrecognized;

-        if(read(term->ifd, &c, 1)<1)

-            return -1;

-        if(c < ' ')

-            break;

-        term->edit.buf[term->edit.pos] = c;

-        refreshline(term);

-        break;

-

-    // TODO: replace mode?

-

-    case 'c':

-        if(verb != move) goto unrecognized;

-        insertmode(term->ofd);

-        verb = delete;

-        if(read(term->ifd, &c, 1)<1)

-            return -1;

-        goto action;

-

-    case 'C':

-        if(verb != move) goto unrecognized;

-        insertmode(term->ofd);

-        goto deleteln;

-

-    case 'D':

-        if(verb != move) goto unrecognized;

-    deleteln:

-        term->edit.len = term->edit.pos;

-        term->edit.buf[term->edit.pos] = 0;

-        refreshline(term);

-        break;

-

-    default: unrecognized:

-        beep();

-        break;

-    }

-

-    return 0;

-}

-#undef END

-

-#define END(term)  (Position){(term).edit.len, (term).cursor.len}

-

-static

-int

-size(char *s)

-{

-    rune c;

-    int  n, len = 0;;

-    while((c=*s)){

-        if(c == '\033'){

-            n = 1;

-        esccode:

-            c = s[n];

-            if(!c) // we hit end of string in the middle of parsing an escape code!

-                return len;

-            if(c == 'm'){

-                s += n + 1;

-                continue; // outer loop

-            }

-            n++;

-            goto esccode;

-        }

-        n = utf8·decode(s, &c);

-        s   += n;

-        len += utf8·runewidth(c);

-    }

-    return len;

-}

-

-/* this function is the core of the line editing capability of linenoise.

- * it expects 'fd' to be already in "raw mode" so that every key pressed

- * will be returned asap to read().

- *

- * the resulting string is put into 'buf' when the user type enter, or

- * when ctrl+d is typed.

- *

- * the function returns the length of the current buffer. */

-static

-int

-interact(int ifd, int ofd, char *buf, intptr len, char *prompt)

-{

-    int  n, aux;

-    char esc[3];

-    char c[UTFmax+1] = { 0 };

-    rune r;

-

-    struct TerminalState term;

-    /*

-     * populate the state that we pass to functions implementing

-     * specific editing functionalities

-     */

-    term.ifd           = ifd;

-    term.ofd           = ofd;

-

-    term.edit.buf      = buf;

-    term.edit.cap      = len;

-    term.edit.len      = 0;

-    term.edit.pos      = 0;

-

-    term.prompt.s      = prompt;

-    term.prompt.len    = strlen(prompt);

-    term.prompt.size   = size(prompt);

-

-    term.cursor.pos    = 0;

-    term.cursor.len    = 0;

-    term.cursor.cap    = columns(ifd, ofd);

-

-    term.maxrows       = 0;

-    term.history       = 0;

-

-    term.yank.buf = nil;

-    term.yank.cap = term.yank.len = 0;

-

-    /* buffer starts empty. */

-    term.edit.buf[0] = '\0';

-    term.edit.cap--; /* make sure there is always space for the nulterm */

-

-    /* push current (empty) command onto history stack */

-    addhistory("");

-

-    if(write(term.ofd,prompt,term.prompt.len) == -1)

-        return -1;

-

-    for(;;){

-        n = read(term.ifd,c,1);

-        if(n <= 0)

-            goto finish;

-

-        /* partition input by rune */

-        if(utf8·onebyte(c[0])){

-            r = c[0];

-        }else if(utf8·twobyte(c[0])){

-            n = read(term.ifd,c+1,1);

-            if(n < 1 || (n=utf8·decode(c, &r)) != 2)

-                goto finish;

-        }else if(utf8·threebyte(c[0])){

-            n = read(term.ifd,c+1,2);

-            if(n < 2 || (n=utf8·decode(c, &r)) != 3)

-                goto finish;

-        }else if(utf8·fourbyte(c[0])){

-            n = read(term.ifd,c+1,3);

-            if(n < 3 || (n=utf8·decode(c, &r)) != 4)

-                goto finish;

-        }else

-            goto finish;

-

-        switch(r){

-        case KeyEnter:

-            pophistory();

-            if(mode.multiline)

-                move(&term, END(term));

-            goto finish;

-

-        case KeyCtrlC:

-            errno = EAGAIN;

-            return -1;

-

-        case KeyBackspace:

-        case KeyCtrlH:

-            delete(&term, left(&term, 1));

-            break;

-

-        case KeyCtrlD:

-            if(term.edit.len > 0)

-                delete(&term, right(&term, 1));

-            break;

-

-        case KeyCtrlT:

-            if(term.edit.pos > 0 && term.edit.pos < term.edit.len){

-                aux = buf[term.edit.pos-1];

-

-                buf[term.edit.pos-1] = buf[term.edit.pos];

-                buf[term.edit.pos]   = aux;

-

-                if(term.edit.pos != term.edit.len-1)

-                    term.edit.pos++;

-

-                refreshline(&term);

-            }

-            break;

-

-        case KeyCtrlB:

-            move(&term, left(&term, 1));

-            break;

-

-        case KeyCtrlF:     /* ctrl-f */

-            move(&term, right(&term, 1));

-            break;

-

-        case KeyCtrlP:    /* ctrl-p */

-            usehistory(&term, +1);

-            break;

-

-        case KeyCtrlN:    /* ctrl-n */

-            usehistory(&term, -1);

-            break;

-

-        case KeyEsc:    /* escape sequence */

-            /*

-             * try to read two bytes representing the escape sequence.

-             * if we read less than 2 and we are in vi mode, interpret as command

-             *

-             * NOTE: we could do a timed read here

-             */

-            switch(read(term.ifd,esc,2)){

-            case 0:

-                if(mode.vi.on){

-                    if(mode.vi.insert){

-                        normalmode(term.ofd);

-                        if(term.edit.pos > 0){

-                            --term.edit.pos;

-                            refreshline(&term);

-                        }

-                        continue;

-                    }

-                }

-            case 1:

-                if(mode.vi.on){

-                    if(mode.vi.insert){

-                        normalmode(term.ofd);

-                        if(vi(&term,esc[0]) < 0){

-                            term.edit.len = -1;

-                            goto finish;

-                        }

-                        continue;

-                    }

-                }

-            default: // 2

-                ;

-            }

-

-            /* ESC [ sequences. */

-            if(esc[0] == '['){

-                if(0 <= esc[1] && esc[1] <= '9'){

-                    /* extended escape, read additional byte. */

-                    if(read(term.ifd,esc+2,1) == -1)

-                        break;

-

-                    if(esc[2] == '~'){

-                        switch(esc[1]){

-                        case '3': /* delete key. */

-                            delete(&term, left(&term,1));

-                            break;

-                        }

-                    }

-                }else{

-                    switch(esc[1]) {

-                    case 'A': /* up */

-                        usehistory(&term, +1);

-                        break;

-                    case 'B': /* down */

-                        usehistory(&term, -1);

-                        break;

-                    case 'C': /* right */

-                        move(&term, right(&term, 1));

-                        break;

-                    case 'D': /* left */

-                        move(&term, left(&term, 1));

-                        break;

-                    case 'H': /* home */

-                        move(&term, HOME(term)); 

-                        break;

-                    case 'F': /* end*/

-                        move(&term, END(term));

-                        break;

-                    }

-                }

-            }

-            /* ESC O sequences. */

-            else if(esc[0] == 'O'){

-                switch(esc[1]) {

-                case 'H': /* home */

-                    move(&term, HOME(term)); 

-                    break;

-                case 'F': /* end*/

-                    move(&term, END(term));

-                    break;

-                }

-            }

-            break;

-

-        default:

-            if(mode.vi.on && !mode.vi.insert && n == 1){

-                if(vi(&term,c[0]) < 0){

-                    term.edit.len = -1;

-                    goto finish;

-                }

-            }else if(!insertrune(&term,n,c)){

-                term.edit.len = -1;

-                goto finish;

-            }

-

-            break;

-

-        case KeyCtrlU: /* Ctrl+u, delete the whole line. */

-            buf[0] = '\0';

-            term.edit.pos = term.edit.len = 0;

-            term.cursor.pos = term.cursor.len = 0;

-            refreshline(&term);

-            break;

-

-        case KeyCtrlK: /* Ctrl+k, delete from current to end of line. */

-            buf[term.edit.pos] = '\0';

-            term.edit.len = term.edit.pos;

-            term.cursor.len = term.cursor.pos;

-            refreshline(&term);

-            break;

-

-        case KeyCtrlA: /* Ctrl+a, go to the start of the line */

-            move(&term, HOME(term));

-            break;

-

-        case KeyCtrlE: /* ctrl+e, go to the end of the line */

-            move(&term, END(term));

-            break;

-

-        case KeyCtrlL: /* ctrl+term, clear screen */

-            clear();

-            refreshline(&term);

-            break;

-

-        case KeyCtrlW: /* ctrl+w, delete previous word */

-            delete(&term, prevword(&term,1));

-            break;

-        }

-    }

-finish:

-    efree(term.yank.buf);

-    return term.edit.len;

-}

-

-/*

- * this special mode is used by linenoise in order to print scan codes

- * on screen for debugging / development purposes. It is implemented

- * by the linenoise_example program using the --keycodes option. 

- */

-void

-printkeycode(void)

-{

-    int  n;

-    char c, quit[4];

-

-    printf("entering debugging mode. printing key codes.\n"

-           "press keys to see scan codes. type 'quit' at any time to exit.\n");

-

-    if(!enterraw(0))

-        return;

-

-    memset(quit,' ',4);

-

-    for(;;){

-        n = read(0,&c,1);

-        if(n <= 0)

-            continue;

-        memmove(quit,quit+1,sizeof(quit)-1); // shift string to left

-        quit[arrlen(quit)-1] = c; /* Insert current char on the right. */

-

-        if(memcmp(quit,"quit",sizeof(quit)) == 0)

-            break;

-

-        printf("'%c' %02x (%d) (type quit to exit)\n", isprint(c) ? c : '?', (int)c, (int)c);

-        printf("\r"); /* go to left edge manually, we are in raw mode. */

-        fflush(stdout);

-    }

-    exitraw(0);

-}

-

-/*

- * this function calls the line editing function edit() using the stdin set in raw mode

- */

-static

-int

-raw(char *buf, intptr len, char *prompt)

-{

-    int n;

-

-    if(!len){

-        errno = EINVAL;

-        return -1;

-    }

-

-    // XXX: should we not hardcode stdin and stdout fd?

-    if(!enterraw(0)) return -1;

-    n = interact(0, 1, buf, len, prompt);

-    exitraw(0);

-

-    return n;

-}

-

-/*

- * called when readline() is called with the standard

- * input file descriptor not attached to a TTY. For example when the

- * program is called in pipe or with a file redirected to its standard input

- * in this case, we want to be able to return the line regardless of its length

- */

-static

-int

-notty(void)

-{

-    int c;

-

-    for(;;){

-        c = fgetc(stdin);

-        put(&runner->cmd.io, c);

-    }

-}

-

-void

-enablevi(void)

-{

-    mode.vi.on = 1;

-    insertmode(1);

-}

-

-/*

- * The high level function that is the main API.

- * This function checks if the terminal has basic capabilities and later

- * either calls the line editing function or uses dummy fgets() so that

- * you will be able to type something even in the most desperate of the

- * conditions.

- */

-int

-readline(char *prompt)

-{

-    int n;

-

-    // reset the command buffer

-    runner->cmd.io->e = runner->cmd.io->b = runner->cmd.io->buf;

-

-    if(!shell.interactive)

-        return notty();

-

-    if((n = raw(runner->cmd.io->e, runner->cmd.io->cap-1, prompt)) == -1)

-        return 0;

-    runner->cmd.io->e += n;

-

-    /* insert a newline character at the end */

-    put(&runner->cmd.io, '\n');

-

-    return 1;

-}

-

-/* At exit we'll try to fix the terminal to the initial conditions. */

-static

-void

-doatexit(void)

-{

-    exitraw(0);

-    normalcursor(1);

-}

diff --git a/sys/cmd/rc/io.c b/sys/cmd/rc/io.c
deleted file mode 100644
index dc81c2e..0000000
--- a/sys/cmd/rc/io.c
+++ /dev/null
@@ -1,437 +0,0 @@
-#include "rc.h"
-#include "parse.h"
-
-#define CAP0 512
-
-Io*
-openfd(int fd)
-{
-    Io *io = emalloc(sizeof(*io) + CAP0);
-
-    io->fd  = fd;
-    io->cap = CAP0;
-    io->b   = io->e = io->buf;
-    io->s   = nil;
-
-    return io;
-}
-
-Io*
-openstr(void)
-{
-    char *s;
-    Io *io = emalloc(sizeof(*io) + CAP0);
-
-    io->fd  = -1;
-    io->cap = CAP0;
-    io->b   = io->s = emalloc(101);
-    io->e   = io->b+100;
-
-    for(s = io->b; s<=io->e; s++)
-        *s=0;
-
-    return io;
-}
-
-#if 0
-/*
- * open a corebuffer to read. EOF occurs after reading len characters from buf
- */
-
-Io*
-opencore(char *s, int len)
-{
-    Io *io = emalloc(sizeof(*io));
-    char *buf = emalloc(len);
-    io->fd = -1 /*open("/dev/null", 0)*/;
-    io->b  = io->s = buf;
-    io->e  = buf+len;
-    memcpy(buf, s, len);
-
-    return io;
-}
-#endif
-
-void
-iorewind(Io *io)
-{
-    if(io->fd==-1)
-        io->b = io->s;
-    else{
-        io->b = io->e = io->buf;
-        lseek(io->fd, 0L, 0);
-    }
-}
-
-void
-terminate(Io *io)
-{
-    if(io->fd>=0)
-        close(io->fd);
-    if(io->s)
-        efree(io->s);
-
-    efree((char *)io);
-}
-
-static
-int
-refill(Io *io)
-{
-    int n;
-
-    if(io->fd==-1 || (n = read(io->fd, io->buf, io->cap))<=0)
-        return EOF;
-
-    io->b = io->buf;
-    io->e = io->buf+n;
-
-    return *io->b++&0xff;
-}
-
-
-void
-flush(Io *io)
-{
-    int n;
-    char *s;
-
-    if(io->s){
-        n = io->e-io->s;
-        io->s = realloc(io->s, n+101);
-        if(io->s==0)
-            panicf("Can't realloc %d bytes in flush!", n+101);
-        io->b = io->s+n;
-        io->e = io->b+100;
-        for(s = io->b;s<=io->e;s++) *s='\0';
-    }else{
-        n = io->b-io->buf;
-        if(n && write(io->fd, io->buf, n) < 0)
-            write(3, "write error\n", 12);
-        io->b = io->buf;
-        io->e = io->buf + io->cap;
-    }
-}
-
-
-static
-void
-printchar(Io *io, int c)
-{
-    if(io->b==io->e)
-        flush(io);
-
-    *io->b++=c;
-}
-
-void
-printquote(Io *io, char *s)
-{
-    printchar(io, '\'');
-    for(;*s;s++)
-        if(*s=='\'')
-            print(io, "''");
-        else printchar(io, *s);
-    printchar(io, '\'');
-}
-
-void
-printstr(Io *io, char *s)
-{
-    if(s==0)
-        s="(null)";
-    while(*s) printchar(io, *s++);
-}
-
-void
-printword(Io *io, char *s)
-{
-    char *t;
-
-    for(t = s;*t;t++)
-        if(!iswordchar(*t))
-            break;
-
-    if(t==s || *t)
-        printquote(io, s);
-    else
-        printstr(io, s);
-}
-
-void
-printptr(Io *io, void *v)
-{
-    int n;
-    uintptr p;
-
-    p = (uintptr)v;
-    if(sizeof(uintptr) == sizeof(uvlong) && p>>32)
-        for(n = 60;n>=32;n-=4) printchar(io, "0123456789ABCDEF"[(p>>n)&0xF]);
-
-    for(n = 28;n>=0;n-=4) printchar(io, "0123456789ABCDEF"[(p>>n)&0xF]);
-}
-
-static
-void
-printint(Io *io, int n)
-{
-    if(n<0){
-        if(n!=INT_MIN){
-            printchar(io, '-');
-            printint(io, -n);
-            return;
-        }
-        /* n is two's complement minimum integer */
-        n = -(INT_MIN+1);
-        printchar(io, '-');
-        printint(io, n/10);
-        printchar(io, n%10+'1');
-        return;
-    }
-    if(n>9)
-        printint(io, n/10);
-    printchar(io, n%10+'0');
-}
-
-static
-void
-printoct(Io *io, unsigned n)
-{
-    if(n>7)
-        printoct(io, n>>3);
-    printchar(io, (n&7)+'0');
-}
-
-static
-void
-printval(Io *io, Word *a)
-{
-    if(a){
-        while(a->link && a->link->str){
-            printword(io, a->str);
-            printchar(io, ' ');
-            a = a->link;
-        }
-        printword(io, a->str);
-    }
-}
-
-#define C0 t->child[0]
-#define C1 t->child[1]
-#define C2 t->child[2]
-
-static
-void
-printtree(Io *io, Tree *t)
-{
-    if(!t)
-        return;
-
-    switch(t->type){
-    default: print(io, "bad(%d)[%p %p %p]", t->type, C0, C1, C2); break;
-    case '$': print(io,"$%t",C0);      break;
-    case '&': print(io,"%t&",C0);      break;
-    case '^': print(io,"%t^%t",C0,C1); break;
-    case '`': print(io,"`%t",C0);      break;
-
-    case Tbasic:    print(io, "%t", C0);    break;
-    case Tbang:     print(io, "!%t", C0);   break;
-    case Tblock:    print(io, "{%t}", C0);  break;
-    case Tcount:    print(io, "$#%t", C0);  break;
-    case Tparen:    print(io, "(%t)", C0);  break;
-    case Tjoin:     print(io,"$\"%t",C0);   break;
-    case Tindex:    print(io, "%t(%t)",C0); break;
-    case Tsubshell: print(io, "@ %t",C0);   break;
-    //case Ttwiddle:  print(io, "~ %t %t", C0, C1);  break;
-
-    case Toror:
-    case Tandand:
-
-    case Targs:
-        if(!C0)
-            print(io, "%t", C1);
-        else if(!C1)
-            print(io, "%t", C0);
-        else
-            print(io, "%t %t", C0, C1);
-        break;
-
-    case ';':
-        if(C0){
-            if(C1)
-                print(io, "%t;%t", C0, C1);
-            else
-                print(io, "%t", C0);
-        }else
-            print(io, "%t", C1);
-        break;
-
-    case Twords:
-        if(C0)
-            print(io, "%t", C0);
-        print(io, "%t", C1);
-
-    case Tword:
-        if(t->quoted)
-            print(io, "%Q", t->str);
-        print(io, "%q", t->str);
-        break;
-
-    case '=':
-        print(io, "%t=%t", C0, C1);
-        if(C2)
-            print(io, " %t", C2);
-        break;
-
-    case Tdup:
-        if(t->redir.type == Rdupfd)
-            print(io, ">[%d=%d]", t->redir.fd[1], t->redir.fd[0]);
-        else
-            print(io, ">[%d=]", t->redir.fd[0]);
-        print(io, "%t", C1);
-        break;
-
-    case Tredir:
-        switch(t->redir.type){
-        case Rhere:
-            printchar(io, '<');
-        case Rread:
-            printchar(io, '<');
-            goto readfd;
-        case Rrdwr:
-            printchar(io, '<');
-            printchar(io, '>');
-        readfd:
-            if(t->redir.fd[0]!=0)
-                print(io, "[%d]", t->redir.fd[0]);
-            break;
-        case Rappend:
-            printchar(io, '>');
-            goto writefd;
-        case Rwrite:
-            printchar(io, '>');
-            printchar(io, '>');
-        writefd:
-            if(t->redir.fd[0]!=1)
-                print(io, "[%d]", t->redir.fd[0]);
-            break;
-        }
-        print(io, "%t", C0);
-        if(C1)
-            print(io, " %t", C1);
-        break;
-
-    case Tpipe:
-        print(io, "%t|", C0);
-        if(t->redir.fd[1]==0){
-            if(t->redir.fd[0]!=1)
-                print(io, "[%d]", t->redir.fd[0]);
-        }
-        else
-            print(io, "[%d=%d]", t->redir.fd[0], t->redir.fd[1]);
-        print(io, "%t", C1);
-        break;
-    }
-}
-
-#undef C0
-#undef C1
-#undef C2
-
-// -----------------------------------------------------------------------
-// exports
-
-/* readers */
-int
-get(Io *io)
-{
-    if(io->b==io->e)
-        return refill(io);
-
-    return *io->b++ & 0xFF;
-}
-
-/* writers */
-int
-put(Io **iop, char c)
-{
-    int nb, ne, nc;
-    Io *io  = *iop;
-    char *e = io->b + io->cap;
-
-    if(io->e == e){
-        nb = io->b - io->buf;
-        ne = io->e - io->buf;
-        nc = 2*io->cap;
-
-        if(!(io = erealloc(io, sizeof(*io)+nc)))
-            return 0;
-
-        io->b   = io->buf + nb;
-        io->e   = io->buf + ne;
-        io->cap = nc;
-
-        *iop = io;
-    }
-
-    *io->e++ = c;
-    return 1;
-}
-
-/* printers */
-static int pfmtnest;
-
-void
-print(Io *io, char *fmt, ...)
-{
-    va_list args;
-    char err[ERRMAX];
-
-    va_start(args, fmt);
-    pfmtnest++;
-
-    for(;*fmt;fmt++)
-        if(*fmt!='%')
-            printchar(io, *fmt);
-        else
-            switch(*++fmt){
-            case '\0':
-                va_end(args);
-                return;
-            case 'c':
-                printchar(io, va_arg(args, int));
-                break;
-            case 'd':
-                printint(io, va_arg(args, int));
-                break;
-            case 'o':
-                printoct(io, va_arg(args, unsigned));
-                break;
-            case 'p':
-                printptr(io, va_arg(args, void*));
-                break;
-            case 'Q':
-                printquote(io, va_arg(args, char *));
-                break;
-            case 'q':
-                printword(io, va_arg(args, char *));
-                break;
-            case 's':
-                printstr(io, va_arg(args, char *));
-                break;
-            case 't':
-                printtree(io, va_arg(args, struct Tree *));
-                break;
-            case 'v':
-                printval(io, va_arg(args, struct Word *));
-                break;
-            default:
-                printchar(io, *fmt);
-                break;
-            }
-
-    va_end(args);
-
-    if(--pfmtnest==0)
-        flush(io);
-}
diff --git a/sys/cmd/rc/job.c b/sys/cmd/rc/job.c
deleted file mode 100644
index 1587951..0000000
--- a/sys/cmd/rc/job.c
+++ /dev/null
@@ -1,91 +0,0 @@
-#include "rc.h"
-
-#include <signal.h>
-#include <termios.h>
-
-// -----------------------------------------------------------------------
-// exports
-
-Thread *
-getjob(int pid, int *index)
-{
-    int i;
-    Thread *job;
-    for(i=0,job=shell.jobs; job && job->pid != pid; i++, job=job->link)
-        ;
-
-    return job;
-}
-
-void
-report(Thread *job, int index)
-{
-    switch(job->wait.status){
-        case Pdone:
-            print(shell.err, "job %d [%d]: done\n",      index, job->pid);
-            break;
-        case Pstop:
-            print(shell.err, "job %d [%d]: suspended\n", index, job->pid);
-            break;
-        case Pagain:
-            print(shell.err, "job %d [%d]: continued\n", index, job->pid);
-            break;
-        case Prun:
-            print(shell.err, "job %d [%d]: running\n",   index, job->pid);
-            break;
-        default:
-            fatal("bad wait status: %d\n", job->wait.status);
-    }
-}
-
-void
-wakeup(Thread *job)
-{
-    int i;
-    job->wait.status = Prun;
-    for(i=0; i < job->wait.len; i++){
-        if(job->wait.on[i].status == Pstop)
-            job->wait.on[i].status = Prun;
-    }
-
-    tcsetpgrp(0, job->pgid);
-}
-
-void
-foreground(Thread *job, int now)
-{
-    Thread *caller = job->caller;
-    if(now){
-        if(kill(-job->pgid, SIGCONT) < 0)
-            perror("kill[SIGCONT]");
-    }
-
-    waitall(job);
-    /*
-     * reset state if we have a caller
-     * otherwise we will exit anyways
-     */
-    if(caller && caller->flag.user){
-        tcsetpgrp(0, caller->pid);
-        job->flag.user = 1;
-    }
-}
-
-void
-addjob(Thread *job)
-{
-    job->link = shell.jobs;
-    shell.jobs = job;
-    job->wait.status = Prun;
-}
-
-void
-deljob(Thread *job)
-{
-    Thread **jp;
-
-    for(jp = &shell.jobs; *jp && *jp != job; jp = &(*jp)->link)
-        ;
-
-    *jp = job->link;
-}
diff --git a/sys/cmd/rc/lex.c b/sys/cmd/rc/lex.c
deleted file mode 100644
index 9ca2453..0000000
--- a/sys/cmd/rc/lex.c
+++ /dev/null
@@ -1,394 +0,0 @@
-#include "rc.h"
-#include "parse.h"
-
-static int advance(void);
-
-// -----------------------------------------------------------------------
-// lexer
-
-struct Lexer
-{
-    int c[2];
-    ushort doprompt;
-    ushort hadword;
-    ushort haddollar;
-    ushort inquote;
-    char buf[BUFSIZ];
-};
-
-static struct Lexer lexer = { .c={0, EOF}, .doprompt=1 };
-
-#define put1(b)        lexer.buf[0] = (b),  lexer.buf[1] = 0;
-#define put2(b0,b1)    lexer.buf[0] = (b0), lexer.buf[1] = (b1), lexer.buf[2] = 0;
-#define put3(b0,b1,b2) lexer.buf[0] = (b0), lexer.buf[1] = (b1), lexer.buf[2] = b2, lexer.buf[3] = 0;
-
-void
-yyerror(const char *msg)
-{
-    print(shell.err, "rc:%d: ", runner->line);
-
-    if(lexer.buf[0] && lexer.buf[0]!='\n')
-        print(shell.err, "%q: ", lexer.buf);
-
-    print(shell.err, "%s\n", msg);
-    flush(shell.err);
-
-    lexer.hadword   = 0;
-    lexer.haddollar = 0;
-
-    /* consume remaining tokens */
-    while(lexer.c[0] !='\n' && lexer.c[0] != EOF)
-        advance();
-}
-
-int
-readc(void)
-{
-    int c;
-    static int peek = EOF;
-
-    if(peek!=EOF){
-        c = peek;
-        peek = EOF;
-        return c;
-    }
-
-    if(runner->flag.eof)
-        return EOF;
-
-    if(!prompt(&lexer.doprompt))
-        exit(1); // XXX: hack for signal handling right now...
-
-    c = get(runner->cmd.io);
-    lexer.doprompt = lexer.doprompt || c=='\n' || c==EOF;
-
-    if(c==EOF)
-        runner->flag.eof = 1;
-
-    return c;
-}
-
-static
-int
-peekc(void)
-{
-    if(lexer.c[1] == EOF)
-        lexer.c[1] = readc();
-
-    return lexer.c[1];
-}
-
-static
-int
-advance(void)
-{
-    int c = peekc();
-    lexer.c[0] = lexer.c[1], lexer.c[1] = EOF;
-
-    return c;
-}
-
-static
-void
-skipws(void)
-{
-    int c;
-    for(;;){
-        c = peekc();
-        if(c== ' ' || c == '\t')
-            advance();
-        else
-            return;
-    }
-}
-
-static
-void
-skipnl(void)
-{
-    int c;
-    for(;;){
-        c = peekc();
-        if(c== ' ' || c == '\t' || c == '\n')
-            advance();
-        else
-            return;
-    }
-}
-
-static
-int
-nextis(int c)
-{
-    if(peekc()==c){
-        advance();
-        return 1;
-    }
-    return 0;
-}
-
-static
-char *
-putbyte(char *buf, int c)
-{
-    if(!buf)
-        return buf;
-
-    if(buf == arrend(lexer.buf)){
-        fatal("lexer: out of buffer space");
-        return nil;
-    }
-    *buf++ = c;
-    return buf;
-}
-
-static
-char *
-putrune(char *buf, int c)
-{
-    buf = putbyte(buf, c);
-    if(utf8·onebyte(c))
-        return buf;
-    if(utf8·twobyte(c))
-        return putbyte(buf,advance());
-    if(utf8·threebyte(c)){
-        buf = putbyte(buf,advance());
-        return putbyte(buf,advance());
-    }
-    if(utf8·fourbyte(c)){
-        buf = putbyte(buf,advance());
-        buf = putbyte(buf,advance());
-        return putbyte(buf,advance());
-    }
-    fatal("malformed utf8 stream");
-
-    return nil;
-}
-
-// -----------------------------------------------------------------------
-// exported functions
-
-// TODO: turn into static tables
-int
-iswordchar(int c)
-{
-    return !strchr("\n \t#;&|^$=`'{}()<>", c) && c!=EOF;
-}
-
-int
-isidentchar(int c)
-{
-	return c>' ' && !strchr("!\"#$%&'()+,-./:;<=>?@[\\]^`{|}~", c);
-}
-
-int
-yylex(void)
-{
-    int  c, d = peekc();
-    Tree *node;
-    char *w = lexer.buf;
-
-    yylval.tree = nil;
-
-    /* inject tokens */
-    if(lexer.hadword){
-        lexer.hadword = 0;
-        if(d=='('){
-            advance();
-            strcpy(lexer.buf, "( [Tindex]");
-            return Tindex;
-        }
-        if(iswordchar(d) || d=='\'' || d=='`' || d=='$' || d=='"'){
-            strcpy(lexer.buf, "^");
-            return '^';
-        }
-    }
-
-    lexer.inquote = 0;
-
-    skipws();
-    switch(c=advance()){
-    case EOF:
-        lexer.haddollar = 0;
-        put3('E','O','F');
-        return EOF;
-
-    case '$':
-        lexer.haddollar = 1;
-        if(nextis('#')){
-            put2('$','#');
-            return Tcount;
-        }
-        if(nextis('^')){
-            put2('$','^');
-            return Tjoin;
-        }
-        put1('$');
-        return '$';
-
-    case '@':
-        lexer.haddollar = 0;
-        put1('@');
-        return Tsubshell;
-
-    case '!':
-        lexer.haddollar = 0;
-        put1('!');
-        return Tbang;
-
-    case '&':
-        lexer.haddollar = 0;
-        if(nextis('&')){
-            put2('&','&');
-            return Tandand;
-        }
-        put1('&');
-        return '&';
-
-    case '|':
-        lexer.haddollar = 0;
-        if(nextis('|')){
-            put2('|','|');
-            return Toror;
-        }
-        node = maketree();
-        *w++ = '|';
-
-        node->type = Tpipe;
-        node->redir.fd[0] = 1;
-        node->redir.fd[1] = 0;
-        goto redir;
-
-    case '>':
-        lexer.haddollar = 0;
-        node = maketree();
-        *w++ = '>';
-        node->type = Tredir;
-
-        if(nextis('>')){
-            node->redir.type = Rappend;
-            *w++ = '>';
-        }else
-            node->redir.type = Rwrite;
-        node->redir.fd[0] = 1;
-        goto redir;
-
-    case '<':
-        lexer.haddollar = 0;
-        node = maketree();
-        *w++ = '<';
-        node->type = Tredir;
-
-        if(nextis('<')){
-            node->redir.type = Rhere;
-            *w++ = '<';
-        }else if(nextis('>')){
-            node->redir.type = Rrdwr;
-            *w++ = '>';
-        }else{
-            node->redir.type = Rread;
-        }
-        node->redir.fd[0] = 0;
-        /* fallthrough */
-    redir:
-        if(nextis('[')){
-            *w++='[';
-            c = advance();
-            *w++ = c;
-            if(c < '0' || '9' < c){
-            badredir:
-                *w = 0;
-                yyerror(node->type == Tpipe ? "pipe syntax" : "redirection syntax");
-                return EOF;
-            }
-            node->redir.fd[0] = 0;
-            do{
-                node->redir.fd[0] = 10*node->redir.fd[0]+(c-'0');
-                *w++ = c;
-                c = advance();
-            }while('0'<=c && c<='9');
-
-            if(c == '='){
-                *w++ = '=';
-                if(node->type==Tredir)
-                    node->type = Tdup;
-                c = advance();
-            }
-            if(c < '0' || '9' < c){
-                if(node->type == Tpipe)
-                    goto badredir;
-                node->redir.type = Rclose;
-            }else{
-                node->redir.type = Rdupfd;
-                node->redir.fd[1] = node->redir.fd[0];
-                node->redir.fd[0] = 0;
-                do{
-                    node->redir.fd[0] = 10*node->redir.fd[0]+(c-'0');
-                    *w++ = c;
-                    c = advance();
-                }while('0'<=c && c<='9');
-            }
-            if(c != ']' || (node->type == Tdup && (node->redir.type = Rhere || node->redir.type == Rappend)))
-                goto badredir;
-            *w++ = ']';
-        }
-        *w++ = 0;
-        yylval.tree = node;
-
-        return node->type;
-
-    case '\'':
-        lexer.hadword   = 1;
-        lexer.inquote   = 1;
-        lexer.haddollar = 0;
-        for(;;){
-            c = advance();
-            if(c==EOF)
-                break;
-
-            if(c=='\''){
-                if(peekc()!='\'')
-                    break;
-                advance();
-            }
-            w = putrune(w, c);
-        }
-        if(w)
-            *w = 0;
-        node = token(Tword, lexer.buf);
-        node->quoted = 1;
-        return node->type;
-
-    default:
-        ;
-    }
-    if(!iswordchar(c)){
-        put1(c);
-        lexer.haddollar = 0;
-        return c;
-    }
-
-    for(;;){
-        w = putrune(w, c);
-        c = peekc();
-        if(lexer.haddollar ? !isidentchar(c) : !iswordchar(c))
-            break;
-        advance();
-    }
-
-    lexer.hadword   = 1;
-    lexer.haddollar = 0;
-    if(w)
-        *w = 0;
-
-    node = token(Tword, lexer.buf);
-    if((c=iskeyword(lexer.buf))){
-        node->type = c;
-        lexer.hadword = 0;
-    }
-
-    node->quoted = 0;
-
-    yylval.tree = node;
-    return node->type;
-}
diff --git a/sys/cmd/rc/main.c b/sys/cmd/rc/main.c
deleted file mode 100644
index 2c0aa42..0000000
--- a/sys/cmd/rc/main.c
+++ /dev/null
@@ -1,66 +0,0 @@
-#include "rc.h"
-#include "parse.h"
-#include "exec.h"
-
-#include <signal.h>
-#include <termios.h>
-
-// -----------------------------------------------------------------------
-// globals
-
-Thread *runner = nil;
-Shell shell    = { 0 };
-
-// -----------------------------------------------------------------------
-// functions
-
-void
-initshell(void)
-{
-    if((shell.interactive=isatty(0))){
-        while(tcgetpgrp(0) != (shell.pid = getpgrp()))
-            kill(-shell.pid, SIGTTIN);
-
-        /* ignore job control signals */
-        signal(SIGINT,  SIG_IGN);
-        signal(SIGQUIT, SIG_IGN);
-        signal(SIGTSTP, SIG_IGN);
-        signal(SIGTTIN, SIG_IGN);
-        signal(SIGTTOU, SIG_IGN);
-        /* 
-         * NOTE: if SIGCHLD is set to SIG_IGN then
-         *  1. children that terminate do not become zombies
-         *  2. call a to wait() will block until all children have terminated
-         *  3. the call to wait will fail with errno == ECHILD
-         *  see for discussion:
-         *      https://stackoverflow.com/questions/1608017/no-child-process-error-from-waitpid-when-waiting-for-process-group 
-         */
-        // signal(SIGCHLD, SIG_IGN);
-
-        /* take control */
-        shell.pid = getpid();
-        if(setpgid(shell.pid, shell.pid)<0)
-            fatal("could not put shell in its own process group");
-
-        tcsetpgrp(shell.pid, shell.pid);
-    }
-}
-
-// -----------------------------------------------------------------------
-// main point of entry
-
-int
-main(int argc, char *argv[])
-{
-    shell.err = openfd(2);
-
-    initenv();
-    initpath();
-    initkeywords();
-    initshell();
-    inithistory();
-
-    enablevi();
-    xboot(argc, argv);
-    /* unreachable */
-}
diff --git a/sys/cmd/rc/parse.c b/sys/cmd/rc/parse.c
deleted file mode 100644
index 1b29d41..0000000
--- a/sys/cmd/rc/parse.c
+++ /dev/null
@@ -1,2059 +0,0 @@
-/* A Bison parser, made by GNU Bison 3.8.2.  */
-
-/* Bison implementation for Yacc-like parsers in C
-
-   Copyright (C) 1984, 1989-1990, 2000-2015, 2018-2021 Free Software Foundation,
-   Inc.
-
-   This program is free software: you can redistribute it and/or modify
-   it under the terms of the GNU General Public License as published by
-   the Free Software Foundation, either version 3 of the License, or
-   (at your option) any later version.
-
-   This program is distributed in the hope that it will be useful,
-   but WITHOUT ANY WARRANTY; without even the implied warranty of
-   MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
-   GNU General Public License for more details.
-
-   You should have received a copy of the GNU General Public License
-   along with this program.  If not, see <https://www.gnu.org/licenses/>.  */
-
-/* As a special exception, you may create a larger work that contains
-   part or all of the Bison parser skeleton and distribute that work
-   under terms of your choice, so long as that work isn't itself a
-   parser generator using the skeleton or a modified version thereof
-   as a parser skeleton.  Alternatively, if you modify or redistribute
-   the parser skeleton itself, you may (at your option) remove this
-   special exception, which will cause the skeleton and the resulting
-   Bison output files to be licensed under the GNU General Public
-   License without this special exception.
-
-   This special exception was added by the Free Software Foundation in
-   version 2.2 of Bison.  */
-
-/* C LALR(1) parser skeleton written by Richard Stallman, by
-   simplifying the original so-called "semantic" parser.  */
-
-/* DO NOT RELY ON FEATURES THAT ARE NOT DOCUMENTED in the manual,
-   especially those whose name start with YY_ or yy_.  They are
-   private implementation details that can be changed or removed.  */
-
-/* All symbols defined below should begin with yy or YY, to avoid
-   infringing on user name space.  This should be done even for local
-   variables, as they might otherwise be expanded by user macros.
-   There are some unavoidable exceptions within include files to
-   define necessary library symbols; they are noted "INFRINGES ON
-   USER NAME SPACE" below.  */
-
-/* Identify Bison output, and Bison version.  */
-#define YYBISON 30802
-
-/* Bison version string.  */
-#define YYBISON_VERSION "3.8.2"
-
-/* Skeleton name.  */
-#define YYSKELETON_NAME "yacc.c"
-
-/* Pure parsers.  */
-#define YYPURE 0
-
-/* Push parsers.  */
-#define YYPUSH 0
-
-/* Pull parsers.  */
-#define YYPULL 1
-
-
-
-
-/* First part of user prologue.  */
-#line 7 "sys/cmd/rc/syntax.y"
-
-    #include "rc.h"
-
-    int  yylex(void);
-    void yyerror(const char *);
-
-#line 78 "sys/cmd/rc/parse.c"
-
-# ifndef YY_CAST
-#  ifdef __cplusplus
-#   define YY_CAST(Type, Val) static_cast<Type> (Val)
-#   define YY_REINTERPRET_CAST(Type, Val) reinterpret_cast<Type> (Val)
-#  else
-#   define YY_CAST(Type, Val) ((Type) (Val))
-#   define YY_REINTERPRET_CAST(Type, Val) ((Type) (Val))
-#  endif
-# endif
-# ifndef YY_NULLPTR
-#  if defined __cplusplus
-#   if 201103L <= __cplusplus
-#    define YY_NULLPTR nullptr
-#   else
-#    define YY_NULLPTR 0
-#   endif
-#  else
-#   define YY_NULLPTR ((void*)0)
-#  endif
-# endif
-
-#include "parse.h"
-/* Symbol kind.  */
-enum yysymbol_kind_t
-{
-  YYSYMBOL_YYEMPTY = -2,
-  YYSYMBOL_YYEOF = 0,                      /* "end of file"  */
-  YYSYMBOL_YYerror = 1,                    /* error  */
-  YYSYMBOL_YYUNDEF = 2,                    /* "invalid token"  */
-  YYSYMBOL_Tfor = 3,                       /* Tfor  */
-  YYSYMBOL_Tin = 4,                        /* Tin  */
-  YYSYMBOL_Twhile = 5,                     /* Twhile  */
-  YYSYMBOL_Tif = 6,                        /* Tif  */
-  YYSYMBOL_Telse = 7,                      /* Telse  */
-  YYSYMBOL_Tswitch = 8,                    /* Tswitch  */
-  YYSYMBOL_Tcase = 9,                      /* Tcase  */
-  YYSYMBOL_Tcasebody = 10,                 /* Tcasebody  */
-  YYSYMBOL_Ttwiddle = 11,                  /* Ttwiddle  */
-  YYSYMBOL_Tbang = 12,                     /* Tbang  */
-  YYSYMBOL_Tsubshell = 13,                 /* Tsubshell  */
-  YYSYMBOL_Tfunc = 14,                     /* Tfunc  */
-  YYSYMBOL_Tredir = 15,                    /* Tredir  */
-  YYSYMBOL_Tdup = 16,                      /* Tdup  */
-  YYSYMBOL_Tpipe = 17,                     /* Tpipe  */
-  YYSYMBOL_Tindex = 18,                    /* Tindex  */
-  YYSYMBOL_Tbasic = 19,                    /* Tbasic  */
-  YYSYMBOL_Targs = 20,                     /* Targs  */
-  YYSYMBOL_Tword = 21,                     /* Tword  */
-  YYSYMBOL_Twords = 22,                    /* Twords  */
-  YYSYMBOL_Tparen = 23,                    /* Tparen  */
-  YYSYMBOL_Tblock = 24,                    /* Tblock  */
-  YYSYMBOL_25_ = 25,                       /* ')'  */
-  YYSYMBOL_Tandand = 26,                   /* Tandand  */
-  YYSYMBOL_Toror = 27,                     /* Toror  */
-  YYSYMBOL_28_n_ = 28,                     /* '\n'  */
-  YYSYMBOL_29_ = 29,                       /* '^'  */
-  YYSYMBOL_30_ = 30,                       /* '$'  */
-  YYSYMBOL_Tcount = 31,                    /* Tcount  */
-  YYSYMBOL_Tjoin = 32,                     /* Tjoin  */
-  YYSYMBOL_33_ = 33,                       /* '('  */
-  YYSYMBOL_34_ = 34,                       /* '{'  */
-  YYSYMBOL_35_ = 35,                       /* '}'  */
-  YYSYMBOL_36_ = 36,                       /* ';'  */
-  YYSYMBOL_37_ = 37,                       /* '&'  */
-  YYSYMBOL_38_ = 38,                       /* '='  */
-  YYSYMBOL_39_ = 39,                       /* '`'  */
-  YYSYMBOL_YYACCEPT = 40,                  /* $accept  */
-  YYSYMBOL_rc = 41,                        /* rc  */
-  YYSYMBOL_line = 42,                      /* line  */
-  YYSYMBOL_body = 43,                      /* body  */
-  YYSYMBOL_paren = 44,                     /* paren  */
-  YYSYMBOL_block = 45,                     /* block  */
-  YYSYMBOL_cmds = 46,                      /* cmds  */
-  YYSYMBOL_cmdsln = 47,                    /* cmdsln  */
-  YYSYMBOL_ifbody = 48,                    /* ifbody  */
-  YYSYMBOL_case = 49,                      /* case  */
-  YYSYMBOL_casebody = 50,                  /* casebody  */
-  YYSYMBOL_assign = 51,                    /* assign  */
-  YYSYMBOL_redir = 52,                     /* redir  */
-  YYSYMBOL_epilog = 53,                    /* epilog  */
-  YYSYMBOL_cmd = 54,                       /* cmd  */
-  YYSYMBOL_basic = 55,                     /* basic  */
-  YYSYMBOL_atom = 56,                      /* atom  */
-  YYSYMBOL_word = 57,                      /* word  */
-  YYSYMBOL_executable = 58,                /* executable  */
-  YYSYMBOL_nonkeyword = 59,                /* nonkeyword  */
-  YYSYMBOL_keyword = 60,                   /* keyword  */
-  YYSYMBOL_words = 61,                     /* words  */
-  YYSYMBOL_wordsnl = 62,                   /* wordsnl  */
-  YYSYMBOL_nl = 63                         /* nl  */
-};
-typedef enum yysymbol_kind_t yysymbol_kind_t;
-
-
-
-
-#ifdef short
-# undef short
-#endif
-
-/* On compilers that do not define __PTRDIFF_MAX__ etc., make sure
-   <limits.h> and (if available) <stdint.h> are included
-   so that the code can choose integer types of a good width.  */
-
-#ifndef __PTRDIFF_MAX__
-# include <limits.h> /* INFRINGES ON USER NAME SPACE */
-# if defined __STDC_VERSION__ && 199901 <= __STDC_VERSION__
-#  include <stdint.h> /* INFRINGES ON USER NAME SPACE */
-#  define YY_STDINT_H
-# endif
-#endif
-
-/* Narrow types that promote to a signed type and that can represent a
-   signed or unsigned integer of at least N bits.  In tables they can
-   save space and decrease cache pressure.  Promoting to a signed type
-   helps avoid bugs in integer arithmetic.  */
-
-#ifdef __INT_LEAST8_MAX__
-typedef __INT_LEAST8_TYPE__ yytype_int8;
-#elif defined YY_STDINT_H
-typedef int_least8_t yytype_int8;
-#else
-typedef signed char yytype_int8;
-#endif
-
-#ifdef __INT_LEAST16_MAX__
-typedef __INT_LEAST16_TYPE__ yytype_int16;
-#elif defined YY_STDINT_H
-typedef int_least16_t yytype_int16;
-#else
-typedef short yytype_int16;
-#endif
-
-/* Work around bug in HP-UX 11.23, which defines these macros
-   incorrectly for preprocessor constants.  This workaround can likely
-   be removed in 2023, as HPE has promised support for HP-UX 11.23
-   (aka HP-UX 11i v2) only through the end of 2022; see Table 2 of
-   <https://h20195.www2.hpe.com/V2/getpdf.aspx/4AA4-7673ENW.pdf>.  */
-#ifdef __hpux
-# undef UINT_LEAST8_MAX
-# undef UINT_LEAST16_MAX
-# define UINT_LEAST8_MAX 255
-# define UINT_LEAST16_MAX 65535
-#endif
-
-#if defined __UINT_LEAST8_MAX__ && __UINT_LEAST8_MAX__ <= __INT_MAX__
-typedef __UINT_LEAST8_TYPE__ yytype_uint8;
-#elif (!defined __UINT_LEAST8_MAX__ && defined YY_STDINT_H \
-       && UINT_LEAST8_MAX <= INT_MAX)
-typedef uint_least8_t yytype_uint8;
-#elif !defined __UINT_LEAST8_MAX__ && UCHAR_MAX <= INT_MAX
-typedef unsigned char yytype_uint8;
-#else
-typedef short yytype_uint8;
-#endif
-
-#if defined __UINT_LEAST16_MAX__ && __UINT_LEAST16_MAX__ <= __INT_MAX__
-typedef __UINT_LEAST16_TYPE__ yytype_uint16;
-#elif (!defined __UINT_LEAST16_MAX__ && defined YY_STDINT_H \
-       && UINT_LEAST16_MAX <= INT_MAX)
-typedef uint_least16_t yytype_uint16;
-#elif !defined __UINT_LEAST16_MAX__ && USHRT_MAX <= INT_MAX
-typedef unsigned short yytype_uint16;
-#else
-typedef int yytype_uint16;
-#endif
-
-#ifndef YYPTRDIFF_T
-# if defined __PTRDIFF_TYPE__ && defined __PTRDIFF_MAX__
-#  define YYPTRDIFF_T __PTRDIFF_TYPE__
-#  define YYPTRDIFF_MAXIMUM __PTRDIFF_MAX__
-# elif defined PTRDIFF_MAX
-#  ifndef ptrdiff_t
-#   include <stddef.h> /* INFRINGES ON USER NAME SPACE */
-#  endif
-#  define YYPTRDIFF_T ptrdiff_t
-#  define YYPTRDIFF_MAXIMUM PTRDIFF_MAX
-# else
-#  define YYPTRDIFF_T long
-#  define YYPTRDIFF_MAXIMUM LONG_MAX
-# endif
-#endif
-
-#ifndef YYSIZE_T
-# ifdef __SIZE_TYPE__
-#  define YYSIZE_T __SIZE_TYPE__
-# elif defined size_t
-#  define YYSIZE_T size_t
-# elif defined __STDC_VERSION__ && 199901 <= __STDC_VERSION__
-#  include <stddef.h> /* INFRINGES ON USER NAME SPACE */
-#  define YYSIZE_T size_t
-# else
-#  define YYSIZE_T unsigned
-# endif
-#endif
-
-#define YYSIZE_MAXIMUM                                  \
-  YY_CAST (YYPTRDIFF_T,                                 \
-           (YYPTRDIFF_MAXIMUM < YY_CAST (YYSIZE_T, -1)  \
-            ? YYPTRDIFF_MAXIMUM                         \
-            : YY_CAST (YYSIZE_T, -1)))
-
-#define YYSIZEOF(X) YY_CAST (YYPTRDIFF_T, sizeof (X))
-
-
-/* Stored state numbers (used for stacks). */
-typedef yytype_uint8 yy_state_t;
-
-/* State numbers in computations.  */
-typedef int yy_state_fast_t;
-
-#ifndef YY_
-# if defined YYENABLE_NLS && YYENABLE_NLS
-#  if ENABLE_NLS
-#   include <libintl.h> /* INFRINGES ON USER NAME SPACE */
-#   define YY_(Msgid) dgettext ("bison-runtime", Msgid)
-#  endif
-# endif
-# ifndef YY_
-#  define YY_(Msgid) Msgid
-# endif
-#endif
-
-
-#ifndef YY_ATTRIBUTE_PURE
-# if defined __GNUC__ && 2 < __GNUC__ + (96 <= __GNUC_MINOR__)
-#  define YY_ATTRIBUTE_PURE __attribute__ ((__pure__))
-# else
-#  define YY_ATTRIBUTE_PURE
-# endif
-#endif
-
-#ifndef YY_ATTRIBUTE_UNUSED
-# if defined __GNUC__ && 2 < __GNUC__ + (7 <= __GNUC_MINOR__)
-#  define YY_ATTRIBUTE_UNUSED __attribute__ ((__unused__))
-# else
-#  define YY_ATTRIBUTE_UNUSED
-# endif
-#endif
-
-/* Suppress unused-variable warnings by "using" E.  */
-#if ! defined lint || defined __GNUC__
-# define YY_USE(E) ((void) (E))
-#else
-# define YY_USE(E) /* empty */
-#endif
-
-/* Suppress an incorrect diagnostic about yylval being uninitialized.  */
-#if defined __GNUC__ && ! defined __ICC && 406 <= __GNUC__ * 100 + __GNUC_MINOR__
-# if __GNUC__ * 100 + __GNUC_MINOR__ < 407
-#  define YY_IGNORE_MAYBE_UNINITIALIZED_BEGIN                           \
-    _Pragma ("GCC diagnostic push")                                     \
-    _Pragma ("GCC diagnostic ignored \"-Wuninitialized\"")
-# else
-#  define YY_IGNORE_MAYBE_UNINITIALIZED_BEGIN                           \
-    _Pragma ("GCC diagnostic push")                                     \
-    _Pragma ("GCC diagnostic ignored \"-Wuninitialized\"")              \
-    _Pragma ("GCC diagnostic ignored \"-Wmaybe-uninitialized\"")
-# endif
-# define YY_IGNORE_MAYBE_UNINITIALIZED_END      \
-    _Pragma ("GCC diagnostic pop")
-#else
-# define YY_INITIAL_VALUE(Value) Value
-#endif
-#ifndef YY_IGNORE_MAYBE_UNINITIALIZED_BEGIN
-# define YY_IGNORE_MAYBE_UNINITIALIZED_BEGIN
-# define YY_IGNORE_MAYBE_UNINITIALIZED_END
-#endif
-#ifndef YY_INITIAL_VALUE
-# define YY_INITIAL_VALUE(Value) /* Nothing. */
-#endif
-
-#if defined __cplusplus && defined __GNUC__ && ! defined __ICC && 6 <= __GNUC__
-# define YY_IGNORE_USELESS_CAST_BEGIN                          \
-    _Pragma ("GCC diagnostic push")                            \
-    _Pragma ("GCC diagnostic ignored \"-Wuseless-cast\"")
-# define YY_IGNORE_USELESS_CAST_END            \
-    _Pragma ("GCC diagnostic pop")
-#endif
-#ifndef YY_IGNORE_USELESS_CAST_BEGIN
-# define YY_IGNORE_USELESS_CAST_BEGIN
-# define YY_IGNORE_USELESS_CAST_END
-#endif
-
-
-#define YY_ASSERT(E) ((void) (0 && (E)))
-
-#if 1
-
-/* The parser invokes alloca or malloc; define the necessary symbols.  */
-
-# ifdef YYSTACK_USE_ALLOCA
-#  if YYSTACK_USE_ALLOCA
-#   ifdef __GNUC__
-#    define YYSTACK_ALLOC __builtin_alloca
-#   elif defined __BUILTIN_VA_ARG_INCR
-#    include <alloca.h> /* INFRINGES ON USER NAME SPACE */
-#   elif defined _AIX
-#    define YYSTACK_ALLOC __alloca
-#   elif defined _MSC_VER
-#    include <malloc.h> /* INFRINGES ON USER NAME SPACE */
-#    define alloca _alloca
-#   else
-#    define YYSTACK_ALLOC alloca
-#    if ! defined _ALLOCA_H && ! defined EXIT_SUCCESS
-#     include <stdlib.h> /* INFRINGES ON USER NAME SPACE */
-      /* Use EXIT_SUCCESS as a witness for stdlib.h.  */
-#     ifndef EXIT_SUCCESS
-#      define EXIT_SUCCESS 0
-#     endif
-#    endif
-#   endif
-#  endif
-# endif
-
-# ifdef YYSTACK_ALLOC
-   /* Pacify GCC's 'empty if-body' warning.  */
-#  define YYSTACK_FREE(Ptr) do { /* empty */; } while (0)
-#  ifndef YYSTACK_ALLOC_MAXIMUM
-    /* The OS might guarantee only one guard page at the bottom of the stack,
-       and a page size can be as small as 4096 bytes.  So we cannot safely
-       invoke alloca (N) if N exceeds 4096.  Use a slightly smaller number
-       to allow for a few compiler-allocated temporary stack slots.  */
-#   define YYSTACK_ALLOC_MAXIMUM 4032 /* reasonable circa 2006 */
-#  endif
-# else
-#  define YYSTACK_ALLOC YYMALLOC
-#  define YYSTACK_FREE YYFREE
-#  ifndef YYSTACK_ALLOC_MAXIMUM
-#   define YYSTACK_ALLOC_MAXIMUM YYSIZE_MAXIMUM
-#  endif
-#  if (defined __cplusplus && ! defined EXIT_SUCCESS \
-       && ! ((defined YYMALLOC || defined malloc) \
-             && (defined YYFREE || defined free)))
-#   include <stdlib.h> /* INFRINGES ON USER NAME SPACE */
-#   ifndef EXIT_SUCCESS
-#    define EXIT_SUCCESS 0
-#   endif
-#  endif
-#  ifndef YYMALLOC
-#   define YYMALLOC malloc
-#   if ! defined malloc && ! defined EXIT_SUCCESS
-void *malloc (YYSIZE_T); /* INFRINGES ON USER NAME SPACE */
-#   endif
-#  endif
-#  ifndef YYFREE
-#   define YYFREE free
-#   if ! defined free && ! defined EXIT_SUCCESS
-void free (void *); /* INFRINGES ON USER NAME SPACE */
-#   endif
-#  endif
-# endif
-#endif /* 1 */
-
-#if (! defined yyoverflow \
-     && (! defined __cplusplus \
-         || (defined YYSTYPE_IS_TRIVIAL && YYSTYPE_IS_TRIVIAL)))
-
-/* A type that is properly aligned for any stack member.  */
-union yyalloc
-{
-  yy_state_t yyss_alloc;
-  YYSTYPE yyvs_alloc;
-};
-
-/* The size of the maximum gap between one aligned stack and the next.  */
-# define YYSTACK_GAP_MAXIMUM (YYSIZEOF (union yyalloc) - 1)
-
-/* The size of an array large to enough to hold all stacks, each with
-   N elements.  */
-# define YYSTACK_BYTES(N) \
-     ((N) * (YYSIZEOF (yy_state_t) + YYSIZEOF (YYSTYPE)) \
-      + YYSTACK_GAP_MAXIMUM)
-
-# define YYCOPY_NEEDED 1
-
-/* Relocate STACK from its old location to the new one.  The
-   local variables YYSIZE and YYSTACKSIZE give the old and new number of
-   elements in the stack, and YYPTR gives the new location of the
-   stack.  Advance YYPTR to a properly aligned location for the next
-   stack.  */
-# define YYSTACK_RELOCATE(Stack_alloc, Stack)                           \
-    do                                                                  \
-      {                                                                 \
-        YYPTRDIFF_T yynewbytes;                                         \
-        YYCOPY (&yyptr->Stack_alloc, Stack, yysize);                    \
-        Stack = &yyptr->Stack_alloc;                                    \
-        yynewbytes = yystacksize * YYSIZEOF (*Stack) + YYSTACK_GAP_MAXIMUM; \
-        yyptr += yynewbytes / YYSIZEOF (*yyptr);                        \
-      }                                                                 \
-    while (0)
-
-#endif
-
-#if defined YYCOPY_NEEDED && YYCOPY_NEEDED
-/* Copy COUNT objects from SRC to DST.  The source and destination do
-   not overlap.  */
-# ifndef YYCOPY
-#  if defined __GNUC__ && 1 < __GNUC__
-#   define YYCOPY(Dst, Src, Count) \
-      __builtin_memcpy (Dst, Src, YY_CAST (YYSIZE_T, (Count)) * sizeof (*(Src)))
-#  else
-#   define YYCOPY(Dst, Src, Count)              \
-      do                                        \
-        {                                       \
-          YYPTRDIFF_T yyi;                      \
-          for (yyi = 0; yyi < (Count); yyi++)   \
-            (Dst)[yyi] = (Src)[yyi];            \
-        }                                       \
-      while (0)
-#  endif
-# endif
-#endif /* !YYCOPY_NEEDED */
-
-/* YYFINAL -- State number of the termination state.  */
-#define YYFINAL  56
-/* YYLAST -- Last index in YYTABLE.  */
-#define YYLAST   478
-
-/* YYNTOKENS -- Number of terminals.  */
-#define YYNTOKENS  40
-/* YYNNTS -- Number of nonterminals.  */
-#define YYNNTS  24
-/* YYNRULES -- Number of rules.  */
-#define YYNRULES  73
-/* YYNSTATES -- Number of states.  */
-#define YYNSTATES  129
-
-/* YYMAXUTOK -- Last valid token kind.  */
-#define YYMAXUTOK   283
-
-
-/* YYTRANSLATE(TOKEN-NUM) -- Symbol number corresponding to TOKEN-NUM
-   as returned by yylex, with out-of-bounds checking.  */
-#define YYTRANSLATE(YYX)                                \
-  (0 <= (YYX) && (YYX) <= YYMAXUTOK                     \
-   ? YY_CAST (yysymbol_kind_t, yytranslate[YYX])        \
-   : YYSYMBOL_YYUNDEF)
-
-/* YYTRANSLATE[TOKEN-NUM] -- Symbol number corresponding to TOKEN-NUM
-   as returned by yylex.  */
-static const yytype_int8 yytranslate[] =
-{
-       0,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-      28,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,    30,     2,    37,     2,
-      33,    25,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,    36,
-       2,    38,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,    29,     2,    39,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,    34,     2,    35,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     2,     2,     2,     2,
-       2,     2,     2,     2,     2,     2,     1,     2,     3,     4,
-       5,     6,     7,     8,     9,    10,    11,    12,    13,    14,
-      15,    16,    17,    18,    19,    20,    21,    22,    23,    24,
-      26,    27,    31,    32
-};
-
-#if YYDEBUG
-/* YYRLINE[YYN] -- Source line where rule number YYN was defined.  */
-static const yytype_uint8 yyrline[] =
-{
-       0,    38,    38,    39,    42,    43,    46,    47,    50,    53,
-      56,    57,    60,    61,    64,    65,    68,    69,    72,    73,
-      74,    77,    80,    81,    84,    85,    88,    89,    90,    91,
-      92,    93,    94,    95,    96,    97,    98,    99,   100,   101,
-     102,   105,   106,   107,   110,   111,   114,   115,   118,   119,
-     122,   123,   124,   125,   126,   127,   128,   132,   132,   132,
-     132,   132,   132,   132,   132,   132,   132,   135,   136,   139,
-     140,   141,   143,   145
-};
-#endif
-
-/** Accessing symbol of state STATE.  */
-#define YY_ACCESSING_SYMBOL(State) YY_CAST (yysymbol_kind_t, yystos[State])
-
-#if 1
-/* The user-facing name of the symbol whose (internal) number is
-   YYSYMBOL.  No bounds checking.  */
-static const char *yysymbol_name (yysymbol_kind_t yysymbol) YY_ATTRIBUTE_UNUSED;
-
-/* YYTNAME[SYMBOL-NUM] -- String name of the symbol SYMBOL-NUM.
-   First, the terminals, then, starting at YYNTOKENS, nonterminals.  */
-static const char *const yytname[] =
-{
-  "\"end of file\"", "error", "\"invalid token\"", "Tfor", "Tin",
-  "Twhile", "Tif", "Telse", "Tswitch", "Tcase", "Tcasebody", "Ttwiddle",
-  "Tbang", "Tsubshell", "Tfunc", "Tredir", "Tdup", "Tpipe", "Tindex",
-  "Tbasic", "Targs", "Tword", "Twords", "Tparen", "Tblock", "')'",
-  "Tandand", "Toror", "'\\n'", "'^'", "'$'", "Tcount", "Tjoin", "'('",
-  "'{'", "'}'", "';'", "'&'", "'='", "'`'", "$accept", "rc", "line",
-  "body", "paren", "block", "cmds", "cmdsln", "ifbody", "case", "casebody",
-  "assign", "redir", "epilog", "cmd", "basic", "atom", "word",
-  "executable", "nonkeyword", "keyword", "words", "wordsnl", "nl", YY_NULLPTR
-};
-
-static const char *
-yysymbol_name (yysymbol_kind_t yysymbol)
-{
-  return yytname[yysymbol];
-}
-#endif
-
-#define YYPACT_NINF (-82)
-
-#define yypact_value_is_default(Yyn) \
-  ((Yyn) == YYPACT_NINF)
-
-#define YYTABLE_NINF (-3)
-
-#define yytable_value_is_error(Yyn) \
-  0
-
-/* YYPACT[STATE-NUM] -- Index in YYTABLE of the portion describing
-   STATE-NUM.  */
-static const yytype_int16 yypact[] =
-{
-     121,   -17,    -2,    -2,     5,   439,   439,   343,   -82,   -82,
-     343,   343,   343,   -82,   439,   -23,    45,    32,    11,   439,
-     439,   439,    13,   158,   -14,   -82,   343,   439,   -82,   -82,
-     343,    30,    30,   -82,   -82,   -82,   -82,   -82,   -82,   -82,
-     -82,   -82,   -82,   -82,    34,   -82,   -82,    47,   -82,   -82,
-     195,    41,   -82,   439,    54,   -82,   -82,   -82,    11,   -82,
-     -82,    30,    30,   -82,   -82,   -82,   -82,   -82,   -82,    34,
-     343,   343,    19,    44,   375,   375,     4,   343,   -82,   -82,
-     -82,    34,   -82,   -82,   -82,   -82,   375,   375,   375,   -82,
-      34,   -82,   -82,   -82,   -82,    29,    77,   -82,    29,   -82,
-     -82,   269,   -82,    30,    30,   306,   375,   -82,    25,   -82,
-      34,   -82,    29,   375,   407,   375,    29,   -82,   407,   407,
-      48,    54,    29,   232,   -82,   -82,   -82,   -82,   -82
-};
-
-/* YYDEFACT[STATE-NUM] -- Default reduction number in state STATE-NUM.
-   Performed when YYTABLE does not specify something else to do.  Zero
-   means the default is an error.  */
-static const yytype_int8 yydefact[] =
-{
-      26,     0,     0,     0,     0,    26,    26,     0,    22,    50,
-       0,     0,     0,    69,    26,     0,     0,     0,    24,    26,
-      26,    26,     4,    27,    41,    48,     0,    26,    72,    72,
-       0,    34,    35,    57,    58,    59,    60,    61,    62,    63,
-      64,    65,    66,    46,    23,    44,    45,    51,    54,    55,
-       0,     0,    12,    26,     6,    56,     1,     3,    24,    28,
-       5,    33,    32,    72,    72,    72,    10,    11,    43,    42,
-       0,     0,     0,     0,    26,    26,     0,     0,    67,    53,
-      70,    71,     9,     7,    13,    25,    26,    26,    26,    49,
-      21,    67,    72,     8,    73,    38,    24,    39,    14,    72,
-      47,     0,    29,    30,    31,     0,    26,    72,     0,    52,
-      68,    72,    36,    26,    26,    26,    15,    67,    26,    26,
-       0,    18,    37,     0,    20,    19,    40,    17,    16
-};
-
-/* YYPGOTO[NTERM-NUM].  */
-static const yytype_int8 yypgoto[] =
-{
-     -82,   -82,    75,   -19,    93,   -11,    18,   -52,   -82,   -82,
-     -21,   -82,    -1,    42,     0,   -82,    -9,    28,   -82,     2,
-     -82,   -81,   -82,   -22
-};
-
-/* YYDEFGOTO[NTERM-NUM].  */
-static const yytype_int8 yydefgoto[] =
-{
-       0,    16,    17,    51,    28,    18,    52,    53,    97,   119,
-     120,    20,    21,    59,    54,    23,    43,   110,    24,    25,
-      46,   101,    50,    74
-};
-
-/* YYTABLE[YYPACT[STATE-NUM]] -- What to do in state STATE-NUM.  If
-   positive, shift that token.  If negative, reduce the rule whose
-   number is the opposite.  If YYTABLE_NINF, syntax error.  */
-static const yytype_int16 yytable[] =
-{
-      22,    47,    48,    49,    55,    31,    32,    75,    73,    45,
-     105,    14,    45,    45,    45,    70,    26,    58,    19,    22,
-      61,    62,    68,    91,    71,    45,     7,     8,    45,    99,
-      63,    27,    45,    77,    83,    44,   123,    19,    30,    64,
-      65,    86,    87,    88,    92,    56,    63,    63,    77,    66,
-      67,    69,    45,    94,    72,    64,    65,    58,    76,   114,
-      57,    89,   118,    77,    96,    78,   118,   118,   100,    93,
-     106,    63,    45,    45,    95,    98,    82,   108,    81,    45,
-      64,    65,    84,   126,   107,   113,   102,   103,   104,   115,
-      66,    67,     7,     8,    60,    58,    29,   124,   125,    90,
-      85,     0,     0,    45,     0,     0,   112,    45,     0,     0,
-       0,     0,     0,   116,   121,   122,     0,     0,   121,   121,
-       0,    -2,     0,     0,     1,    45,     2,     3,     0,     4,
-       0,     0,     0,     5,     6,     0,     7,     8,     0,     0,
-       0,     0,     9,     0,     0,     0,     0,     0,     0,     0,
-       0,    10,    11,    12,    13,    14,     0,     0,     0,     0,
-      15,    33,    34,    35,    36,    37,    38,    39,     0,     0,
-      40,    41,    42,     7,     8,     0,     0,     0,     0,     9,
-       0,     0,     0,     0,     0,     0,     0,     0,    10,    11,
-      12,    13,     0,     0,     0,     0,     0,    15,    33,    34,
-      35,    36,    37,    38,    39,     0,     0,    40,    41,    42,
-       0,     0,     0,     0,     0,     0,     9,     0,     0,     0,
-      79,     0,     0,    80,     0,    10,    11,    12,    13,     0,
-       0,     0,     0,     0,    15,    33,    34,    35,    36,    37,
-      38,    39,     0,     0,    40,    41,    42,     0,     0,     0,
-       0,     0,     0,     9,     0,     0,     0,     0,     0,     0,
-     127,     0,    10,    11,    12,    13,     0,     0,   128,     0,
-       0,    15,    33,    34,    35,    36,    37,    38,    39,     0,
-       0,    40,    41,    42,     0,     0,     0,     0,     0,     0,
-       9,     0,     0,     0,   109,     0,     0,     0,     0,    10,
-      11,    12,    13,     0,     0,     0,     0,     0,    15,    33,
-      34,    35,    36,    37,    38,    39,     0,     0,    40,    41,
-      42,     0,     0,     0,     0,     0,     0,     9,     0,     0,
-       0,   111,     0,     0,     0,     0,    10,    11,    12,    13,
-       0,     0,     0,     0,     0,    15,    33,    34,    35,    36,
-      37,    38,    39,     0,     0,    40,    41,    42,     0,     0,
-       0,     0,     0,     0,     9,     0,     0,     0,     0,     0,
-       0,     0,     0,    10,    11,    12,    13,     0,     1,     0,
-       2,     3,    15,     4,     0,     0,     0,     5,     6,     0,
-       7,     8,     0,     0,     0,     0,     9,     0,     0,     0,
-       0,     0,     0,    94,     0,    10,    11,    12,    13,    14,
-       1,     0,     2,     3,    15,     4,   117,     0,     0,     5,
-       6,     0,     7,     8,     0,     0,     0,     0,     9,     0,
-       0,     0,     0,     0,     0,     0,     0,    10,    11,    12,
-      13,    14,     1,     0,     2,     3,    15,     4,     0,     0,
-       0,     5,     6,     0,     7,     8,     0,     0,     0,     0,
-       9,     0,     0,     0,     0,     0,     0,     0,     0,    10,
-      11,    12,    13,    14,     0,     0,     0,     0,    15
-};
-
-static const yytype_int8 yycheck[] =
-{
-       0,    10,    11,    12,    15,     5,     6,    29,    27,     7,
-      91,    34,    10,    11,    12,    29,    33,    18,     0,    19,
-      20,    21,    23,     4,    38,    23,    15,    16,    26,    25,
-      17,    33,    30,    29,    53,     7,   117,    19,    33,    26,
-      27,    63,    64,    65,    25,     0,    17,    17,    29,    36,
-      37,    23,    50,    28,    26,    26,    27,    58,    30,    34,
-      28,    70,   114,    29,    75,    18,   118,   119,    77,    25,
-      92,    17,    70,    71,    74,    75,    35,    99,    50,    77,
-      26,    27,    28,    35,     7,   107,    86,    87,    88,   111,
-      36,    37,    15,    16,    19,    96,     3,   118,   119,    71,
-      58,    -1,    -1,   101,    -1,    -1,   106,   105,    -1,    -1,
-      -1,    -1,    -1,   113,   114,   115,    -1,    -1,   118,   119,
-      -1,     0,    -1,    -1,     3,   123,     5,     6,    -1,     8,
-      -1,    -1,    -1,    12,    13,    -1,    15,    16,    -1,    -1,
-      -1,    -1,    21,    -1,    -1,    -1,    -1,    -1,    -1,    -1,
-      -1,    30,    31,    32,    33,    34,    -1,    -1,    -1,    -1,
-      39,     3,     4,     5,     6,     7,     8,     9,    -1,    -1,
-      12,    13,    14,    15,    16,    -1,    -1,    -1,    -1,    21,
-      -1,    -1,    -1,    -1,    -1,    -1,    -1,    -1,    30,    31,
-      32,    33,    -1,    -1,    -1,    -1,    -1,    39,     3,     4,
-       5,     6,     7,     8,     9,    -1,    -1,    12,    13,    14,
-      -1,    -1,    -1,    -1,    -1,    -1,    21,    -1,    -1,    -1,
-      25,    -1,    -1,    28,    -1,    30,    31,    32,    33,    -1,
-      -1,    -1,    -1,    -1,    39,     3,     4,     5,     6,     7,
-       8,     9,    -1,    -1,    12,    13,    14,    -1,    -1,    -1,
-      -1,    -1,    -1,    21,    -1,    -1,    -1,    -1,    -1,    -1,
-      28,    -1,    30,    31,    32,    33,    -1,    -1,    36,    -1,
-      -1,    39,     3,     4,     5,     6,     7,     8,     9,    -1,
-      -1,    12,    13,    14,    -1,    -1,    -1,    -1,    -1,    -1,
-      21,    -1,    -1,    -1,    25,    -1,    -1,    -1,    -1,    30,
-      31,    32,    33,    -1,    -1,    -1,    -1,    -1,    39,     3,
-       4,     5,     6,     7,     8,     9,    -1,    -1,    12,    13,
-      14,    -1,    -1,    -1,    -1,    -1,    -1,    21,    -1,    -1,
-      -1,    25,    -1,    -1,    -1,    -1,    30,    31,    32,    33,
-      -1,    -1,    -1,    -1,    -1,    39,     3,     4,     5,     6,
-       7,     8,     9,    -1,    -1,    12,    13,    14,    -1,    -1,
-      -1,    -1,    -1,    -1,    21,    -1,    -1,    -1,    -1,    -1,
-      -1,    -1,    -1,    30,    31,    32,    33,    -1,     3,    -1,
-       5,     6,    39,     8,    -1,    -1,    -1,    12,    13,    -1,
-      15,    16,    -1,    -1,    -1,    -1,    21,    -1,    -1,    -1,
-      -1,    -1,    -1,    28,    -1,    30,    31,    32,    33,    34,
-       3,    -1,     5,     6,    39,     8,     9,    -1,    -1,    12,
-      13,    -1,    15,    16,    -1,    -1,    -1,    -1,    21,    -1,
-      -1,    -1,    -1,    -1,    -1,    -1,    -1,    30,    31,    32,
-      33,    34,     3,    -1,     5,     6,    39,     8,    -1,    -1,
-      -1,    12,    13,    -1,    15,    16,    -1,    -1,    -1,    -1,
-      21,    -1,    -1,    -1,    -1,    -1,    -1,    -1,    -1,    30,
-      31,    32,    33,    34,    -1,    -1,    -1,    -1,    39
-};
-
-/* YYSTOS[STATE-NUM] -- The symbol kind of the accessing symbol of
-   state STATE-NUM.  */
-static const yytype_int8 yystos[] =
-{
-       0,     3,     5,     6,     8,    12,    13,    15,    16,    21,
-      30,    31,    32,    33,    34,    39,    41,    42,    45,    46,
-      51,    52,    54,    55,    58,    59,    33,    33,    44,    44,
-      33,    54,    54,     3,     4,     5,     6,     7,     8,     9,
-      12,    13,    14,    56,    57,    59,    60,    56,    56,    56,
-      62,    43,    46,    47,    54,    45,     0,    28,    52,    53,
-      42,    54,    54,    17,    26,    27,    36,    37,    52,    57,
-      29,    38,    57,    43,    63,    63,    57,    29,    18,    25,
-      28,    57,    35,    43,    28,    53,    63,    63,    63,    56,
-      57,     4,    25,    25,    28,    54,    45,    48,    54,    25,
-      56,    61,    54,    54,    54,    61,    63,     7,    63,    25,
-      57,    25,    54,    63,    34,    63,    54,     9,    47,    49,
-      50,    54,    54,    61,    50,    50,    35,    28,    36
-};
-
-/* YYR1[RULE-NUM] -- Symbol kind of the left-hand side of rule RULE-NUM.  */
-static const yytype_int8 yyr1[] =
-{
-       0,    40,    41,    41,    42,    42,    43,    43,    44,    45,
-      46,    46,    47,    47,    48,    48,    49,    49,    50,    50,
-      50,    51,    52,    52,    53,    53,    54,    54,    54,    54,
-      54,    54,    54,    54,    54,    54,    54,    54,    54,    54,
-      54,    55,    55,    55,    56,    56,    57,    57,    58,    58,
-      59,    59,    59,    59,    59,    59,    59,    60,    60,    60,
-      60,    60,    60,    60,    60,    60,    60,    61,    61,    62,
-      62,    62,    63,    63
-};
-
-/* YYR2[RULE-NUM] -- Number of symbols on the right-hand side of rule RULE-NUM.  */
-static const yytype_int8 yyr2[] =
-{
-       0,     2,     0,     2,     1,     2,     1,     2,     3,     3,
-       2,     2,     1,     2,     1,     4,     3,     3,     1,     2,
-       2,     3,     1,     2,     0,     2,     0,     1,     2,     4,
-       4,     4,     2,     2,     2,     2,     6,     8,     4,     4,
-       8,     1,     2,     2,     1,     1,     1,     3,     1,     3,
-       1,     2,     5,     3,     2,     2,     2,     1,     1,     1,
-       1,     1,     1,     1,     1,     1,     1,     0,     2,     0,
-       2,     2,     0,     2
-};
-
-
-enum { YYENOMEM = -2 };
-
-#define yyerrok         (yyerrstatus = 0)
-#define yyclearin       (yychar = YYEMPTY)
-
-#define YYACCEPT        goto yyacceptlab
-#define YYABORT         goto yyabortlab
-#define YYERROR         goto yyerrorlab
-#define YYNOMEM         goto yyexhaustedlab
-
-
-#define YYRECOVERING()  (!!yyerrstatus)
-
-#define YYBACKUP(Token, Value)                                    \
-  do                                                              \
-    if (yychar == YYEMPTY)                                        \
-      {                                                           \
-        yychar = (Token);                                         \
-        yylval = (Value);                                         \
-        YYPOPSTACK (yylen);                                       \
-        yystate = *yyssp;                                         \
-        goto yybackup;                                            \
-      }                                                           \
-    else                                                          \
-      {                                                           \
-        yyerror (YY_("syntax error: cannot back up")); \
-        YYERROR;                                                  \
-      }                                                           \
-  while (0)
-
-/* Backward compatibility with an undocumented macro.
-   Use YYerror or YYUNDEF. */
-#define YYERRCODE YYUNDEF
-
-
-/* Enable debugging if requested.  */
-#if YYDEBUG
-
-# ifndef YYFPRINTF
-#  include <stdio.h> /* INFRINGES ON USER NAME SPACE */
-#  define YYFPRINTF fprintf
-# endif
-
-# define YYDPRINTF(Args)                        \
-do {                                            \
-  if (yydebug)                                  \
-    YYFPRINTF Args;                             \
-} while (0)
-
-
-
-
-# define YY_SYMBOL_PRINT(Title, Kind, Value, Location)                    \
-do {                                                                      \
-  if (yydebug)                                                            \
-    {                                                                     \
-      YYFPRINTF (stderr, "%s ", Title);                                   \
-      yy_symbol_print (stderr,                                            \
-                  Kind, Value); \
-      YYFPRINTF (stderr, "\n");                                           \
-    }                                                                     \
-} while (0)
-
-
-/*-----------------------------------.
-| Print this symbol's value on YYO.  |
-`-----------------------------------*/
-
-static void
-yy_symbol_value_print (FILE *yyo,
-                       yysymbol_kind_t yykind, YYSTYPE const * const yyvaluep)
-{
-  FILE *yyoutput = yyo;
-  YY_USE (yyoutput);
-  if (!yyvaluep)
-    return;
-  YY_IGNORE_MAYBE_UNINITIALIZED_BEGIN
-  YY_USE (yykind);
-  YY_IGNORE_MAYBE_UNINITIALIZED_END
-}
-
-
-/*---------------------------.
-| Print this symbol on YYO.  |
-`---------------------------*/
-
-static void
-yy_symbol_print (FILE *yyo,
-                 yysymbol_kind_t yykind, YYSTYPE const * const yyvaluep)
-{
-  YYFPRINTF (yyo, "%s %s (",
-             yykind < YYNTOKENS ? "token" : "nterm", yysymbol_name (yykind));
-
-  yy_symbol_value_print (yyo, yykind, yyvaluep);
-  YYFPRINTF (yyo, ")");
-}
-
-/*------------------------------------------------------------------.
-| yy_stack_print -- Print the state stack from its BOTTOM up to its |
-| TOP (included).                                                   |
-`------------------------------------------------------------------*/
-
-static void
-yy_stack_print (yy_state_t *yybottom, yy_state_t *yytop)
-{
-  YYFPRINTF (stderr, "Stack now");
-  for (; yybottom <= yytop; yybottom++)
-    {
-      int yybot = *yybottom;
-      YYFPRINTF (stderr, " %d", yybot);
-    }
-  YYFPRINTF (stderr, "\n");
-}
-
-# define YY_STACK_PRINT(Bottom, Top)                            \
-do {                                                            \
-  if (yydebug)                                                  \
-    yy_stack_print ((Bottom), (Top));                           \
-} while (0)
-
-
-/*------------------------------------------------.
-| Report that the YYRULE is going to be reduced.  |
-`------------------------------------------------*/
-
-static void
-yy_reduce_print (yy_state_t *yyssp, YYSTYPE *yyvsp,
-                 int yyrule)
-{
-  int yylno = yyrline[yyrule];
-  int yynrhs = yyr2[yyrule];
-  int yyi;
-  YYFPRINTF (stderr, "Reducing stack by rule %d (line %d):\n",
-             yyrule - 1, yylno);
-  /* The symbols being reduced.  */
-  for (yyi = 0; yyi < yynrhs; yyi++)
-    {
-      YYFPRINTF (stderr, "   $%d = ", yyi + 1);
-      yy_symbol_print (stderr,
-                       YY_ACCESSING_SYMBOL (+yyssp[yyi + 1 - yynrhs]),
-                       &yyvsp[(yyi + 1) - (yynrhs)]);
-      YYFPRINTF (stderr, "\n");
-    }
-}
-
-# define YY_REDUCE_PRINT(Rule)          \
-do {                                    \
-  if (yydebug)                          \
-    yy_reduce_print (yyssp, yyvsp, Rule); \
-} while (0)
-
-/* Nonzero means print parse trace.  It is left uninitialized so that
-   multiple parsers can coexist.  */
-int yydebug;
-#else /* !YYDEBUG */
-# define YYDPRINTF(Args) ((void) 0)
-# define YY_SYMBOL_PRINT(Title, Kind, Value, Location)
-# define YY_STACK_PRINT(Bottom, Top)
-# define YY_REDUCE_PRINT(Rule)
-#endif /* !YYDEBUG */
-
-
-/* YYINITDEPTH -- initial size of the parser's stacks.  */
-#ifndef YYINITDEPTH
-# define YYINITDEPTH 200
-#endif
-
-/* YYMAXDEPTH -- maximum size the stacks can grow to (effective only
-   if the built-in stack extension method is used).
-
-   Do not make this value too large; the results are undefined if
-   YYSTACK_ALLOC_MAXIMUM < YYSTACK_BYTES (YYMAXDEPTH)
-   evaluated with infinite-precision integer arithmetic.  */
-
-#ifndef YYMAXDEPTH
-# define YYMAXDEPTH 10000
-#endif
-
-
-/* Context of a parse error.  */
-typedef struct
-{
-  yy_state_t *yyssp;
-  yysymbol_kind_t yytoken;
-} yypcontext_t;
-
-/* Put in YYARG at most YYARGN of the expected tokens given the
-   current YYCTX, and return the number of tokens stored in YYARG.  If
-   YYARG is null, return the number of expected tokens (guaranteed to
-   be less than YYNTOKENS).  Return YYENOMEM on memory exhaustion.
-   Return 0 if there are more than YYARGN expected tokens, yet fill
-   YYARG up to YYARGN. */
-static int
-yypcontext_expected_tokens (const yypcontext_t *yyctx,
-                            yysymbol_kind_t yyarg[], int yyargn)
-{
-  /* Actual size of YYARG. */
-  int yycount = 0;
-  int yyn = yypact[+*yyctx->yyssp];
-  if (!yypact_value_is_default (yyn))
-    {
-      /* Start YYX at -YYN if negative to avoid negative indexes in
-         YYCHECK.  In other words, skip the first -YYN actions for
-         this state because they are default actions.  */
-      int yyxbegin = yyn < 0 ? -yyn : 0;
-      /* Stay within bounds of both yycheck and yytname.  */
-      int yychecklim = YYLAST - yyn + 1;
-      int yyxend = yychecklim < YYNTOKENS ? yychecklim : YYNTOKENS;
-      int yyx;
-      for (yyx = yyxbegin; yyx < yyxend; ++yyx)
-        if (yycheck[yyx + yyn] == yyx && yyx != YYSYMBOL_YYerror
-            && !yytable_value_is_error (yytable[yyx + yyn]))
-          {
-            if (!yyarg)
-              ++yycount;
-            else if (yycount == yyargn)
-              return 0;
-            else
-              yyarg[yycount++] = YY_CAST (yysymbol_kind_t, yyx);
-          }
-    }
-  if (yyarg && yycount == 0 && 0 < yyargn)
-    yyarg[0] = YYSYMBOL_YYEMPTY;
-  return yycount;
-}
-
-
-
-
-#ifndef yystrlen
-# if defined __GLIBC__ && defined _STRING_H
-#  define yystrlen(S) (YY_CAST (YYPTRDIFF_T, strlen (S)))
-# else
-/* Return the length of YYSTR.  */
-static YYPTRDIFF_T
-yystrlen (const char *yystr)
-{
-  YYPTRDIFF_T yylen;
-  for (yylen = 0; yystr[yylen]; yylen++)
-    continue;
-  return yylen;
-}
-# endif
-#endif
-
-#ifndef yystpcpy
-# if defined __GLIBC__ && defined _STRING_H && defined _GNU_SOURCE
-#  define yystpcpy stpcpy
-# else
-/* Copy YYSRC to YYDEST, returning the address of the terminating '\0' in
-   YYDEST.  */
-static char *
-yystpcpy (char *yydest, const char *yysrc)
-{
-  char *yyd = yydest;
-  const char *yys = yysrc;
-
-  while ((*yyd++ = *yys++) != '\0')
-    continue;
-
-  return yyd - 1;
-}
-# endif
-#endif
-
-#ifndef yytnamerr
-/* Copy to YYRES the contents of YYSTR after stripping away unnecessary
-   quotes and backslashes, so that it's suitable for yyerror.  The
-   heuristic is that double-quoting is unnecessary unless the string
-   contains an apostrophe, a comma, or backslash (other than
-   backslash-backslash).  YYSTR is taken from yytname.  If YYRES is
-   null, do not copy; instead, return the length of what the result
-   would have been.  */
-static YYPTRDIFF_T
-yytnamerr (char *yyres, const char *yystr)
-{
-  if (*yystr == '"')
-    {
-      YYPTRDIFF_T yyn = 0;
-      char const *yyp = yystr;
-      for (;;)
-        switch (*++yyp)
-          {
-          case '\'':
-          case ',':
-            goto do_not_strip_quotes;
-
-          case '\\':
-            if (*++yyp != '\\')
-              goto do_not_strip_quotes;
-            else
-              goto append;
-
-          append:
-          default:
-            if (yyres)
-              yyres[yyn] = *yyp;
-            yyn++;
-            break;
-
-          case '"':
-            if (yyres)
-              yyres[yyn] = '\0';
-            return yyn;
-          }
-    do_not_strip_quotes: ;
-    }
-
-  if (yyres)
-    return yystpcpy (yyres, yystr) - yyres;
-  else
-    return yystrlen (yystr);
-}
-#endif
-
-
-static int
-yy_syntax_error_arguments (const yypcontext_t *yyctx,
-                           yysymbol_kind_t yyarg[], int yyargn)
-{
-  /* Actual size of YYARG. */
-  int yycount = 0;
-  /* There are many possibilities here to consider:
-     - If this state is a consistent state with a default action, then
-       the only way this function was invoked is if the default action
-       is an error action.  In that case, don't check for expected
-       tokens because there are none.
-     - The only way there can be no lookahead present (in yychar) is if
-       this state is a consistent state with a default action.  Thus,
-       detecting the absence of a lookahead is sufficient to determine
-       that there is no unexpected or expected token to report.  In that
-       case, just report a simple "syntax error".
-     - Don't assume there isn't a lookahead just because this state is a
-       consistent state with a default action.  There might have been a
-       previous inconsistent state, consistent state with a non-default
-       action, or user semantic action that manipulated yychar.
-     - Of course, the expected token list depends on states to have
-       correct lookahead information, and it depends on the parser not
-       to perform extra reductions after fetching a lookahead from the
-       scanner and before detecting a syntax error.  Thus, state merging
-       (from LALR or IELR) and default reductions corrupt the expected
-       token list.  However, the list is correct for canonical LR with
-       one exception: it will still contain any token that will not be
-       accepted due to an error action in a later state.
-  */
-  if (yyctx->yytoken != YYSYMBOL_YYEMPTY)
-    {
-      int yyn;
-      if (yyarg)
-        yyarg[yycount] = yyctx->yytoken;
-      ++yycount;
-      yyn = yypcontext_expected_tokens (yyctx,
-                                        yyarg ? yyarg + 1 : yyarg, yyargn - 1);
-      if (yyn == YYENOMEM)
-        return YYENOMEM;
-      else
-        yycount += yyn;
-    }
-  return yycount;
-}
-
-/* Copy into *YYMSG, which is of size *YYMSG_ALLOC, an error message
-   about the unexpected token YYTOKEN for the state stack whose top is
-   YYSSP.
-
-   Return 0 if *YYMSG was successfully written.  Return -1 if *YYMSG is
-   not large enough to hold the message.  In that case, also set
-   *YYMSG_ALLOC to the required number of bytes.  Return YYENOMEM if the
-   required number of bytes is too large to store.  */
-static int
-yysyntax_error (YYPTRDIFF_T *yymsg_alloc, char **yymsg,
-                const yypcontext_t *yyctx)
-{
-  enum { YYARGS_MAX = 5 };
-  /* Internationalized format string. */
-  const char *yyformat = YY_NULLPTR;
-  /* Arguments of yyformat: reported tokens (one for the "unexpected",
-     one per "expected"). */
-  yysymbol_kind_t yyarg[YYARGS_MAX];
-  /* Cumulated lengths of YYARG.  */
-  YYPTRDIFF_T yysize = 0;
-
-  /* Actual size of YYARG. */
-  int yycount = yy_syntax_error_arguments (yyctx, yyarg, YYARGS_MAX);
-  if (yycount == YYENOMEM)
-    return YYENOMEM;
-
-  switch (yycount)
-    {
-#define YYCASE_(N, S)                       \
-      case N:                               \
-        yyformat = S;                       \
-        break
-    default: /* Avoid compiler warnings. */
-      YYCASE_(0, YY_("syntax error"));
-      YYCASE_(1, YY_("syntax error, unexpected %s"));
-      YYCASE_(2, YY_("syntax error, unexpected %s, expecting %s"));
-      YYCASE_(3, YY_("syntax error, unexpected %s, expecting %s or %s"));
-      YYCASE_(4, YY_("syntax error, unexpected %s, expecting %s or %s or %s"));
-      YYCASE_(5, YY_("syntax error, unexpected %s, expecting %s or %s or %s or %s"));
-#undef YYCASE_
-    }
-
-  /* Compute error message size.  Don't count the "%s"s, but reserve
-     room for the terminator.  */
-  yysize = yystrlen (yyformat) - 2 * yycount + 1;
-  {
-    int yyi;
-    for (yyi = 0; yyi < yycount; ++yyi)
-      {
-        YYPTRDIFF_T yysize1
-          = yysize + yytnamerr (YY_NULLPTR, yytname[yyarg[yyi]]);
-        if (yysize <= yysize1 && yysize1 <= YYSTACK_ALLOC_MAXIMUM)
-          yysize = yysize1;
-        else
-          return YYENOMEM;
-      }
-  }
-
-  if (*yymsg_alloc < yysize)
-    {
-      *yymsg_alloc = 2 * yysize;
-      if (! (yysize <= *yymsg_alloc
-             && *yymsg_alloc <= YYSTACK_ALLOC_MAXIMUM))
-        *yymsg_alloc = YYSTACK_ALLOC_MAXIMUM;
-      return -1;
-    }
-
-  /* Avoid sprintf, as that infringes on the user's name space.
-     Don't have undefined behavior even if the translation
-     produced a string with the wrong number of "%s"s.  */
-  {
-    char *yyp = *yymsg;
-    int yyi = 0;
-    while ((*yyp = *yyformat) != '\0')
-      if (*yyp == '%' && yyformat[1] == 's' && yyi < yycount)
-        {
-          yyp += yytnamerr (yyp, yytname[yyarg[yyi++]]);
-          yyformat += 2;
-        }
-      else
-        {
-          ++yyp;
-          ++yyformat;
-        }
-  }
-  return 0;
-}
-
-
-/*-----------------------------------------------.
-| Release the memory associated to this symbol.  |
-`-----------------------------------------------*/
-
-static void
-yydestruct (const char *yymsg,
-            yysymbol_kind_t yykind, YYSTYPE *yyvaluep)
-{
-  YY_USE (yyvaluep);
-  if (!yymsg)
-    yymsg = "Deleting";
-  YY_SYMBOL_PRINT (yymsg, yykind, yyvaluep, yylocationp);
-
-  YY_IGNORE_MAYBE_UNINITIALIZED_BEGIN
-  YY_USE (yykind);
-  YY_IGNORE_MAYBE_UNINITIALIZED_END
-}
-
-
-/* Lookahead token kind.  */
-int yychar;
-
-/* The semantic value of the lookahead symbol.  */
-YYSTYPE yylval;
-/* Number of syntax errors so far.  */
-int yynerrs;
-
-
-
-
-/*----------.
-| yyparse.  |
-`----------*/
-
-int
-yyparse (void)
-{
-    yy_state_fast_t yystate = 0;
-    /* Number of tokens to shift before error messages enabled.  */
-    int yyerrstatus = 0;
-
-    /* Refer to the stacks through separate pointers, to allow yyoverflow
-       to reallocate them elsewhere.  */
-
-    /* Their size.  */
-    YYPTRDIFF_T yystacksize = YYINITDEPTH;
-
-    /* The state stack: array, bottom, top.  */
-    yy_state_t yyssa[YYINITDEPTH];
-    yy_state_t *yyss = yyssa;
-    yy_state_t *yyssp = yyss;
-
-    /* The semantic value stack: array, bottom, top.  */
-    YYSTYPE yyvsa[YYINITDEPTH];
-    YYSTYPE *yyvs = yyvsa;
-    YYSTYPE *yyvsp = yyvs;
-
-  int yyn;
-  /* The return value of yyparse.  */
-  int yyresult;
-  /* Lookahead symbol kind.  */
-  yysymbol_kind_t yytoken = YYSYMBOL_YYEMPTY;
-  /* The variables used to return semantic value and location from the
-     action routines.  */
-  YYSTYPE yyval;
-
-  /* Buffer for error messages, and its allocated size.  */
-  char yymsgbuf[128];
-  char *yymsg = yymsgbuf;
-  YYPTRDIFF_T yymsg_alloc = sizeof yymsgbuf;
-
-#define YYPOPSTACK(N)   (yyvsp -= (N), yyssp -= (N))
-
-  /* The number of symbols on the RHS of the reduced rule.
-     Keep to zero when no symbol should be popped.  */
-  int yylen = 0;
-
-  YYDPRINTF ((stderr, "Starting parse\n"));
-
-  yychar = YYEMPTY; /* Cause a token to be read.  */
-
-  goto yysetstate;
-
-
-/*------------------------------------------------------------.
-| yynewstate -- push a new state, which is found in yystate.  |
-`------------------------------------------------------------*/
-yynewstate:
-  /* In all cases, when you get here, the value and location stacks
-     have just been pushed.  So pushing a state here evens the stacks.  */
-  yyssp++;
-
-
-/*--------------------------------------------------------------------.
-| yysetstate -- set current state (the top of the stack) to yystate.  |
-`--------------------------------------------------------------------*/
-yysetstate:
-  YYDPRINTF ((stderr, "Entering state %d\n", yystate));
-  YY_ASSERT (0 <= yystate && yystate < YYNSTATES);
-  YY_IGNORE_USELESS_CAST_BEGIN
-  *yyssp = YY_CAST (yy_state_t, yystate);
-  YY_IGNORE_USELESS_CAST_END
-  YY_STACK_PRINT (yyss, yyssp);
-
-  if (yyss + yystacksize - 1 <= yyssp)
-#if !defined yyoverflow && !defined YYSTACK_RELOCATE
-    YYNOMEM;
-#else
-    {
-      /* Get the current used size of the three stacks, in elements.  */
-      YYPTRDIFF_T yysize = yyssp - yyss + 1;
-
-# if defined yyoverflow
-      {
-        /* Give user a chance to reallocate the stack.  Use copies of
-           these so that the &'s don't force the real ones into
-           memory.  */
-        yy_state_t *yyss1 = yyss;
-        YYSTYPE *yyvs1 = yyvs;
-
-        /* Each stack pointer address is followed by the size of the
-           data in use in that stack, in bytes.  This used to be a
-           conditional around just the two extra args, but that might
-           be undefined if yyoverflow is a macro.  */
-        yyoverflow (YY_("memory exhausted"),
-                    &yyss1, yysize * YYSIZEOF (*yyssp),
-                    &yyvs1, yysize * YYSIZEOF (*yyvsp),
-                    &yystacksize);
-        yyss = yyss1;
-        yyvs = yyvs1;
-      }
-# else /* defined YYSTACK_RELOCATE */
-      /* Extend the stack our own way.  */
-      if (YYMAXDEPTH <= yystacksize)
-        YYNOMEM;
-      yystacksize *= 2;
-      if (YYMAXDEPTH < yystacksize)
-        yystacksize = YYMAXDEPTH;
-
-      {
-        yy_state_t *yyss1 = yyss;
-        union yyalloc *yyptr =
-          YY_CAST (union yyalloc *,
-                   YYSTACK_ALLOC (YY_CAST (YYSIZE_T, YYSTACK_BYTES (yystacksize))));
-        if (! yyptr)
-          YYNOMEM;
-        YYSTACK_RELOCATE (yyss_alloc, yyss);
-        YYSTACK_RELOCATE (yyvs_alloc, yyvs);
-#  undef YYSTACK_RELOCATE
-        if (yyss1 != yyssa)
-          YYSTACK_FREE (yyss1);
-      }
-# endif
-
-      yyssp = yyss + yysize - 1;
-      yyvsp = yyvs + yysize - 1;
-
-      YY_IGNORE_USELESS_CAST_BEGIN
-      YYDPRINTF ((stderr, "Stack size increased to %ld\n",
-                  YY_CAST (long, yystacksize)));
-      YY_IGNORE_USELESS_CAST_END
-
-      if (yyss + yystacksize - 1 <= yyssp)
-        YYABORT;
-    }
-#endif /* !defined yyoverflow && !defined YYSTACK_RELOCATE */
-
-
-  if (yystate == YYFINAL)
-    YYACCEPT;
-
-  goto yybackup;
-
-
-/*-----------.
-| yybackup.  |
-`-----------*/
-yybackup:
-  /* Do appropriate processing given the current state.  Read a
-     lookahead token if we need one and don't already have one.  */
-
-  /* First try to decide what to do without reference to lookahead token.  */
-  yyn = yypact[yystate];
-  if (yypact_value_is_default (yyn))
-    goto yydefault;
-
-  /* Not known => get a lookahead token if don't already have one.  */
-
-  /* YYCHAR is either empty, or end-of-input, or a valid lookahead.  */
-  if (yychar == YYEMPTY)
-    {
-      YYDPRINTF ((stderr, "Reading a token\n"));
-      yychar = yylex ();
-    }
-
-  if (yychar <= YYEOF)
-    {
-      yychar = YYEOF;
-      yytoken = YYSYMBOL_YYEOF;
-      YYDPRINTF ((stderr, "Now at end of input.\n"));
-    }
-  else if (yychar == YYerror)
-    {
-      /* The scanner already issued an error message, process directly
-         to error recovery.  But do not keep the error token as
-         lookahead, it is too special and may lead us to an endless
-         loop in error recovery. */
-      yychar = YYUNDEF;
-      yytoken = YYSYMBOL_YYerror;
-      goto yyerrlab1;
-    }
-  else
-    {
-      yytoken = YYTRANSLATE (yychar);
-      YY_SYMBOL_PRINT ("Next token is", yytoken, &yylval, &yylloc);
-    }
-
-  /* If the proper action on seeing token YYTOKEN is to reduce or to
-     detect an error, take that action.  */
-  yyn += yytoken;
-  if (yyn < 0 || YYLAST < yyn || yycheck[yyn] != yytoken)
-    goto yydefault;
-  yyn = yytable[yyn];
-  if (yyn <= 0)
-    {
-      if (yytable_value_is_error (yyn))
-        goto yyerrlab;
-      yyn = -yyn;
-      goto yyreduce;
-    }
-
-  /* Count tokens shifted since error; after three, turn off error
-     status.  */
-  if (yyerrstatus)
-    yyerrstatus--;
-
-  /* Shift the lookahead token.  */
-  YY_SYMBOL_PRINT ("Shifting", yytoken, &yylval, &yylloc);
-  yystate = yyn;
-  YY_IGNORE_MAYBE_UNINITIALIZED_BEGIN
-  *++yyvsp = yylval;
-  YY_IGNORE_MAYBE_UNINITIALIZED_END
-
-  /* Discard the shifted token.  */
-  yychar = YYEMPTY;
-  goto yynewstate;
-
-
-/*-----------------------------------------------------------.
-| yydefault -- do the default action for the current state.  |
-`-----------------------------------------------------------*/
-yydefault:
-  yyn = yydefact[yystate];
-  if (yyn == 0)
-    goto yyerrlab;
-  goto yyreduce;
-
-
-/*-----------------------------.
-| yyreduce -- do a reduction.  |
-`-----------------------------*/
-yyreduce:
-  /* yyn is the number of a rule to reduce with.  */
-  yylen = yyr2[yyn];
-
-  /* If YYLEN is nonzero, implement the default value of the action:
-     '$$ = $1'.
-
-     Otherwise, the following line sets YYVAL to garbage.
-     This behavior is undocumented and Bison
-     users should not rely upon it.  Assigning to YYVAL
-     unconditionally makes the parser a bit smaller, and it avoids a
-     GCC warning that YYVAL may be used uninitialized.  */
-  yyval = yyvsp[1-yylen];
-
-
-  YY_REDUCE_PRINT (yyn);
-  switch (yyn)
-    {
-  case 2: /* rc: %empty  */
-#line 38 "sys/cmd/rc/syntax.y"
-            { return 0; }
-#line 1549 "sys/cmd/rc/parse.c"
-    break;
-
-  case 3: /* rc: line '\n'  */
-#line 39 "sys/cmd/rc/syntax.y"
-            { return compile((yyvsp[-1].tree)); }
-#line 1555 "sys/cmd/rc/parse.c"
-    break;
-
-  case 5: /* line: cmds line  */
-#line 43 "sys/cmd/rc/syntax.y"
-            { (yyval.tree) = maketree2(';', (yyvsp[-1].tree), (yyvsp[0].tree)); }
-#line 1561 "sys/cmd/rc/parse.c"
-    break;
-
-  case 7: /* body: cmdsln body  */
-#line 47 "sys/cmd/rc/syntax.y"
-              { (yyval.tree) = maketree2(';', (yyvsp[-1].tree), (yyvsp[0].tree)); }
-#line 1567 "sys/cmd/rc/parse.c"
-    break;
-
-  case 8: /* paren: '(' body ')'  */
-#line 50 "sys/cmd/rc/syntax.y"
-               { (yyval.tree) = maketree1(Tparen, (yyvsp[-1].tree)); }
-#line 1573 "sys/cmd/rc/parse.c"
-    break;
-
-  case 9: /* block: '{' body '}'  */
-#line 53 "sys/cmd/rc/syntax.y"
-               { (yyval.tree) = maketree1(Tblock, (yyvsp[-1].tree)); }
-#line 1579 "sys/cmd/rc/parse.c"
-    break;
-
-  case 11: /* cmds: cmd '&'  */
-#line 57 "sys/cmd/rc/syntax.y"
-          { (yyval.tree) = maketree1('&', (yyvsp[-1].tree)); }
-#line 1585 "sys/cmd/rc/parse.c"
-    break;
-
-  case 14: /* ifbody: cmd  */
-#line 64 "sys/cmd/rc/syntax.y"
-                     { (yyval.tree) = maketree2(Tif, nil, (yyvsp[0].tree)); }
-#line 1591 "sys/cmd/rc/parse.c"
-    break;
-
-  case 15: /* ifbody: block Telse nl cmd  */
-#line 65 "sys/cmd/rc/syntax.y"
-                     { (yyval.tree) = maketree3(Tif, nil, (yyvsp[-3].tree), (yyvsp[-2].tree)); }
-#line 1597 "sys/cmd/rc/parse.c"
-    break;
-
-  case 16: /* case: Tcase words ';'  */
-#line 68 "sys/cmd/rc/syntax.y"
-                     { (yyval.tree) = hangchild1((yyvsp[-2].tree), (yyvsp[-1].tree), 0); }
-#line 1603 "sys/cmd/rc/parse.c"
-    break;
-
-  case 17: /* case: Tcase words '\n'  */
-#line 69 "sys/cmd/rc/syntax.y"
-                     { (yyval.tree) = hangchild1((yyvsp[-2].tree), (yyvsp[-1].tree), 0); }
-#line 1609 "sys/cmd/rc/parse.c"
-    break;
-
-  case 18: /* casebody: cmd  */
-#line 72 "sys/cmd/rc/syntax.y"
-                     { (yyval.tree) = maketree2(Tcasebody, (yyvsp[0].tree), nil); }
-#line 1615 "sys/cmd/rc/parse.c"
-    break;
-
-  case 19: /* casebody: case casebody  */
-#line 73 "sys/cmd/rc/syntax.y"
-                     { (yyval.tree) = maketree2(Tcasebody, (yyvsp[-1].tree), (yyvsp[0].tree)); }
-#line 1621 "sys/cmd/rc/parse.c"
-    break;
-
-  case 20: /* casebody: cmdsln casebody  */
-#line 74 "sys/cmd/rc/syntax.y"
-                     { (yyval.tree) = maketree2(Tcasebody, (yyvsp[-1].tree), (yyvsp[0].tree)); }
-#line 1627 "sys/cmd/rc/parse.c"
-    break;
-
-  case 21: /* assign: executable '=' word  */
-#line 77 "sys/cmd/rc/syntax.y"
-                        { (yyval.tree) = maketree2('=', (yyvsp[-2].tree), (yyvsp[0].tree)); }
-#line 1633 "sys/cmd/rc/parse.c"
-    break;
-
-  case 23: /* redir: Tredir word  */
-#line 81 "sys/cmd/rc/syntax.y"
-                           { (yyval.tree) = hangchild1((yyvsp[-1].tree), (yyvsp[0].tree), 0); }
-#line 1639 "sys/cmd/rc/parse.c"
-    break;
-
-  case 24: /* epilog: %empty  */
-#line 84 "sys/cmd/rc/syntax.y"
-                { (yyval.tree) = nil; }
-#line 1645 "sys/cmd/rc/parse.c"
-    break;
-
-  case 25: /* epilog: redir epilog  */
-#line 85 "sys/cmd/rc/syntax.y"
-                { (yyval.tree) = hangchild1((yyvsp[-1].tree), (yyvsp[0].tree), 1); }
-#line 1651 "sys/cmd/rc/parse.c"
-    break;
-
-  case 26: /* cmd: %empty  */
-#line 88 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = nil; }
-#line 1657 "sys/cmd/rc/parse.c"
-    break;
-
-  case 27: /* cmd: basic  */
-#line 89 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = maketree1(Tbasic, (yyvsp[0].tree)); }
-#line 1663 "sys/cmd/rc/parse.c"
-    break;
-
-  case 28: /* cmd: block epilog  */
-#line 90 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = hangepilog((yyvsp[-1].tree), (yyvsp[0].tree)); }
-#line 1669 "sys/cmd/rc/parse.c"
-    break;
-
-  case 29: /* cmd: cmd Tpipe nl cmd  */
-#line 91 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = hangchild2((yyvsp[-2].tree), (yyvsp[-3].tree), 0, (yyvsp[0].tree), 1); }
-#line 1675 "sys/cmd/rc/parse.c"
-    break;
-
-  case 30: /* cmd: cmd Tandand nl cmd  */
-#line 92 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = maketree2(Tandand, (yyvsp[-3].tree), (yyvsp[0].tree)); }
-#line 1681 "sys/cmd/rc/parse.c"
-    break;
-
-  case 31: /* cmd: cmd Toror nl cmd  */
-#line 93 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = maketree2(Toror, (yyvsp[-3].tree), (yyvsp[0].tree)); }
-#line 1687 "sys/cmd/rc/parse.c"
-    break;
-
-  case 32: /* cmd: redir cmd  */
-#line 94 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = hangchild1((yyvsp[-1].tree), (yyvsp[0].tree), 1); }
-#line 1693 "sys/cmd/rc/parse.c"
-    break;
-
-  case 33: /* cmd: assign cmd  */
-#line 95 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = hangchild1((yyvsp[-1].tree), (yyvsp[0].tree), 2); }
-#line 1699 "sys/cmd/rc/parse.c"
-    break;
-
-  case 34: /* cmd: Tbang cmd  */
-#line 96 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = maketree1(Tbang, (yyvsp[0].tree)); }
-#line 1705 "sys/cmd/rc/parse.c"
-    break;
-
-  case 35: /* cmd: Tsubshell cmd  */
-#line 97 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = maketree1(Tsubshell, (yyvsp[0].tree)); }
-#line 1711 "sys/cmd/rc/parse.c"
-    break;
-
-  case 36: /* cmd: Tfor '(' word ')' nl cmd  */
-#line 98 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = hangchild3((yyvsp[-5].tree), (yyvsp[-3].tree), nil, (yyvsp[0].tree)); }
-#line 1717 "sys/cmd/rc/parse.c"
-    break;
-
-  case 37: /* cmd: Tfor '(' word Tin words ')' nl cmd  */
-#line 99 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = hangchild3((yyvsp[-7].tree), (yyvsp[-5].tree), (yyvsp[-3].tree), (yyvsp[0].tree)); }
-#line 1723 "sys/cmd/rc/parse.c"
-    break;
-
-  case 38: /* cmd: Twhile paren nl cmd  */
-#line 100 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = hangchild2((yyvsp[-3].tree), (yyvsp[-2].tree), 0, (yyvsp[0].tree), 1); }
-#line 1729 "sys/cmd/rc/parse.c"
-    break;
-
-  case 39: /* cmd: Tif paren nl ifbody  */
-#line 101 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = hangchild1((yyvsp[-2].tree), (yyvsp[-3].tree), 0); }
-#line 1735 "sys/cmd/rc/parse.c"
-    break;
-
-  case 40: /* cmd: Tswitch '(' word ')' nl '{' casebody '}'  */
-#line 102 "sys/cmd/rc/syntax.y"
-                                           { (yyval.tree) = hangchild2((yyvsp[-7].tree), (yyvsp[-5].tree), 0, (yyvsp[-1].tree), 1); }
-#line 1741 "sys/cmd/rc/parse.c"
-    break;
-
-  case 42: /* basic: basic word  */
-#line 106 "sys/cmd/rc/syntax.y"
-                { (yyval.tree) = maketree2(Targs, (yyvsp[-1].tree), (yyvsp[0].tree)); }
-#line 1747 "sys/cmd/rc/parse.c"
-    break;
-
-  case 43: /* basic: basic redir  */
-#line 107 "sys/cmd/rc/syntax.y"
-                { (yyval.tree) = maketree2(Targs, (yyvsp[-1].tree), (yyvsp[0].tree)); }
-#line 1753 "sys/cmd/rc/parse.c"
-    break;
-
-  case 45: /* atom: keyword  */
-#line 111 "sys/cmd/rc/syntax.y"
-                      { (yyval.tree) = maketree1(Tword, (yyvsp[0].tree)); }
-#line 1759 "sys/cmd/rc/parse.c"
-    break;
-
-  case 47: /* word: word '^' atom  */
-#line 115 "sys/cmd/rc/syntax.y"
-                      { (yyval.tree) = maketree2('^', (yyvsp[-2].tree), (yyvsp[0].tree)); }
-#line 1765 "sys/cmd/rc/parse.c"
-    break;
-
-  case 49: /* executable: executable '^' atom  */
-#line 119 "sys/cmd/rc/syntax.y"
-                      { (yyval.tree) = maketree2('^', (yyvsp[-2].tree), (yyvsp[0].tree)); }
-#line 1771 "sys/cmd/rc/parse.c"
-    break;
-
-  case 51: /* nonkeyword: '$' atom  */
-#line 123 "sys/cmd/rc/syntax.y"
-                            { (yyval.tree) = maketree1('$', (yyvsp[0].tree)); }
-#line 1777 "sys/cmd/rc/parse.c"
-    break;
-
-  case 52: /* nonkeyword: '$' atom Tindex words ')'  */
-#line 124 "sys/cmd/rc/syntax.y"
-                            { (yyval.tree) = maketree2(Tindex, (yyvsp[-3].tree), (yyvsp[-1].tree)); }
-#line 1783 "sys/cmd/rc/parse.c"
-    break;
-
-  case 53: /* nonkeyword: '(' wordsnl ')'  */
-#line 125 "sys/cmd/rc/syntax.y"
-                            { (yyval.tree) = (yyvsp[-1].tree); }
-#line 1789 "sys/cmd/rc/parse.c"
-    break;
-
-  case 54: /* nonkeyword: Tcount atom  */
-#line 126 "sys/cmd/rc/syntax.y"
-                            { (yyval.tree) = maketree1(Tcount, (yyvsp[0].tree)); }
-#line 1795 "sys/cmd/rc/parse.c"
-    break;
-
-  case 55: /* nonkeyword: Tjoin atom  */
-#line 127 "sys/cmd/rc/syntax.y"
-                            { (yyval.tree) = maketree1(Tjoin, (yyvsp[0].tree)); }
-#line 1801 "sys/cmd/rc/parse.c"
-    break;
-
-  case 56: /* nonkeyword: '`' block  */
-#line 128 "sys/cmd/rc/syntax.y"
-                            { (yyval.tree) = maketree1('`', (yyvsp[0].tree)); }
-#line 1807 "sys/cmd/rc/parse.c"
-    break;
-
-  case 67: /* words: %empty  */
-#line 135 "sys/cmd/rc/syntax.y"
-             { (yyval.tree) = nil; }
-#line 1813 "sys/cmd/rc/parse.c"
-    break;
-
-  case 68: /* words: words word  */
-#line 136 "sys/cmd/rc/syntax.y"
-             { (yyval.tree) = maketree2(Twords, (yyvsp[-1].tree), (yyvsp[0].tree)); }
-#line 1819 "sys/cmd/rc/parse.c"
-    break;
-
-  case 69: /* wordsnl: %empty  */
-#line 139 "sys/cmd/rc/syntax.y"
-               { (yyval.tree) = nil; }
-#line 1825 "sys/cmd/rc/parse.c"
-    break;
-
-  case 71: /* wordsnl: wordsnl word  */
-#line 141 "sys/cmd/rc/syntax.y"
-               {(yyval.tree) = (!(yyvsp[-1].tree)) ? ((!(yyvsp[0].tree)) ? nil : (yyvsp[0].tree)) : ((!(yyvsp[0].tree)) ? (yyvsp[-1].tree) : maketree2(Twords, (yyvsp[-1].tree), (yyvsp[0].tree))); }
-#line 1831 "sys/cmd/rc/parse.c"
-    break;
-
-
-#line 1835 "sys/cmd/rc/parse.c"
-
-      default: break;
-    }
-  /* User semantic actions sometimes alter yychar, and that requires
-     that yytoken be updated with the new translation.  We take the
-     approach of translating immediately before every use of yytoken.
-     One alternative is translating here after every semantic action,
-     but that translation would be missed if the semantic action invokes
-     YYABORT, YYACCEPT, or YYERROR immediately after altering yychar or
-     if it invokes YYBACKUP.  In the case of YYABORT or YYACCEPT, an
-     incorrect destructor might then be invoked immediately.  In the
-     case of YYERROR or YYBACKUP, subsequent parser actions might lead
-     to an incorrect destructor call or verbose syntax error message
-     before the lookahead is translated.  */
-  YY_SYMBOL_PRINT ("-> $$ =", YY_CAST (yysymbol_kind_t, yyr1[yyn]), &yyval, &yyloc);
-
-  YYPOPSTACK (yylen);
-  yylen = 0;
-
-  *++yyvsp = yyval;
-
-  /* Now 'shift' the result of the reduction.  Determine what state
-     that goes to, based on the state we popped back to and the rule
-     number reduced by.  */
-  {
-    const int yylhs = yyr1[yyn] - YYNTOKENS;
-    const int yyi = yypgoto[yylhs] + *yyssp;
-    yystate = (0 <= yyi && yyi <= YYLAST && yycheck[yyi] == *yyssp
-               ? yytable[yyi]
-               : yydefgoto[yylhs]);
-  }
-
-  goto yynewstate;
-
-
-/*--------------------------------------.
-| yyerrlab -- here on detecting error.  |
-`--------------------------------------*/
-yyerrlab:
-  /* Make sure we have latest lookahead translation.  See comments at
-     user semantic actions for why this is necessary.  */
-  yytoken = yychar == YYEMPTY ? YYSYMBOL_YYEMPTY : YYTRANSLATE (yychar);
-  /* If not already recovering from an error, report this error.  */
-  if (!yyerrstatus)
-    {
-      ++yynerrs;
-      {
-        yypcontext_t yyctx
-          = {yyssp, yytoken};
-        char const *yymsgp = YY_("syntax error");
-        int yysyntax_error_status;
-        yysyntax_error_status = yysyntax_error (&yymsg_alloc, &yymsg, &yyctx);
-        if (yysyntax_error_status == 0)
-          yymsgp = yymsg;
-        else if (yysyntax_error_status == -1)
-          {
-            if (yymsg != yymsgbuf)
-              YYSTACK_FREE (yymsg);
-            yymsg = YY_CAST (char *,
-                             YYSTACK_ALLOC (YY_CAST (YYSIZE_T, yymsg_alloc)));
-            if (yymsg)
-              {
-                yysyntax_error_status
-                  = yysyntax_error (&yymsg_alloc, &yymsg, &yyctx);
-                yymsgp = yymsg;
-              }
-            else
-              {
-                yymsg = yymsgbuf;
-                yymsg_alloc = sizeof yymsgbuf;
-                yysyntax_error_status = YYENOMEM;
-              }
-          }
-        yyerror (yymsgp);
-        if (yysyntax_error_status == YYENOMEM)
-          YYNOMEM;
-      }
-    }
-
-  if (yyerrstatus == 3)
-    {
-      /* If just tried and failed to reuse lookahead token after an
-         error, discard it.  */
-
-      if (yychar <= YYEOF)
-        {
-          /* Return failure if at end of input.  */
-          if (yychar == YYEOF)
-            YYABORT;
-        }
-      else
-        {
-          yydestruct ("Error: discarding",
-                      yytoken, &yylval);
-          yychar = YYEMPTY;
-        }
-    }
-
-  /* Else will try to reuse lookahead token after shifting the error
-     token.  */
-  goto yyerrlab1;
-
-
-/*---------------------------------------------------.
-| yyerrorlab -- error raised explicitly by YYERROR.  |
-`---------------------------------------------------*/
-yyerrorlab:
-  /* Pacify compilers when the user code never invokes YYERROR and the
-     label yyerrorlab therefore never appears in user code.  */
-  if (0)
-    YYERROR;
-  ++yynerrs;
-
-  /* Do not reclaim the symbols of the rule whose action triggered
-     this YYERROR.  */
-  YYPOPSTACK (yylen);
-  yylen = 0;
-  YY_STACK_PRINT (yyss, yyssp);
-  yystate = *yyssp;
-  goto yyerrlab1;
-
-
-/*-------------------------------------------------------------.
-| yyerrlab1 -- common code for both syntax error and YYERROR.  |
-`-------------------------------------------------------------*/
-yyerrlab1:
-  yyerrstatus = 3;      /* Each real token shifted decrements this.  */
-
-  /* Pop stack until we find a state that shifts the error token.  */
-  for (;;)
-    {
-      yyn = yypact[yystate];
-      if (!yypact_value_is_default (yyn))
-        {
-          yyn += YYSYMBOL_YYerror;
-          if (0 <= yyn && yyn <= YYLAST && yycheck[yyn] == YYSYMBOL_YYerror)
-            {
-              yyn = yytable[yyn];
-              if (0 < yyn)
-                break;
-            }
-        }
-
-      /* Pop the current state because it cannot handle the error token.  */
-      if (yyssp == yyss)
-        YYABORT;
-
-
-      yydestruct ("Error: popping",
-                  YY_ACCESSING_SYMBOL (yystate), yyvsp);
-      YYPOPSTACK (1);
-      yystate = *yyssp;
-      YY_STACK_PRINT (yyss, yyssp);
-    }
-
-  YY_IGNORE_MAYBE_UNINITIALIZED_BEGIN
-  *++yyvsp = yylval;
-  YY_IGNORE_MAYBE_UNINITIALIZED_END
-
-
-  /* Shift the error token.  */
-  YY_SYMBOL_PRINT ("Shifting", YY_ACCESSING_SYMBOL (yyn), yyvsp, yylsp);
-
-  yystate = yyn;
-  goto yynewstate;
-
-
-/*-------------------------------------.
-| yyacceptlab -- YYACCEPT comes here.  |
-`-------------------------------------*/
-yyacceptlab:
-  yyresult = 0;
-  goto yyreturnlab;
-
-
-/*-----------------------------------.
-| yyabortlab -- YYABORT comes here.  |
-`-----------------------------------*/
-yyabortlab:
-  yyresult = 1;
-  goto yyreturnlab;
-
-
-/*-----------------------------------------------------------.
-| yyexhaustedlab -- YYNOMEM (memory exhaustion) comes here.  |
-`-----------------------------------------------------------*/
-yyexhaustedlab:
-  yyerror (YY_("memory exhausted"));
-  yyresult = 2;
-  goto yyreturnlab;
-
-
-/*----------------------------------------------------------.
-| yyreturnlab -- parsing is finished, clean up and return.  |
-`----------------------------------------------------------*/
-yyreturnlab:
-  if (yychar != YYEMPTY)
-    {
-      /* Make sure we have latest lookahead translation.  See comments at
-         user semantic actions for why this is necessary.  */
-      yytoken = YYTRANSLATE (yychar);
-      yydestruct ("Cleanup: discarding lookahead",
-                  yytoken, &yylval);
-    }
-  /* Do not reclaim the symbols of the rule whose action triggered
-     this YYABORT or YYACCEPT.  */
-  YYPOPSTACK (yylen);
-  YY_STACK_PRINT (yyss, yyssp);
-  while (yyssp != yyss)
-    {
-      yydestruct ("Cleanup: popping",
-                  YY_ACCESSING_SYMBOL (+*yyssp), yyvsp);
-      YYPOPSTACK (1);
-    }
-#ifndef yyoverflow
-  if (yyss != yyssa)
-    YYSTACK_FREE (yyss);
-#endif
-  if (yymsg != yymsgbuf)
-    YYSTACK_FREE (yymsg);
-  return yyresult;
-}
-
-#line 147 "sys/cmd/rc/syntax.y"
-
diff --git a/sys/cmd/rc/parse.h b/sys/cmd/rc/parse.h
deleted file mode 100644
index 64ee07b..0000000
--- a/sys/cmd/rc/parse.h
+++ /dev/null
@@ -1,141 +0,0 @@
-/* A Bison parser, made by GNU Bison 3.8.2.  */
-
-/* Bison interface for Yacc-like parsers in C
-
-   Copyright (C) 1984, 1989-1990, 2000-2015, 2018-2021 Free Software Foundation,
-   Inc.
-
-   This program is free software: you can redistribute it and/or modify
-   it under the terms of the GNU General Public License as published by
-   the Free Software Foundation, either version 3 of the License, or
-   (at your option) any later version.
-
-   This program is distributed in the hope that it will be useful,
-   but WITHOUT ANY WARRANTY; without even the implied warranty of
-   MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
-   GNU General Public License for more details.
-
-   You should have received a copy of the GNU General Public License
-   along with this program.  If not, see <https://www.gnu.org/licenses/>.  */
-
-/* As a special exception, you may create a larger work that contains
-   part or all of the Bison parser skeleton and distribute that work
-   under terms of your choice, so long as that work isn't itself a
-   parser generator using the skeleton or a modified version thereof
-   as a parser skeleton.  Alternatively, if you modify or redistribute
-   the parser skeleton itself, you may (at your option) remove this
-   special exception, which will cause the skeleton and the resulting
-   Bison output files to be licensed under the GNU General Public
-   License without this special exception.
-
-   This special exception was added by the Free Software Foundation in
-   version 2.2 of Bison.  */
-
-/* DO NOT RELY ON FEATURES THAT ARE NOT DOCUMENTED in the manual,
-   especially those whose name start with YY_ or yy_.  They are
-   private implementation details that can be changed or removed.  */
-
-#ifndef YY_YY_SYS_CMD_RC_PARSE_H_INCLUDED
-# define YY_YY_SYS_CMD_RC_PARSE_H_INCLUDED
-/* Debug traces.  */
-#ifndef YYDEBUG
-# define YYDEBUG 0
-#endif
-#if YYDEBUG
-extern int yydebug;
-#endif
-
-/* Token kinds.  */
-#ifndef YYTOKENTYPE
-# define YYTOKENTYPE
-  enum yytokentype
-  {
-    YYEMPTY = -2,
-    YYEOF = 0,                     /* "end of file"  */
-    YYerror = 256,                 /* error  */
-    YYUNDEF = 257,                 /* "invalid token"  */
-    Tfor = 258,                    /* Tfor  */
-    Tin = 259,                     /* Tin  */
-    Twhile = 260,                  /* Twhile  */
-    Tif = 261,                     /* Tif  */
-    Telse = 262,                   /* Telse  */
-    Tswitch = 263,                 /* Tswitch  */
-    Tcase = 264,                   /* Tcase  */
-    Tcasebody = 265,               /* Tcasebody  */
-    Ttwiddle = 266,                /* Ttwiddle  */
-    Tbang = 267,                   /* Tbang  */
-    Tsubshell = 268,               /* Tsubshell  */
-    Tfunc = 269,                   /* Tfunc  */
-    Tredir = 270,                  /* Tredir  */
-    Tdup = 271,                    /* Tdup  */
-    Tpipe = 272,                   /* Tpipe  */
-    Tindex = 273,                  /* Tindex  */
-    Tbasic = 274,                  /* Tbasic  */
-    Targs = 275,                   /* Targs  */
-    Tword = 276,                   /* Tword  */
-    Twords = 277,                  /* Twords  */
-    Tparen = 278,                  /* Tparen  */
-    Tblock = 279,                  /* Tblock  */
-    Tandand = 280,                 /* Tandand  */
-    Toror = 281,                   /* Toror  */
-    Tcount = 282,                  /* Tcount  */
-    Tjoin = 283                    /* Tjoin  */
-  };
-  typedef enum yytokentype yytoken_kind_t;
-#endif
-/* Token kinds.  */
-#define YYEMPTY -2
-#define YYEOF 0
-#define YYerror 256
-#define YYUNDEF 257
-#define Tfor 258
-#define Tin 259
-#define Twhile 260
-#define Tif 261
-#define Telse 262
-#define Tswitch 263
-#define Tcase 264
-#define Tcasebody 265
-#define Ttwiddle 266
-#define Tbang 267
-#define Tsubshell 268
-#define Tfunc 269
-#define Tredir 270
-#define Tdup 271
-#define Tpipe 272
-#define Tindex 273
-#define Tbasic 274
-#define Targs 275
-#define Tword 276
-#define Twords 277
-#define Tparen 278
-#define Tblock 279
-#define Tandand 280
-#define Toror 281
-#define Tcount 282
-#define Tjoin 283
-
-/* Value type.  */
-#if ! defined YYSTYPE && ! defined YYSTYPE_IS_DECLARED
-union YYSTYPE
-{
-#line 24 "sys/cmd/rc/syntax.y"
-
-    struct Tree *tree;
-
-#line 127 "sys/cmd/rc/parse.h"
-
-};
-typedef union YYSTYPE YYSTYPE;
-# define YYSTYPE_IS_TRIVIAL 1
-# define YYSTYPE_IS_DECLARED 1
-#endif
-
-
-extern YYSTYPE yylval;
-
-
-int yyparse (void);
-
-
-#endif /* !YY_YY_SYS_CMD_RC_PARSE_H_INCLUDED  */
diff --git a/sys/cmd/rc/prompt.c b/sys/cmd/rc/prompt.c
deleted file mode 100644
index 1122d54..0000000
--- a/sys/cmd/rc/prompt.c
+++ /dev/null
@@ -1,36 +0,0 @@
-#include "rc.h"
-
-/* static char promptbuf[7] = {'>', ' ', 0, ' ' , ' ', ' ', 0}; */
-static char *base= "\x1b[1;31m" ">" "\x1b[0;0m" " ", *promptstr;
-
-void
-resetprompt(void)
-{
-    promptstr = base;
-}
-
-int
-prompt(ushort *flag)
-{
-    int f = *flag;
-
-    if(f){
-        if(!readline(promptstr)){
-            runner->flag.eof = 1;
-            return 0;
-        }
-        if(runner->cmd.io->e[-1] == '\n'){
-            runner->cmd.io->e[-1] = 0;
-            addhistory(runner->cmd.io->b);
-            runner->cmd.io->e[-1] = '\n';
-        }
-
-        write(mapfd(0), "\n\r", 2);
-        promptstr = "    ";
-
-        runner->line++;
-        *flag = 0;
-    }
-
-    return 1;
-}
diff --git a/sys/cmd/rc/rc.h b/sys/cmd/rc/rc.h
deleted file mode 100644
index 9b415fc..0000000
--- a/sys/cmd/rc/rc.h
+++ /dev/null
@@ -1,263 +0,0 @@
-
-#include <u.h>
-#include <base.h>
-#include <libutf.h>
-
-// -----------------------------------------------------------------------
-// types
-
-typedef struct Io     Io;
-typedef struct Var    Var;
-typedef struct Word   Word;
-typedef struct List   List;
-typedef struct Tree   Tree;
-typedef struct Redir  Redir;
-typedef union  Code   Code;
-typedef struct Thread Thread;
-typedef struct Shell  Shell;
-
-struct Io
-{
-    int fd, cap;
-    char *s;
-    char *b, *e, buf[];
-};
-
-enum
-{
-    Rappend,
-    Rwrite,
-    Rread,
-    Rhere,
-    Rdupfd,
-    Ropen,
-    Rclose,
-    Rrdwr
-};
-
-struct Tree
-{
-    int  type;
-    union{
-        struct {
-            ushort quoted;
-            char *str;       // Tword
-        };
-        struct {
-            ushort type; // Tpipe, Tredir, Tdup
-            int fd[2];
-        } redir;
-    };
-    Tree *child[3];
-    Tree *link;
-};
-
-struct Word
-{
-    char *str;
-    Word *link;
-};
-
-struct List
-{
-    Word *word;
-    List *link;
-};
-
-/*
- * the first word of any code vector is a reference count
- * always create a new reference to a code vector by calling copycode()
- * always call freecode() when deleting a reference
- */
-union Code
-{
-    int  i;
-    void (*f)(void);
-    char *s;
-};
-
-struct Var
-{
-    char *name;
-    Word *val;
-    short new     : 1;
-    short newfunc : 1;
-    Code *func;
-    void (*update)(Var *);
-    Var  *link;
-};
-
-struct Redir
-{
-    char type;              /* what to do */
-    short from, to;         /* what to do it to */
-    struct Redir *link;     /* what else to do (reverse order) */
-};
-
-enum
-{
-    Pnil,
-    Prun,
-    Pstop,
-    Psig,
-    Pagain,
-    Pdone,
-};
-
-struct WaitItem
-{
-    int    pid;
-    ushort status;
-};
-
-struct Thread
-{
-    struct {
-        int  i;
-        Code *exe;
-    } code;      // execution stack
-    struct {
-        Io   *io;
-        char *path;
-    } cmd;       // command input
-
-    List  *args;  // argument stack
-    Var   *local; // local variables
-    struct {
-        Redir *start;
-        Redir *end;
-    } redir; // list of redirections
-
-    struct {
-        ushort user : 1;
-        ushort eof  : 1;
-    } flag;
-
-    struct {
-        ushort status;
-        int len, cap;
-        struct WaitItem *on;
-    } wait;
-
-    int  pid, pgid, status;
-    long line;
-
-    Thread *caller; // process we return to
-    Thread *link; // next job
-};
-
-struct Shell
-{
-    int pid;
-    Io *err;
-    int status;
-    int interactive;
-    Thread *jobs;
-};
-
-// -----------------------------------------------------------------------
-// globals
-
-extern Shell shell;
-extern Thread *runner;
-extern Code   *compiled;
-
-// -----------------------------------------------------------------------
-// functions
-
-/* util.c */
-void  itoa(char*, long i);
-void  fatal(char *, ...);
-void *emalloc(uintptr);
-void *erealloc(void*, uintptr);
-void  efree(void*);
-
-/* input.c */
-int  readline(char *);
-void enablevi(void);
-
-void inithistory(void);
-int  addhistory(char *);
-
-/* prompt.c */
-void resetprompt(void);
-int  prompt(ushort *);
-
-/* io.c */
-Io  *openfd(int fd);
-Io  *openstr(void);
-void terminate(Io *io);
-
-int  get(Io *);
-int  put(Io **, char);
-
-void flush(Io *io);
-void print(Io *, char *, ...);
-
-/* lex.c */
-int iswordchar(int c);
-int yylex(void);
-
-/* tree.c */
-Tree *maketree(void);
-Tree *maketree1(int, Tree*);
-Tree *maketree2(int, Tree*, Tree*);
-Tree *maketree3(int, Tree*, Tree*, Tree*);
-
-Tree *token(int, char *);
-Tree *hangchild1(Tree *, Tree *, int);
-Tree *hangchild2(Tree *, Tree *, int, Tree *, int);
-Tree *hangchild3(Tree *, Tree *, Tree *, Tree *);
-Tree *hangepilog(Tree *, Tree*);
-
-void freeparsetree(void);
-
-/* sys.c */
-void initenv(void);
-void redirect(struct Redir *);
-void execute(Word *, Word*);
-int  mapfd(int fd);
-
-/* wait.c */
-void addwait(Thread *, int);
-void delwait(Thread *, int);
-void clearwait(Thread*);
-
-int  waitall(Thread *);
-int  waitfor(Thread *, int);
-
-void killzombies(void);
-
-/* job.c */
-Thread *getjob(int, int*);
-void    addjob(Thread *);
-void    deljob(Thread *);
-void    wakeup(Thread *);
-void    report(Thread *, int);
-
-void foreground(Thread *, int);
-void background(Thread *, int);
-
-/* exec.c */
-// XXX: odd place for this
-int   count(Word *);
-Word  *makeword(char *str, Word *link);
-void   freeword(Word *w);
-
-/* var.c */
-Var *var(char*);
-Var *definevar(char*, Var *);
-Var *globalvar(char*);
-Var *makevar(char *name, Var *link);
-void setvar(char *, Word *);
-int  iskeyword(char *);
-
-void initpath(void);
-void initkeywords(void);
-
-char **mkenv(void);
-
-/* code.c */
-int   compile(Tree *);
-Code *copycode(Code *c);
-void  freecode(Code *c);
diff --git a/sys/cmd/rc/rules.mk b/sys/cmd/rc/rules.mk
deleted file mode 100644
index a2fd058..0000000
--- a/sys/cmd/rc/rules.mk
+++ /dev/null
@@ -1,31 +0,0 @@
-include share/push.mk
-# Iterate through subdirectory tree
-
-# Local sources
-SRCS_$(d) :=\
-	$(d)/util.c\
-	$(d)/input.c\
-	$(d)/prompt.c\
-	$(d)/io.c\
-	$(d)/lex.c\
-	$(d)/parse.c\
-	$(d)/tree.c\
-	$(d)/code.c\
-	$(d)/var.c\
-	$(d)/sys.c\
-	$(d)/wait.c\
-	$(d)/job.c\
-	$(d)/exec.c\
-	$(d)/main.c
-
-BINS_$(d) := $(d)/rc
-
-include share/paths.mk
-$(d)/parse.h $(d)/parse.c: $(d)/syntax.y
-	yacc --header=$(<D)/parse.h --output=$(<D)/parse.c $(<)
-
-# Local rules
-$(BINS_$(d)): $(OBJS_$(d)) $(OBJ_DIR)/sys/libutf/libutf.a $(OBJ_DIR)/sys/base/base.a $(d)/parse.h
-	$(COMPLINK)
-
-include share/pop.mk
diff --git a/sys/cmd/rc/syntax.y b/sys/cmd/rc/syntax.y
deleted file mode 100644
index 0bdc776..0000000
--- a/sys/cmd/rc/syntax.y
+++ /dev/null
@@ -1,147 +0,0 @@
-%token Tfor Tin Twhile Tif Telse Tswitch Tcase Tcasebody Ttwiddle Tbang Tsubshell Tfunc
-%token Tredir Tdup Tpipe Tindex
-%token Tbasic Targs Tword Twords Tparen Tblock
-
-%define parse.error verbose
-
-%{
-    #include "rc.h"
-
-    int  yylex(void);
-    void yyerror(const char *);
-%}
-
-/* operator precendence: lowest first */
-%left Tif Tfor Tswitch Tcase ')' Twhile Telse
-%left Tandand Toror '\n'
-%left Tbang Tsubshell
-%left Tpipe;
-%left '^';
-%right '$' Tcount Tjoin
-%left Tindex
-
-/* semantic types */
-%union{
-    struct Tree *tree;
-}
-%type<tree> line cmds cmdsln body paren block ifbody casebody case assign epilog redir;
-%type<tree> cmd basic executable nonkeyword keyword word words wordsnl atom;
-%type<tree> Tfor Tin Twhile Tif Telse Tswitch Tcase Ttwiddle Tbang Tsubshell Tfunc;
-%type<tree> Tword Tredir Tpipe Tdup;
-
-/* grammar */
-
-%start rc
-
-%%
-rc:
-/*empty*/   { return 0; }
-| line '\n' { return compile($1); }
-
-line:
-  cmd
-| cmds line { $$ = maketree2(';', $1, $2); }
-
-body:
-  cmd
-| cmdsln body { $$ = maketree2(';', $1, $2); }
-
-paren:
-  '(' body ')' { $$ = maketree1(Tparen, $2); }
-
-block:
-  '{' body '}' { $$ = maketree1(Tblock, $2); }
-
-cmds:
-  cmd ';'
-| cmd '&' { $$ = maketree1('&', $1); }
-
-cmdsln:
-  cmds
-| cmd '\n'
-
-ifbody:
-  cmd   %prec Telse  { $$ = maketree2(Tif, nil, $1); }
-| block Telse nl cmd { $$ = maketree3(Tif, nil, $1, $2); }
-
-case:
-  Tcase words ';'    { $$ = hangchild1($1, $2, 0); }
-| Tcase words '\n'   { $$ = hangchild1($1, $2, 0); }
-
-casebody:
-  cmd                { $$ = maketree2(Tcasebody, $1, nil); }
-| case casebody      { $$ = maketree2(Tcasebody, $1, $2); }
-| cmdsln casebody    { $$ = maketree2(Tcasebody, $1, $2); }
-
-assign:
-    executable '=' word { $$ = maketree2('=', $1, $3); }
-
-redir:
-  Tdup
-| Tredir word              { $$ = hangchild1($1, $2, 0); }
-
-epilog:
-/* empty */     { $$ = nil; }
-| redir epilog  { $$ = hangchild1($1, $2, 1); }
-
-cmd:
-/* empty */  %prec Twhile                  { $$ = nil; }
-| basic                                    { $$ = maketree1(Tbasic, $1); }
-| block epilog                             { $$ = hangepilog($1, $2); }
-| cmd Tpipe nl cmd                         { $$ = hangchild2($2, $1, 0, $4, 1); }
-| cmd Tandand nl cmd                       { $$ = maketree2(Tandand, $1, $4); }
-| cmd Toror nl cmd                         { $$ = maketree2(Toror, $1, $4); }
-| redir  cmd %prec Tbang                   { $$ = hangchild1($1, $2, 1); }
-| assign cmd %prec Tbang                   { $$ = hangchild1($1, $2, 2); }
-| Tbang cmd                                { $$ = maketree1(Tbang, $2); }
-| Tsubshell cmd                            { $$ = maketree1(Tsubshell, $2); }
-| Tfor '(' word ')' nl cmd                 { $$ = hangchild3($1, $3, nil, $6); }
-| Tfor '(' word Tin words ')' nl cmd       { $$ = hangchild3($1, $3, $5, $8); }
-| Twhile paren nl cmd                      { $$ = hangchild2($1, $2, 0, $4, 1); }
-| Tif paren nl ifbody                      { $$ = hangchild1($2, $1, 0); }
-| Tswitch '(' word ')' nl '{' casebody '}' { $$ = hangchild2($1, $3, 0, $7, 1); }
-
-basic:
-  executable
-| basic word    { $$ = maketree2(Targs, $1, $2); }
-| basic redir   { $$ = maketree2(Targs, $1, $2); }
-
-atom:
-  nonkeyword
-| keyword             { $$ = maketree1(Tword, $1); }
-
-word:
-  atom
-| word '^' atom       { $$ = maketree2('^', $1, $3); }
-
-executable:
-  nonkeyword
-| executable '^' atom { $$ = maketree2('^', $1, $3); }
-
-nonkeyword:
-  Tword
-| '$' atom                  { $$ = maketree1('$', $2); }
-| '$' atom Tindex words ')' { $$ = maketree2(Tindex, $2, $4); }
-| '(' wordsnl ')'           { $$ = $2; }
-| Tcount atom               { $$ = maketree1(Tcount, $2); }
-| Tjoin atom                { $$ = maketree1(Tjoin, $2); }
-| '`'  block                { $$ = maketree1('`', $2); }
-//| Tredir block    { $$ = hangchild1($1, $2, 0); $$->type = Tpipefd; }
-
-keyword:
-    Tfor|Tin|Twhile|Tif|Telse|Tswitch|Tcase|Tbang|Tsubshell|Tfunc
-
-words:
-/* empty */  { $$ = nil; }
-| words word { $$ = maketree2(Twords, $1, $2); }
-
-wordsnl:
-/* empty */    { $$ = nil; }
-| wordsnl '\n' /* empty */
-| wordsnl word {$$ = (!$1) ? ((!$2) ? nil : $2) : ((!$2) ? $1 : maketree2(Twords, $1, $2)); }
-
-nl:
-/*empty*/
-| nl '\n'
-
-%%
diff --git a/sys/cmd/rc/sys.c b/sys/cmd/rc/sys.c
deleted file mode 100644
index 807359d..0000000
--- a/sys/cmd/rc/sys.c
+++ /dev/null
@@ -1,137 +0,0 @@
-#include "rc.h"
-
-// -----------------------------------------------------------------------
-// internal
-
-static
-char**
-mkargv(Word *args)
-{
-    char **argv=emalloc((count(args)+2)*sizeof(char *));
-    char **argp=argv+1;	/* leave one at front for runcoms */
-
-    for(;args;args=args->link) 
-        *argp++=args->str;
-    *argp=nil;
-
-    return argv;
-}
-
-static
-Word*
-envval(char *s)
-{
-    Word *v;
-    char *t, c;
-
-    for(t=s; *t && *t!='\1'; t++)
-        ;
-
-    c  = *t;
-    *t = '\0';
-
-    v = makeword(s, (c=='\0') ? nil : envval(t+1));
-    *t=c;
-
-    return v;
-}
-
-// -----------------------------------------------------------------------
-// exported
-
-void
-initenv(void)
-{
-    extern char **environ;
-
-    char *s;
-    char **env;
-
-    for(env=environ; *env; env++) {
-        for(s=*env; *s && *s != '(' && *s != '='; s++)
-            ;
-        switch(*s){
-        case '\0':
-            break;
-        case '(': /* ignore functions */
-            break;
-        case '=':
-            *s = '\0';
-            setvar(*env, envval(s+1));
-            *s = '=';
-            break;
-        }
-    }
-}
-
-void
-execute(Word *cmd, Word *path)
-{
-    int nc;
-    char **argv = mkargv(cmd);
-    char **env  = mkenv();
-    char file[1024];
-
-    for(; path; path=path->link){
-        nc = strlen(path->str);
-        if(nc < arrlen(file)){
-            strcpy(file, path->str);
-            if(file[0]){
-                strcat(file, "/");
-                nc++;
-            }
-            if(nc+strlen(argv[1]) < arrlen(file)){
-                strcat(file, argv[1]);
-                execve(file, argv+1, env);
-            }else
-                fatal("command name too long");
-        }
-    }
-    print(shell.err, "could not execute command: %s\n", argv[1]);
-    efree(argv);
-}
-
-void
-redirect(Redir *r)
-{
-    if(r){
-        redirect(r->link);
-        switch(r->type){
-        case Ropen:
-            if(r->from != r->to){
-                dup2(r->from, r->to);
-                close(r->from);
-            }
-            break;
-        case Rdupfd:
-            dup2(r->from, r->to); // TODO: error checking
-            break;
-        case Rclose:
-            close(r->from);
-            break;
-        default:
-            fatal("unrecognized redirection type %d\n", r->type);
-        }
-    }
-}
-
-int
-mapfd(int fd)
-{
-    Redir *r;
-    for(r = runner->redir.end; r; r = r->link){
-        switch(r->type){
-        case Rclose:
-            if(r->from == fd)
-                fd = -1;
-            break;
-        case Rdupfd:
-        case Ropen:
-            if(r->to == fd)
-                fd = r->from;
-            break;
-        }
-    }
-
-    return fd;
-}
diff --git a/sys/cmd/rc/tree.c b/sys/cmd/rc/tree.c
deleted file mode 100644
index 2c65041..0000000
--- a/sys/cmd/rc/tree.c
+++ /dev/null
@@ -1,111 +0,0 @@
-#include "rc.h"
-#include "parse.h"
-
-static Tree *nodes;
-
-Tree*
-maketree(void)
-{
-    Tree *node = emalloc(sizeof(*node));
-
-    node->link = nodes;
-    nodes = node;
-    return node;
-}
-
-void
-freeparsetree(void)
-{
-    Tree *t, *nt;
-    for(t = nodes; t; t = nt) {
-        nt = t->link;
-        if(t->type == Tword && t->str)
-            efree(t->str);
-        efree(t);
-    }
-    nodes = nil;
-}
-
-Tree*
-maketree1(int type, Tree *c0)
-{
-    return maketree2(type, c0, nil);
-}
-
-Tree*
-maketree2(int type, Tree *c0, Tree *c1)
-{
-    return maketree3(type, c0, c1, nil);
-}
-
-Tree*
-maketree3(int type, Tree *c0, Tree *c1, Tree *c2)
-{
-    Tree *node = maketree();
-
-    node->type = type;
-    node->child[0] = c0;
-    node->child[1] = c1;
-    node->child[2] = c2;
-
-    return node;
-}
-
-Tree*
-hangchild1(Tree *node, Tree *c, int i)
-{
-    node->child[i] = c;
-
-    return node;
-}
-
-Tree*
-hangchild2(Tree *node, Tree *c1, int i1, Tree *c2, int i2)
-{
-    node->child[i1] = c1;
-    node->child[i2] = c2;
-
-    return node;
-}
-
-Tree*
-hangchild3(Tree *node, Tree *c0, Tree *c1, Tree *c2)
-{
-    node->child[0] = c0;
-    node->child[1] = c1;
-    node->child[2] = c2;
-
-    return node;
-}
-
-Tree*
-hangepilog(Tree *cmd, Tree *epi)
-{
-    Tree *p;
-    if(!epi)
-        return cmd;
-    for(p = epi; p->child[1]; p = p->child[1])
-        ;
-
-    p->child[1] = cmd;
-    return epi;
-}
-
-Tree*
-token(int type, char *s)
-{
-    Tree *node = maketree();
-
-    node->type = type;
-    node->str = strdup(s);
-
-    return node;
-}
-
-/*
-Tree*
-basic(Tree *node)
-{
-    return maketree1(Tbasic, node);
-}
-*/
diff --git a/sys/cmd/rc/util.c b/sys/cmd/rc/util.c
deleted file mode 100644
index b0be788..0000000
--- a/sys/cmd/rc/util.c
+++ /dev/null
@@ -1,65 +0,0 @@
-#include "rc.h"
-
-void
-fatal(char *msg, ...)
-{
-    va_list args;
-    vfprintf(stderr, msg, args);
-    va_end(args);
-
-    abort();
-}
-
-void*
-emalloc(uintptr n)
-{
-    void *p;
-    if(!(p = malloc(n)))
-        fatal("out of memory: can't allocate %d bytes", n);
-
-    memset(p, 0, n);
-    return p;
-}
-
-void*
-erealloc(void *p, uintptr n)
-{
-    void *r;
-    if(!(r = realloc(p,n)))
-        fatal("out of memory: can't reallocate %d bytes", n);
-
-    return r;
-}
-
-void
-efree(void *p)
-{
-    if(p)
-        free(p);
-    // TODO: log the double free
-}
-
-
-char *bp;
-
-static
-void
-iacvt(int n)
-{
-    if(n<0){
-        *bp++='-';
-        n=-n;	/* doesn't work for n==-inf */
-    }
-    if(n/10)
-        iacvt(n/10);
-
-    *bp++=n%10+'0';
-}
-
-void
-itoa(char *s, long n)
-{
-    bp = s;
-    iacvt(n);
-    *bp='\0';
-}
diff --git a/sys/cmd/rc/var.c b/sys/cmd/rc/var.c
deleted file mode 100644
index 3e9635f..0000000
--- a/sys/cmd/rc/var.c
+++ /dev/null
@@ -1,336 +0,0 @@
-#include "rc.h"
-#include "parse.h"
-
-// TODO: string interning
-
-// -----------------------------------------------------------------------
-// globals
-
-struct Keyword 
-{
-    char *name;
-    int   type;
-};
-
-static Var *globals[512];
-static struct Keyword keywords[100]; // sparse map means less hits
-
-// -----------------------------------------------------------------------
-// internals
-
-static
-int
-hash(char *s, int len)
-{
-    int h =0, i = 1;
-    while(*s)
-        h += *s++*i++;
-
-    h %= len;
-    return h < 0 ? h+len : h;
-}
-
-static
-void
-·setvar(char *name, Word *val, int call)
-{
-    Var *v = var(name);
-    freeword(v->val);
-
-    v->val = val;
-    v->new = 1; // this never turns off?
-
-    if(call && v->update)
-        v->update(v);
-}
-
-static
-char*
-list2strcolon(Word *words)
-{
-    char *value, *s, *t;
-    int len = 0;
-    Word *ap;
-    for(ap = words;ap;ap = ap->link)
-        len+=1+strlen(ap->str);
-
-    value = emalloc(len+1);
-
-    s = value;
-    for(ap = words; ap; ap = ap->link){
-        for(t = ap->str;*t;) *s++=*t++;
-        *s++=':';
-    }
-
-    if(s==value)
-        *s='\0';
-    else 
-        s[-1]='\0';
-
-    return value;
-}
-
-static
-void
-littlepath(Var *v)
-{
-    /* convert $path to $PATH */
-    char *p;
-    Word *w;
-
-    p = list2strcolon(v->val);
-    w = emalloc(sizeof(*w));
-    w->str  = p;
-    w->link = nil;
-
-    ·setvar("PATH", w, 1);
-}
-
-static
-void
-bigpath(Var *v)
-{
-    /* convert $PATH to $path */
-    char *p, *q;
-    Word **l, *w;
-
-    if(v->val == nil){
-        ·setvar("path", nil, 0);
-        return;
-    }
-
-    p = v->val->str;
-    w = nil;
-    l = &w;
-
-    /* Doesn't handle escaped colon nonsense. */
-    if(p[0] == 0)
-        p = nil;
-
-    while(p){
-        q = strchr(p, ':');
-        if(q)
-            *q = 0;
-
-        *l = makeword(p[0] ? p : ".", nil);
-        l  = &(*l)->link;
-
-        if(q){
-            *q = ':';
-            p = q+1;
-        }else
-            p = nil;
-    }
-    ·setvar("path", w, 0);
-}
-
-// -----------------------------------------------------------------------
-// exports
-
-Var*
-makevar(char *name, Var *link)
-{
-    Var *v = emalloc(sizeof(*v));
-
-    v->name    = name;
-    v->val     = 0;
-    v->new     = 0;
-    v->newfunc = 0;
-    v->link    = link;
-    v->func    = nil;
-    v->update  = nil;
-
-    return v;
-}
-
-void
-setvar(char *name, Word *val)
-{
-    ·setvar(name, val, 1);
-}
-
-Var*
-definevar(char *name, Var *link)
-{
-    Var *v = emalloc(sizeof(*v));
-
-    v->name = name;
-    v->val  = 0;
-    v->link = link;
-
-    return v;
-}
-
-Var*
-globalvar(char *name)
-{
-    int  h;
-    Var *v;
-
-    h = hash(name, arrlen(globals));
-
-    if(strcmp(name,"PATH")==0){
-        flush(shell.err);
-    }
-
-    for(v = globals[h]; v; v = v->link){
-        if(strcmp(v->name, name) == 0){
-            return v;
-        }
-    }
-
-    return globals[h] = definevar(strdup(name), globals[h]);
-}
-
-Var*
-var(char *name)
-{
-    Var *v;
-    if(runner){
-        for(v = runner->local; v; v=v->link)
-            if(strcmp(v->name, name) == 0)
-                return v;
-    }
-    return globalvar(name);
-}
-
-static
-int
-cmpenv(const void *a, const void *b)
-{
-    return strcmp(*(char**)a, *(char**)b);
-}
-
-char**
-mkenv(void)
-{
-    char **env, **ep, *p, *q;
-    Var **h, *v;
-    Word *a;
-    int nvar=0, nchr=0, sep;
-
-#define BODY                                \
-        if((v==var(v->name)) && v->val){    \
-            nvar++;                         \
-            nchr+=strlen(v->name)+1;        \
-            for(a=v->val;a;a=a->link)       \
-                nchr+=strlen(a->str)+1;     \
-        }
-
-    for(v= runner->local; v; v=v->link){
-        BODY
-    }
-    for(h=globals; h!=arrend(globals); h++){
-        for(v = *h; v; v=v->link){
-            BODY
-        }
-    }
-
-#undef  BODY
-
-    env=emalloc((nvar+1)*sizeof(*env)+nchr);
-    ep=env;
-    p=(char *)&env[nvar+1];
-
-#define BODY                            \
-    if((v==var(v->name)) && v->val){    \
-        *ep++=p;                        \
-        q=v->name;                      \
-        while(*q)                       \
-            *p++=*q++;                  \
-        sep='=';                        \
-        for(a=v->val;a;a=a->link){      \
-            *p++=sep;                   \
-            sep='\1';                   \
-            q=a->str;                   \
-            while(*q)                   \
-                *p++=*q++;              \
-        }                               \
-        *p++='\0';                      \
-    }
-
-    for(v=runner->local; v; v=v->link){
-        BODY
-    }
-    for(h=globals; h!=arrend(globals); h++){
-        for(v = *h; v; v=v->link){
-            BODY
-        }
-    }
-#undef  BODY
-
-    *ep=0;
-
-    qsort((char *)env, nvar, sizeof ep[0], cmpenv);
-    return env;	
-}
-
-void
-initpath(void)
-{
-    Var *v;
-
-    v = globalvar("path");
-    v->update = littlepath;
-
-    v = globalvar("PATH");
-    v->update = bigpath;
-
-    flush(shell.err);
-    bigpath(v);
-}
-
-#define KEYWORDS \
-    KEYWORD("for",    Tfor) \
-    KEYWORD("in",     Tin) \
-    KEYWORD("while",  Twhile) \
-    KEYWORD("if",     Tif) \
-    KEYWORD("else",   Telse) \
-    KEYWORD("switch", Tswitch) \
-    KEYWORD("case",   Tcase) \
-    KEYWORD("!",      Tbang) \
-    KEYWORD("@",      Tsubshell) \
-    KEYWORD("func",   Tfunc)
-
-void
-initkeywords(void)
-{
-    int i, s, j, h;
-#define KEYWORD(a, b) a,
-    static char *name[]  = { KEYWORDS };
-#undef KEYWORD
-#define KEYWORD(a, b) b,
-    static int type[] = { KEYWORDS };
-#undef KEYWORD
-
-    for(i = 0; i < arrlen(type); i++){
-        h = hash(name[i], arrlen(keywords));
-        for(s=0; s < arrlen(keywords); s++){
-            j = (h + s) % arrlen(keywords);
-            if(!keywords[j].type || strcmp(keywords[j].name, name[i]) == 0){
-                keywords[j].name = name[i];
-                keywords[j].type = type[i];
-                goto nextkeyword;
-            }
-        }
-    nextkeyword:;
-    }
-}
-
-int
-iskeyword(char *word)
-{
-    int i, s, h;
-
-    h = hash(word, arrlen(keywords));
-    for(s = 0; s < arrlen(keywords); s++){
-        i = (h + s) % arrlen(keywords);
-        if(!keywords[i].type)
-            return 0;
-        if(strcmp(keywords[i].name, word) == 0)
-            return keywords[i].type;
-    }
-    return 0;
-}
-
-#undef KEYWORDS
diff --git a/sys/cmd/rc/wait.c b/sys/cmd/rc/wait.c
deleted file mode 100644
index 911601c..0000000
--- a/sys/cmd/rc/wait.c
+++ /dev/null
@@ -1,247 +0,0 @@
-#include "rc.h"
-
-#include <sys/wait.h>
-
-// -----------------------------------------------------------------------
-// globals
-
-struct WaitMsg
-{
-    int pid;
-    int type;
-    ulong time[3];
-    int status;
-};
-
-// -----------------------------------------------------------------------
-// internal
-
-static
-int
-await(int pid4, int opt, struct WaitMsg *msg)
-{
-    int pid, status, core;
-    struct rusage ru;
-    ulong u, s;
-
-    /* event loop */
-    for(;;){
-        if((pid = wait4(pid4, &status, opt, &ru)) <= 0){
-            if(errno == ECHILD){
-                msg->pid = -1;
-                return 1;
-            }
-            msg->pid = 0;
-            perror("failed wait4");
-            return 0;
-        }
-
-        u = ru.ru_utime.tv_sec*1000+((ru.ru_utime.tv_usec+500)/1000);
-        s = ru.ru_stime.tv_sec*1000+((ru.ru_stime.tv_usec+500)/1000);
-
-        if(WIFEXITED(status)){
-            msg->pid     = pid;
-            msg->time[0] = u;
-            msg->time[1] = s;
-            msg->time[2] = u+s;
-            msg->status  = WEXITSTATUS(status);
-            msg->type    = Pdone;
-
-            return 1;
-        }
-
-        if(WIFSIGNALED(status)){
-            msg->pid     = pid;
-            msg->time[0] = u;
-            msg->time[1] = s;
-            msg->time[2] = u+s;
-            msg->status  = WTERMSIG(status);
-            msg->type    = Psig;
-
-            return 1;
-        }
-
-        if(WIFSTOPPED(status)){
-            msg->pid     = pid;
-            msg->time[0] = u;
-            msg->time[1] = s;
-            msg->time[2] = u+s;
-            msg->status  = WSTOPSIG(status);
-            msg->type    = Pstop;
-
-            return 1;
-        }
-    }
-}
-
-static
-int
-shouldwait(Thread *job)
-{
-    int i;
-
-    for(i=0; i<job->wait.len; i++){
-        if(job->wait.on[i].status == Prun)
-            return 1;
-    }
-
-    return 0;
-}
-
-static inline
-void
-notify(Thread *job, struct WaitMsg msg)
-{
-    int i;
-    for(i=0; i < job->wait.len; i++){
-        if(job->wait.on[i].pid == msg.pid){
-            job->status = msg.status;
-            switch(msg.type){
-            case Pstop:
-                print(shell.err, "%d: suspended\n", msg.pid);
-                job->wait.status = Pstop;
-                job->wait.on[i].status = Pstop;
-                break;
-
-            case Psig:
-                print(shell.err, "%d: terminated by signal %d\n", msg.pid, msg.status);
-                /* fallthrough */
-            case Pdone:
-                job->wait.on[i].status = Pdone;
-                delwait(job, msg.pid);
-                if(!job->wait.len)
-                    job->wait.status = Pdone;
-                break;
-
-            default:
-                fatal("%d: unrecognized message type %d\n", msg.pid, msg.type);
-            }
-            break;
-        }
-    }
-}
-
-// -----------------------------------------------------------------------
-// exported
-
-void
-clearwait(Thread *job)
-{
-    job->wait.len = 0;
-}
-
-int
-havewait(Thread *job, int pid)
-{
-    int i;
-
-    for(i=0; i<job->wait.len; i++)
-        if(job->wait.on[i].pid == pid)
-            return 1;
-    return 0;
-}
-
-void
-addwait(Thread *job, int pid)
-{
-    if(job->wait.len == job->wait.cap){
-        job->wait.cap = job->wait.cap + 2;
-        job->wait.on  = erealloc(job->wait.on, job->wait.cap*sizeof(*job->wait.on));
-    }
-
-    job->wait.on[job->wait.len++] = (struct WaitItem){.pid=pid, .status=Prun};
-}
-
-void
-delwait(Thread *job, int pid)
-{
-    int r, w;
-
-    for(r=w=0; r < job->wait.len; r++){
-        if(job->wait.on[r].pid != pid)
-            job->wait.on[w++].pid = job->wait.on[r].pid;
-    }
-    job->wait.len = w;
-}
-
-int
-waitall(Thread *job)
-{
-    int i;
-    Thread *t;
-    struct WaitMsg msg;
-
-    while(shouldwait(job) && await(-job->pgid, WUNTRACED, &msg)){
-        switch(msg.pid){
-        case 0:   // error
-            perror("wait job");
-            return 0;
-        case -1: // no children: assume they have exited
-            job->wait.status = Pdone;
-            clearwait(job);
-            return 1;
-        default:
-            ;
-        }
-
-        notify(job, msg);
-    }
-    return 1;
-}
-
-int
-waitfor(Thread *job, int pid)
-{
-    int i;
-    Thread *t;
-    struct WaitMsg msg;
-
-    while(shouldwait(job) && await(-job->pgid, WUNTRACED, &msg)){
-        switch(msg.pid){
-        case 0:   // error
-            perror("wait for");
-            return 0;
-        case -1: // no children: assume they have exited
-            job->wait.status = Pdone;
-            clearwait(job);
-            return 1;
-        default:
-            ;
-        }
-
-        notify(job, msg);
-        /* allow for an early exit */
-        if(msg.pid == pid)
-            return 1;
-    }
-    return 1;
-
-}
-
-void
-killzombies(void)
-{
-    Thread *job;
-    int index, status, pid;
-
-    while((pid=waitpid(-1, &status, WNOHANG))>0){
-        print(shell.err, "found zombie pid %d\n", pid);
-        flush(shell.err);
-
-        job = getjob(pid, &index);
-        if(!job)
-            perror("invalid pid");
-
-        if(WIFEXITED(status))
-            job->wait.status = Pdone;
-        if(WIFSTOPPED(status))
-            job->wait.status = Pstop;
-        if(WIFCONTINUED(status))
-            job->wait.status = Pagain;
-
-        if(job->wait.status == Pdone){
-            report(job,index);
-            deljob(job);
-        }
-    }
-}
diff --git a/sys/cmd/rules.mk b/sys/cmd/rules.mk
deleted file mode 100644
index 52a059b..0000000
--- a/sys/cmd/rules.mk
+++ /dev/null
@@ -1,38 +0,0 @@
-include share/push.mk
-
-# Iterate through subdirectory tree
-
-# DIR := $(d)/cc
-# include $(DIR)/rules.mk
-
-DIR := $(d)/rc
-include $(DIR)/rules.mk
-
-DIR := $(d)/walk
-include $(DIR)/rules.mk
-
-DIR := $(d)/filter
-include $(DIR)/rules.mk
-
-# DIR := $(d)/test
-# include $(DIR)/rules.mk
-
-DIR := $(d)/ic
-include $(DIR)/rules.mk
-
-DIR := $(d)/dwm
-include $(DIR)/rules.mk
-
-DIR := $(d)/wm
-include $(DIR)/rules.mk
-
-DIR := $(d)/menu
-include $(DIR)/rules.mk
-
-DIR := $(d)/term
-include $(DIR)/rules.mk
-
-# DIR := $(d)/term2
-# include $(DIR)/rules.mk
-
-include share/pop.mk
diff --git a/sys/cmd/term/LICENSE b/sys/cmd/term/LICENSE
deleted file mode 100644
index c356c39..0000000
--- a/sys/cmd/term/LICENSE
+++ /dev/null
@@ -1,34 +0,0 @@
-MIT/X Consortium License
-
-© 2014-2018 Hiltjo Posthuma <hiltjo at codemadness dot org>
-© 2018 Devin J. Pohly <djpohly at gmail dot com>
-© 2014-2017 Quentin Rameau <quinq at fifth dot space>
-© 2009-2012 Aurélien APTEL <aurelien dot aptel at gmail dot com>
-© 2008-2017 Anselm R Garbe <garbeam at gmail dot com>
-© 2012-2017 Roberto E. Vargas Caballero <k0ga at shike2 dot com>
-© 2012-2016 Christoph Lohmann <20h at r-36 dot net>
-© 2013 Eon S. Jeon <esjeon at hyunmu dot am>
-© 2013 Alexander Sedov <alex0player at gmail dot com>
-© 2013 Mark Edgar <medgar123 at gmail dot com>
-© 2013-2014 Eric Pruitt <eric.pruitt at gmail dot com>
-© 2013 Michael Forney <mforney at mforney dot org>
-© 2013-2014 Markus Teich <markus dot teich at stusta dot mhn dot de>
-© 2014-2015 Laslo Hunhold <dev at frign dot de>
-
-Permission is hereby granted, free of charge, to any person obtaining a
-copy of this software and associated documentation files (the "Software"),
-to deal in the Software without restriction, including without limitation
-the rights to use, copy, modify, merge, publish, distribute, sublicense,
-and/or sell copies of the Software, and to permit persons to whom the
-Software is furnished to do so, subject to the following conditions:
-
-The above copyright notice and this permission notice shall be included in
-all copies or substantial portions of the Software.
-
-THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.  IN NO EVENT SHALL
-THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
-FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
-DEALINGS IN THE SOFTWARE.
diff --git a/sys/cmd/term/config.h b/sys/cmd/term/config.h
deleted file mode 100644
index a740ecf..0000000
--- a/sys/cmd/term/config.h
+++ /dev/null
@@ -1,474 +0,0 @@
-/* See LICENSE file for copyright and license details. */
-#define VERSION "1"
-
-/*
- * appearance
- *
- * font: see http://freedesktop.org/software/fontconfig/fontconfig-user.html
- */
-static char *font   = "consolas:size=16";
-static int borderpx = 2;
-
-/*
- * What program is execed by st depends of these precedence rules:
- * 1: program passed with -e
- * 2: scroll and/or utmp
- * 3: SHELL environment variable
- * 4: value of shell in /etc/passwd
- * 5: value of shell in config.h
- */
-static char *shell = "/bin/mksh";
-char *utmp   = nil;
-/* scroll program: to enable use a string like "scroll" */
-char *scroll = nil;
-char *stty_args = "stty raw pass8 nl -echo -iexten -cstopb 38400";
-
-/* identification sequence returned in DA and DECID */
-char *vtiden = "\033[?6c";
-
-/* Kerning / character bounding-box multipliers */
-static float cwscale = 1.0;
-static float chscale = 1.0;
-
-/*
- * word delimiter string
- *
- * More advanced example: L" `'\"()[]{}"
- */
-wchar_t *worddelimiters = L" ";
-
-/* selection timeouts (in milliseconds) */
-static uint doubleclicktimeout = 300;
-static uint tripleclicktimeout = 600;
-
-/* alt screens */
-int allowaltscreen = 1;
-
-/* allow certain non-interactive (insecure) window operations such as:
-   setting the clipboard text */
-int allowwindowops = 0;
-
-/*
- * draw latency range in ms - from new content/keypress/etc until drawing.
- * within this range, st draws when content stops arriving (idle). mostly it's
- * near minlatency, but it waits longer for slow updates to avoid partial draw.
- * low minlatency will tear/flicker more, as it can "detect" idle too early.
- */
-static double minlatency = 8;
-static double maxlatency = 33;
-
-/*
- * blinking timeout (set to 0 to disable blinking) for the terminal blinking
- * attribute.
- */
-static uint blinktimeout = 800;
-
-/*
- * thickness of underline and bar cursors
- */
-static uint cursorthickness = 2;
-
-/*
- * bell volume. It must be a value between -100 and 100. Use 0 for disabling
- * it
- */
-static int bellvolume = 0;
-
-/* default TERM value */
-char *termname = "term-256color";
-
-/*
- * spaces per tab
- *
- * When you are changing this value, don't forget to adapt the »it« value in
- * the st.info and appropriately install the st.info in the environment where
- * you use this st version.
- *
- *	it#$tabspaces,
- *
- * Secondly make sure your kernel is not expanding tabs. When running `stty
- * -a` »tab0« should appear. You can tell the terminal to not expand tabs by
- *  running following command:
- *
- *	stty tabs
- */
-uint tabspaces = 4;
-
-/* bg opacity */
-float alpha = 0.98;
-
-/* Terminal colors (16 first used in escape sequence) */
-static char *colorname[] = {
-    "#282828", /* hard contrast: #1d2021 / soft contrast: #32302f */
-    "#ea6962", /* red     */
-    "#a9b665", /* green   */
-    "#d8a657", /* yellow  */
-    "#7daea3", /* blue    */
-    "#d3869b", /* magenta */
-    "#89b482", /* cyan    */
-    "#d4be98", /* white   */
-
-    "#928374", /* black   */
-    "#ef938e", /* red     */
-    "#bbc585", /* green   */
-    "#e1bb7e", /* yellow  */
-    "#9dc2ba", /* blue    */
-    "#e1acbb", /* magenta */
-    "#a7c7a2", /* cyan    */
-    "#e2d3ba", /* white   */
-
-	[255] = 0,
-
-	/* more colors can be added after 255 to use with DefaultXX */
-    "#fbf1c7",
-    "#3c3836",
-    "#555555",
-};
-
-/*
- * Default colors (colorname index)
- * foreground, background, cursor, reverse cursor
- */
-uint defaultfg         = 256;
-uint defaultbg         = 257;
-static uint defaultcs  = 15;
-static uint defaultrcs = 258;
-
-/*
- * Default shape of cursor
- * 2: Block ("█")
- * 4: Underline ("_")
- * 6: Bar ("|")
- * 7: Snowman ("☃")
- */
-static uint cursorshape = 2;
-
-/*
- * Default columns and rows numbers
- */
-
-static uint cols = 80;
-static uint rows = 24;
-
-/*
- * Default colour and shape of the mouse cursor
- */
-static uint mouseshape = XC_left_ptr;
-static uint mousefg    = 0;
-static uint mousebg    = 7;
-
-/*
- * Color used to display font attributes when fontconfig selected a font which
- * doesn't match the ones requested.
- */
-static uint defaultattr = 11;
-
-/*
- * Force mouse select/shortcuts while mask is active (when MODE_MOUSE is set).
- * Note that if you want to use ShiftMask with selmasks, set this to an other
- * modifier, set to 0 to not use it.
- */
-static uint forcemousemod = ShiftMask;
-
-/*
- * Internal mouse shortcuts.
- * Beware that overloading Button1 will disable the selection.
- */
-static MouseShortcut mshortcuts[] = {
-	/* mask                 button   function        argument       release */
-	{ XK_ANY_MOD,           Button2, selpaste,       {.i = 0},      1 },
-	{ ShiftMask,            Button4, ttysend,        {.s = "\033[5;2~"} },
-	{ XK_ANY_MOD,           Button4, ttysend,        {.s = "\031"} },
-	{ ShiftMask,            Button5, ttysend,        {.s = "\033[6;2~"} },
-	{ XK_ANY_MOD,           Button5, ttysend,        {.s = "\005"} },
-};
-
-/* Internal keyboard shortcuts. */
-#define MODKEY Mod1Mask
-#define TERMMOD (ControlMask|ShiftMask)
-
-static Shortcut shortcuts[] = {
-	/* mask                 keysym          function        argument */
-	{ XK_ANY_MOD,           XK_Break,       sendbreak,      {.i =  0} },
-	{ ControlMask,          XK_Print,       toggleprinter,  {.i =  0} },
-	{ ShiftMask,            XK_Print,       printscreen,    {.i =  0} },
-	{ XK_ANY_MOD,           XK_Print,       printsel,       {.i =  0} },
-	{ TERMMOD,              XK_plus,        zoom,           {.f = +1} },
-	{ ControlMask,          XK_minus,       zoom,           {.f = -1} },
-	{ TERMMOD,              XK_Home,        zoomreset,      {.f =  0} },
-	{ TERMMOD,              XK_C,           clipcopy,       {.i =  0} },
-	{ TERMMOD,              XK_V,           clippaste,      {.i =  0} },
-	{ TERMMOD,              XK_Y,           selpaste,       {.i =  0} },
-	{ ShiftMask,            XK_Insert,      selpaste,       {.i =  0} },
-	{ TERMMOD,              XK_Num_Lock,    numlock,        {.i =  0} },
-};
-
-/*
- * Special keys (change & recompile st.info accordingly)
- *
- * Mask value:
- * * Use XK_ANY_MOD to match the key no matter modifiers state
- * * Use XK_NO_MOD to match the key alone (no modifiers)
- * appkey value:
- * * 0: no value
- * * > 0: keypad application mode enabled
- * *   = 2: term.numlock = 1
- * * < 0: keypad application mode disabled
- * appcursor value:
- * * 0: no value
- * * > 0: cursor application mode enabled
- * * < 0: cursor application mode disabled
- *
- * Be careful with the order of the definitions because st searches in
- * this table sequentially, so any XK_ANY_MOD must be in the last
- * position for a key.
- */
-
-/*
- * If you want keys other than the X11 function keys (0xFD00 - 0xFFFF)
- * to be mapped below, add them to this array.
- */
-static KeySym mappedkeys[] = { -1 };
-
-/*
- * State bits to ignore when matching key or button events.  By default,
- * numlock (Mod2Mask) and keyboard layout (XK_SWITCH_MOD) are ignored.
- */
-static uint ignoremod = Mod2Mask|XK_SWITCH_MOD;
-
-/*
- * This is the huge key array which defines all compatibility to the Linux
- * world. Please decide about changes wisely.
- */
-static Key key[] = {
-	/* keysym           mask            string      appkey appcursor */
-	{ XK_KP_Home,       ShiftMask,      "\033[2J",       0,   -1},
-	{ XK_KP_Home,       ShiftMask,      "\033[1;2H",     0,   +1},
-	{ XK_KP_Home,       XK_ANY_MOD,     "\033[H",        0,   -1},
-	{ XK_KP_Home,       XK_ANY_MOD,     "\033[1~",       0,   +1},
-	{ XK_KP_Up,         XK_ANY_MOD,     "\033Ox",       +1,    0},
-	{ XK_KP_Up,         XK_ANY_MOD,     "\033[A",        0,   -1},
-	{ XK_KP_Up,         XK_ANY_MOD,     "\033OA",        0,   +1},
-	{ XK_KP_Down,       XK_ANY_MOD,     "\033Or",       +1,    0},
-	{ XK_KP_Down,       XK_ANY_MOD,     "\033[B",        0,   -1},
-	{ XK_KP_Down,       XK_ANY_MOD,     "\033OB",        0,   +1},
-	{ XK_KP_Left,       XK_ANY_MOD,     "\033Ot",       +1,    0},
-	{ XK_KP_Left,       XK_ANY_MOD,     "\033[D",        0,   -1},
-	{ XK_KP_Left,       XK_ANY_MOD,     "\033OD",        0,   +1},
-	{ XK_KP_Right,      XK_ANY_MOD,     "\033Ov",       +1,    0},
-	{ XK_KP_Right,      XK_ANY_MOD,     "\033[C",        0,   -1},
-	{ XK_KP_Right,      XK_ANY_MOD,     "\033OC",        0,   +1},
-	{ XK_KP_Prior,      ShiftMask,      "\033[5;2~",     0,    0},
-	{ XK_KP_Prior,      XK_ANY_MOD,     "\033[5~",       0,    0},
-	{ XK_KP_Begin,      XK_ANY_MOD,     "\033[E",        0,    0},
-	{ XK_KP_End,        ControlMask,    "\033[J",       -1,    0},
-	{ XK_KP_End,        ControlMask,    "\033[1;5F",    +1,    0},
-	{ XK_KP_End,        ShiftMask,      "\033[K",       -1,    0},
-	{ XK_KP_End,        ShiftMask,      "\033[1;2F",    +1,    0},
-	{ XK_KP_End,        XK_ANY_MOD,     "\033[4~",       0,    0},
-	{ XK_KP_Next,       ShiftMask,      "\033[6;2~",     0,    0},
-	{ XK_KP_Next,       XK_ANY_MOD,     "\033[6~",       0,    0},
-	{ XK_KP_Insert,     ShiftMask,      "\033[2;2~",    +1,    0},
-	{ XK_KP_Insert,     ShiftMask,      "\033[4l",      -1,    0},
-	{ XK_KP_Insert,     ControlMask,    "\033[L",       -1,    0},
-	{ XK_KP_Insert,     ControlMask,    "\033[2;5~",    +1,    0},
-	{ XK_KP_Insert,     XK_ANY_MOD,     "\033[4h",      -1,    0},
-	{ XK_KP_Insert,     XK_ANY_MOD,     "\033[2~",      +1,    0},
-	{ XK_KP_Delete,     ControlMask,    "\033[M",       -1,    0},
-	{ XK_KP_Delete,     ControlMask,    "\033[3;5~",    +1,    0},
-	{ XK_KP_Delete,     ShiftMask,      "\033[2K",      -1,    0},
-	{ XK_KP_Delete,     ShiftMask,      "\033[3;2~",    +1,    0},
-	{ XK_KP_Delete,     XK_ANY_MOD,     "\033[P",       -1,    0},
-	{ XK_KP_Delete,     XK_ANY_MOD,     "\033[3~",      +1,    0},
-	{ XK_KP_Multiply,   XK_ANY_MOD,     "\033Oj",       +2,    0},
-	{ XK_KP_Add,        XK_ANY_MOD,     "\033Ok",       +2,    0},
-	{ XK_KP_Enter,      XK_ANY_MOD,     "\033OM",       +2,    0},
-	{ XK_KP_Enter,      XK_ANY_MOD,     "\r",           -1,    0},
-	{ XK_KP_Subtract,   XK_ANY_MOD,     "\033Om",       +2,    0},
-	{ XK_KP_Decimal,    XK_ANY_MOD,     "\033On",       +2,    0},
-	{ XK_KP_Divide,     XK_ANY_MOD,     "\033Oo",       +2,    0},
-	{ XK_KP_0,          XK_ANY_MOD,     "\033Op",       +2,    0},
-	{ XK_KP_1,          XK_ANY_MOD,     "\033Oq",       +2,    0},
-	{ XK_KP_2,          XK_ANY_MOD,     "\033Or",       +2,    0},
-	{ XK_KP_3,          XK_ANY_MOD,     "\033Os",       +2,    0},
-	{ XK_KP_4,          XK_ANY_MOD,     "\033Ot",       +2,    0},
-	{ XK_KP_5,          XK_ANY_MOD,     "\033Ou",       +2,    0},
-	{ XK_KP_6,          XK_ANY_MOD,     "\033Ov",       +2,    0},
-	{ XK_KP_7,          XK_ANY_MOD,     "\033Ow",       +2,    0},
-	{ XK_KP_8,          XK_ANY_MOD,     "\033Ox",       +2,    0},
-	{ XK_KP_9,          XK_ANY_MOD,     "\033Oy",       +2,    0},
-	{ XK_Up,            ShiftMask,      "\033[1;2A",     0,    0},
-	{ XK_Up,            Mod1Mask,       "\033[1;3A",     0,    0},
-	{ XK_Up,         ShiftMask|Mod1Mask,"\033[1;4A",     0,    0},
-	{ XK_Up,            ControlMask,    "\033[1;5A",     0,    0},
-	{ XK_Up,      ShiftMask|ControlMask,"\033[1;6A",     0,    0},
-	{ XK_Up,       ControlMask|Mod1Mask,"\033[1;7A",     0,    0},
-	{ XK_Up,ShiftMask|ControlMask|Mod1Mask,"\033[1;8A",  0,    0},
-	{ XK_Up,            XK_ANY_MOD,     "\033[A",        0,   -1},
-	{ XK_Up,            XK_ANY_MOD,     "\033OA",        0,   +1},
-	{ XK_Down,          ShiftMask,      "\033[1;2B",     0,    0},
-	{ XK_Down,          Mod1Mask,       "\033[1;3B",     0,    0},
-	{ XK_Down,       ShiftMask|Mod1Mask,"\033[1;4B",     0,    0},
-	{ XK_Down,          ControlMask,    "\033[1;5B",     0,    0},
-	{ XK_Down,    ShiftMask|ControlMask,"\033[1;6B",     0,    0},
-	{ XK_Down,     ControlMask|Mod1Mask,"\033[1;7B",     0,    0},
-	{ XK_Down,ShiftMask|ControlMask|Mod1Mask,"\033[1;8B",0,    0},
-	{ XK_Down,          XK_ANY_MOD,     "\033[B",        0,   -1},
-	{ XK_Down,          XK_ANY_MOD,     "\033OB",        0,   +1},
-	{ XK_Left,          ShiftMask,      "\033[1;2D",     0,    0},
-	{ XK_Left,          Mod1Mask,       "\033[1;3D",     0,    0},
-	{ XK_Left,       ShiftMask|Mod1Mask,"\033[1;4D",     0,    0},
-	{ XK_Left,          ControlMask,    "\033[1;5D",     0,    0},
-	{ XK_Left,    ShiftMask|ControlMask,"\033[1;6D",     0,    0},
-	{ XK_Left,     ControlMask|Mod1Mask,"\033[1;7D",     0,    0},
-	{ XK_Left,ShiftMask|ControlMask|Mod1Mask,"\033[1;8D",0,    0},
-	{ XK_Left,          XK_ANY_MOD,     "\033[D",        0,   -1},
-	{ XK_Left,          XK_ANY_MOD,     "\033OD",        0,   +1},
-	{ XK_Right,         ShiftMask,      "\033[1;2C",     0,    0},
-	{ XK_Right,         Mod1Mask,       "\033[1;3C",     0,    0},
-	{ XK_Right,      ShiftMask|Mod1Mask,"\033[1;4C",     0,    0},
-	{ XK_Right,         ControlMask,    "\033[1;5C",     0,    0},
-	{ XK_Right,   ShiftMask|ControlMask,"\033[1;6C",     0,    0},
-	{ XK_Right,    ControlMask|Mod1Mask,"\033[1;7C",     0,    0},
-	{ XK_Right,ShiftMask|ControlMask|Mod1Mask,"\033[1;8C",0,   0},
-	{ XK_Right,         XK_ANY_MOD,     "\033[C",        0,   -1},
-	{ XK_Right,         XK_ANY_MOD,     "\033OC",        0,   +1},
-	{ XK_ISO_Left_Tab,  ShiftMask,      "\033[Z",        0,    0},
-	{ XK_Return,        Mod1Mask,       "\033\r",        0,    0},
-	{ XK_Return,        XK_ANY_MOD,     "\r",            0,    0},
-	{ XK_Insert,        ShiftMask,      "\033[4l",      -1,    0},
-	{ XK_Insert,        ShiftMask,      "\033[2;2~",    +1,    0},
-	{ XK_Insert,        ControlMask,    "\033[L",       -1,    0},
-	{ XK_Insert,        ControlMask,    "\033[2;5~",    +1,    0},
-	{ XK_Insert,        XK_ANY_MOD,     "\033[4h",      -1,    0},
-	{ XK_Insert,        XK_ANY_MOD,     "\033[2~",      +1,    0},
-	{ XK_Delete,        ControlMask,    "\033[M",       -1,    0},
-	{ XK_Delete,        ControlMask,    "\033[3;5~",    +1,    0},
-	{ XK_Delete,        ShiftMask,      "\033[2K",      -1,    0},
-	{ XK_Delete,        ShiftMask,      "\033[3;2~",    +1,    0},
-	{ XK_Delete,        XK_ANY_MOD,     "\033[P",       -1,    0},
-	{ XK_Delete,        XK_ANY_MOD,     "\033[3~",      +1,    0},
-	{ XK_BackSpace,     XK_NO_MOD,      "\177",          0,    0},
-	{ XK_BackSpace,     Mod1Mask,       "\033\177",      0,    0},
-	{ XK_Home,          ShiftMask,      "\033[2J",       0,   -1},
-	{ XK_Home,          ShiftMask,      "\033[1;2H",     0,   +1},
-	{ XK_Home,          XK_ANY_MOD,     "\033[H",        0,   -1},
-	{ XK_Home,          XK_ANY_MOD,     "\033[1~",       0,   +1},
-	{ XK_End,           ControlMask,    "\033[J",       -1,    0},
-	{ XK_End,           ControlMask,    "\033[1;5F",    +1,    0},
-	{ XK_End,           ShiftMask,      "\033[K",       -1,    0},
-	{ XK_End,           ShiftMask,      "\033[1;2F",    +1,    0},
-	{ XK_End,           XK_ANY_MOD,     "\033[4~",       0,    0},
-	{ XK_Prior,         ControlMask,    "\033[5;5~",     0,    0},
-	{ XK_Prior,         ShiftMask,      "\033[5;2~",     0,    0},
-	{ XK_Prior,         XK_ANY_MOD,     "\033[5~",       0,    0},
-	{ XK_Next,          ControlMask,    "\033[6;5~",     0,    0},
-	{ XK_Next,          ShiftMask,      "\033[6;2~",     0,    0},
-	{ XK_Next,          XK_ANY_MOD,     "\033[6~",       0,    0},
-	{ XK_F1,            XK_NO_MOD,      "\033OP" ,       0,    0},
-	{ XK_F1, /* F13 */  ShiftMask,      "\033[1;2P",     0,    0},
-	{ XK_F1, /* F25 */  ControlMask,    "\033[1;5P",     0,    0},
-	{ XK_F1, /* F37 */  Mod4Mask,       "\033[1;6P",     0,    0},
-	{ XK_F1, /* F49 */  Mod1Mask,       "\033[1;3P",     0,    0},
-	{ XK_F1, /* F61 */  Mod3Mask,       "\033[1;4P",     0,    0},
-	{ XK_F2,            XK_NO_MOD,      "\033OQ" ,       0,    0},
-	{ XK_F2, /* F14 */  ShiftMask,      "\033[1;2Q",     0,    0},
-	{ XK_F2, /* F26 */  ControlMask,    "\033[1;5Q",     0,    0},
-	{ XK_F2, /* F38 */  Mod4Mask,       "\033[1;6Q",     0,    0},
-	{ XK_F2, /* F50 */  Mod1Mask,       "\033[1;3Q",     0,    0},
-	{ XK_F2, /* F62 */  Mod3Mask,       "\033[1;4Q",     0,    0},
-	{ XK_F3,            XK_NO_MOD,      "\033OR" ,       0,    0},
-	{ XK_F3, /* F15 */  ShiftMask,      "\033[1;2R",     0,    0},
-	{ XK_F3, /* F27 */  ControlMask,    "\033[1;5R",     0,    0},
-	{ XK_F3, /* F39 */  Mod4Mask,       "\033[1;6R",     0,    0},
-	{ XK_F3, /* F51 */  Mod1Mask,       "\033[1;3R",     0,    0},
-	{ XK_F3, /* F63 */  Mod3Mask,       "\033[1;4R",     0,    0},
-	{ XK_F4,            XK_NO_MOD,      "\033OS" ,       0,    0},
-	{ XK_F4, /* F16 */  ShiftMask,      "\033[1;2S",     0,    0},
-	{ XK_F4, /* F28 */  ControlMask,    "\033[1;5S",     0,    0},
-	{ XK_F4, /* F40 */  Mod4Mask,       "\033[1;6S",     0,    0},
-	{ XK_F4, /* F52 */  Mod1Mask,       "\033[1;3S",     0,    0},
-	{ XK_F5,            XK_NO_MOD,      "\033[15~",      0,    0},
-	{ XK_F5, /* F17 */  ShiftMask,      "\033[15;2~",    0,    0},
-	{ XK_F5, /* F29 */  ControlMask,    "\033[15;5~",    0,    0},
-	{ XK_F5, /* F41 */  Mod4Mask,       "\033[15;6~",    0,    0},
-	{ XK_F5, /* F53 */  Mod1Mask,       "\033[15;3~",    0,    0},
-	{ XK_F6,            XK_NO_MOD,      "\033[17~",      0,    0},
-	{ XK_F6, /* F18 */  ShiftMask,      "\033[17;2~",    0,    0},
-	{ XK_F6, /* F30 */  ControlMask,    "\033[17;5~",    0,    0},
-	{ XK_F6, /* F42 */  Mod4Mask,       "\033[17;6~",    0,    0},
-	{ XK_F6, /* F54 */  Mod1Mask,       "\033[17;3~",    0,    0},
-	{ XK_F7,            XK_NO_MOD,      "\033[18~",      0,    0},
-	{ XK_F7, /* F19 */  ShiftMask,      "\033[18;2~",    0,    0},
-	{ XK_F7, /* F31 */  ControlMask,    "\033[18;5~",    0,    0},
-	{ XK_F7, /* F43 */  Mod4Mask,       "\033[18;6~",    0,    0},
-	{ XK_F7, /* F55 */  Mod1Mask,       "\033[18;3~",    0,    0},
-	{ XK_F8,            XK_NO_MOD,      "\033[19~",      0,    0},
-	{ XK_F8, /* F20 */  ShiftMask,      "\033[19;2~",    0,    0},
-	{ XK_F8, /* F32 */  ControlMask,    "\033[19;5~",    0,    0},
-	{ XK_F8, /* F44 */  Mod4Mask,       "\033[19;6~",    0,    0},
-	{ XK_F8, /* F56 */  Mod1Mask,       "\033[19;3~",    0,    0},
-	{ XK_F9,            XK_NO_MOD,      "\033[20~",      0,    0},
-	{ XK_F9, /* F21 */  ShiftMask,      "\033[20;2~",    0,    0},
-	{ XK_F9, /* F33 */  ControlMask,    "\033[20;5~",    0,    0},
-	{ XK_F9, /* F45 */  Mod4Mask,       "\033[20;6~",    0,    0},
-	{ XK_F9, /* F57 */  Mod1Mask,       "\033[20;3~",    0,    0},
-	{ XK_F10,           XK_NO_MOD,      "\033[21~",      0,    0},
-	{ XK_F10, /* F22 */ ShiftMask,      "\033[21;2~",    0,    0},
-	{ XK_F10, /* F34 */ ControlMask,    "\033[21;5~",    0,    0},
-	{ XK_F10, /* F46 */ Mod4Mask,       "\033[21;6~",    0,    0},
-	{ XK_F10, /* F58 */ Mod1Mask,       "\033[21;3~",    0,    0},
-	{ XK_F11,           XK_NO_MOD,      "\033[23~",      0,    0},
-	{ XK_F11, /* F23 */ ShiftMask,      "\033[23;2~",    0,    0},
-	{ XK_F11, /* F35 */ ControlMask,    "\033[23;5~",    0,    0}, 
-    { XK_F11, /* F47 */ Mod4Mask,       "\033[23;6~",    0,    0}, 
-    { XK_F11, /* F59 */ Mod1Mask,       "\033[23;3~",    0,    0},
-	{ XK_F12,           XK_NO_MOD,      "\033[24~",      0,    0},
-	{ XK_F12, /* F24 */ ShiftMask,      "\033[24;2~",    0,    0},
-	{ XK_F12, /* F36 */ ControlMask,    "\033[24;5~",    0,    0},
-	{ XK_F12, /* F48 */ Mod4Mask,       "\033[24;6~",    0,    0},
-	{ XK_F12, /* F60 */ Mod1Mask,       "\033[24;3~",    0,    0},
-	{ XK_F13,           XK_NO_MOD,      "\033[1;2P",     0,    0},
-	{ XK_F14,           XK_NO_MOD,      "\033[1;2Q",     0,    0},
-	{ XK_F15,           XK_NO_MOD,      "\033[1;2R",     0,    0},
-	{ XK_F16,           XK_NO_MOD,      "\033[1;2S",     0,    0},
-	{ XK_F17,           XK_NO_MOD,      "\033[15;2~",    0,    0},
-	{ XK_F18,           XK_NO_MOD,      "\033[17;2~",    0,    0},
-	{ XK_F19,           XK_NO_MOD,      "\033[18;2~",    0,    0},
-	{ XK_F20,           XK_NO_MOD,      "\033[19;2~",    0,    0},
-	{ XK_F21,           XK_NO_MOD,      "\033[20;2~",    0,    0},
-	{ XK_F22,           XK_NO_MOD,      "\033[21;2~",    0,    0},
-	{ XK_F23,           XK_NO_MOD,      "\033[23;2~",    0,    0},
-	{ XK_F24,           XK_NO_MOD,      "\033[24;2~",    0,    0},
-	{ XK_F25,           XK_NO_MOD,      "\033[1;5P",     0,    0},
-	{ XK_F26,           XK_NO_MOD,      "\033[1;5Q",     0,    0},
-	{ XK_F27,           XK_NO_MOD,      "\033[1;5R",     0,    0},
-	{ XK_F28,           XK_NO_MOD,      "\033[1;5S",     0,    0},
-	{ XK_F29,           XK_NO_MOD,      "\033[15;5~",    0,    0},
-	{ XK_F30,           XK_NO_MOD,      "\033[17;5~",    0,    0},
-	{ XK_F31,           XK_NO_MOD,      "\033[18;5~",    0,    0},
-	{ XK_F32,           XK_NO_MOD,      "\033[19;5~",    0,    0},
-	{ XK_F33,           XK_NO_MOD,      "\033[20;5~",    0,    0},
-	{ XK_F34,           XK_NO_MOD,      "\033[21;5~",    0,    0},
-	{ XK_F35,           XK_NO_MOD,      "\033[23;5~",    0,    0},
-};
-
-/*
- * Selection types' masks.
- * Use the same masks as usual.
- * Button1Mask is always unset, to make masks match between ButtonPress.
- * ButtonRelease and MotionNotify.
- * If no match is found, regular selection is used.
- */
-static uint selmasks[] = {
-	[SelRectangular] = Mod1Mask,
-};
-
-/*
- * Printable characters in ASCII, used to estimate the advance width
- * of single wide characters.
- */
-static char ascii_printable[] =
-	" !\"#$%&'()*+,-./0123456789:;<=>?"
-	"@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\]^_"
-	"`abcdefghijklmnopqrstuvwxyz{|}~";
diff --git a/sys/cmd/term/hb.c b/sys/cmd/term/hb.c
deleted file mode 100644
index 4b6b42d..0000000
--- a/sys/cmd/term/hb.c
+++ /dev/null
@@ -1,147 +0,0 @@
-#include "term.h"
-
-#include <X11/Xft/Xft.h>
-#include <harfbuzz/hb-ft.h>
-
-#define FEATURE(c1,c2,c3,c4) { .tag = HB_TAG(c1,c2,c3,c4), .value = 1, .start = HB_FEATURE_GLOBAL_START, .end = HB_FEATURE_GLOBAL_END }
-
-hb_font_t *hbfindfont(XftFont *match);
-void hbtransformsegment(XftFont *xfont, const Letter *glyph, rune *codepoints, int start, int end);
-
-typedef struct 
-{
-    XftFont *match;
-    hb_font_t *font;
-} HbFontMatch;
-
-static int hbfontslen = 0;
-static HbFontMatch *hbfontcache = nil;
-
-/* 
- * Replace 0 with a list of font features, wrapped in FEATURE macro, e.g. 
- * FEATURE('c', 'a', 'l', 't'), FEATURE('d', 'l', 'i', 'g')
- */
-hb_feature_t features[] = { 0 };
-
-void
-hbunloadfonts()
-{
-    int i;
-    for(i = 0; i < hbfontslen; i++) {
-        hb_font_destroy(hbfontcache[i].font);
-        XftUnlockFace(hbfontcache[i].match);
-    }
-
-    if(hbfontcache != nil) {
-        free(hbfontcache);
-        hbfontcache = nil;
-    }
-
-    hbfontslen = 0;
-}
-
-hb_font_t *
-hbfindfont(XftFont *match)
-{
-    int i;
-    for (i = 0; i < hbfontslen; i++) {
-        if (hbfontcache[i].match == match)
-            return hbfontcache[i].font;
-    }
-
-    /* Font not found in cache, caching it now. */
-    hbfontcache = realloc(hbfontcache, sizeof(HbFontMatch) * (hbfontslen + 1));
-    FT_Face face = XftLockFace(match);
-    hb_font_t *font = hb_ft_font_create(face, NULL);
-    if(!font)
-        fatal("failed to load Harfbuzz font.");
-
-    hbfontcache[hbfontslen].match = match;
-    hbfontcache[hbfontslen].font = font;
-    hbfontslen += 1;
-
-    return font;
-}
-
-void
-hbtransform(XftGlyphFontSpec *specs, const Letter *glyphs, size_t len, int x, int y)
-{
-	int idx, specidx, start = 0, length = 1, gstart = 0;
-	rune *runes = calloc((unsigned int)len, sizeof(hb_codepoint_t));
-
-    for(idx = 1, specidx = 1; idx < len; idx++) {
-        if(glyphs[idx].mode & Gwdummy) {
-            length += 1;
-            continue;
-        }
-
-        if(specs[specidx].font != specs[start].font
-       || GLYPHCMP(glyphs[gstart], glyphs[idx])
-       || selected(x + idx, y) != selected(x + gstart, y)
-        ) {
-            hbtransformsegment(specs[start].font, glyphs, runes, gstart, length);
-            /* reset the sequence. */
-            length = 1;
-            start = specidx;
-            gstart = idx;
-        } else {
-            length += 1;
-        }
-
-        specidx++;
-    }
-
-    /* eol */
-    hbtransformsegment(specs[start].font, glyphs, runes, gstart, length);
-
-    /* apply the transformation to glyph specs. */
-    for(idx = 0, specidx = 0; idx < len; idx++) {
-        if(glyphs[idx].mode & Gwdummy)
-            continue;
-
-        if(runes[idx] != specs[specidx].glyph)
-            ((Letter *)glyphs)[idx].mode |= Gliga;
-
-        specs[specidx++].glyph = runes[idx];
-    }
-
-	free(runes);
-}
-
-void
-hbtransformsegment(XftFont *xfont, const Letter *glyph, rune *codepoints, int start, int len)
-{
-    hb_font_t *font = hbfindfont(xfont);
-    if(!font)
-        return;
-
-    int i;
-    rune r;
-    ushort mode = USHRT_MAX;
-    hb_buffer_t *buffer = hb_buffer_create();
-    hb_buffer_set_direction(buffer, HB_DIRECTION_LTR);
-
-    /* Fill buffer with codepoints. */
-    for(i=start; i < (start+len); i++) {
-        r = glyph[i].u;
-        mode = glyph[i].mode;
-        if(mode & Gwdummy)
-            r = 0x0020;
-        hb_buffer_add_codepoints(buffer, &r, 1, 0, 1);
-    }
-
-    /* Shape the segment. */
-    hb_shape(font, buffer, features, sizeof(features));
-
-    /* Get new glyph info. */
-    hb_glyph_info_t *info = hb_buffer_get_glyph_infos(buffer, NULL);
-
-    /* Write new codepoints. */
-    for(i = 0; i < len; i++) {
-        r = info[i].codepoint;
-        codepoints[start+i] = r;
-    }
-
-    /* Cleanup. */
-    hb_buffer_destroy(buffer);
-}
diff --git a/sys/cmd/term/nonspacing.h b/sys/cmd/term/nonspacing.h
deleted file mode 100644
index 5d05a3d..0000000
--- a/sys/cmd/term/nonspacing.h
+++ /dev/null
@@ -1,89 +0,0 @@
-16,16,16,18,19,20,21,22,23,24,25,26,27,28,29,30,31,16,16,32,16,16,16,33,34,35,
-36,37,38,39,16,16,40,16,16,16,16,16,16,16,16,16,16,16,41,42,16,16,43,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,44,16,45,46,47,48,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,49,16,16,50,
-51,16,52,53,54,16,16,16,16,16,16,55,16,16,56,16,57,58,59,60,61,62,63,64,65,66,
-67,68,16,69,70,71,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,72,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,73,74,16,16,16,75,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,76,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,77,78,16,16,16,16,16,16,16,79,16,16,16,16,16,80,81,82,16,16,16,16,16,83,
-84,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,255,255,
-255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,
-255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,
-255,255,255,255,255,255,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,248,3,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,254,255,255,255,255,191,182,0,0,0,0,0,0,0,63,0,255,23,0,0,0,0,0,248,255,
-255,0,0,1,0,0,0,0,0,0,0,0,0,0,0,192,191,159,61,0,0,0,128,2,0,0,0,255,255,255,
-7,0,0,0,0,0,0,0,0,0,0,192,255,1,0,0,0,0,0,0,248,15,32,0,0,192,251,239,62,0,0,
-0,0,0,14,0,0,0,0,0,0,0,0,0,0,0,0,0,0,248,255,255,255,255,
-255,7,0,0,0,0,0,0,20,254,33,254,0,12,0,0,0,2,0,0,0,0,0,0,16,30,32,0,0,12,0,0,
-64,6,0,0,0,0,0,0,16,134,57,2,0,0,0,35,0,6,0,0,0,0,0,0,16,190,33,0,0,12,0,0,
-252,2,0,0,0,0,0,0,144,30,32,64,0,12,0,0,0,4,0,0,0,0,0,0,0,1,32,0,0,0,0,0,0,17,
-0,0,0,0,0,0,192,193,61,96,0,12,0,0,0,2,0,0,0,0,0,0,144,64,48,0,0,12,0,0,0,3,0,
-0,0,0,0,0,24,30,32,0,0,12,0,0,0,0,0,0,0,0,0,0,0,0,4,92,0,0,0,0,0,0,0,0,0,0,0,
-242,7,128,127,0,0,0,0,0,0,0,0,0,0,0,0,242,31,0,63,0,0,0,0,0,0,0,0,0,3,0,0,160,
-2,0,0,0,0,0,0,254,127,223,224,255,254,255,255,255,31,64,0,0,0,0,0,0,0,0,0,0,0,
-0,224,253,102,0,0,0,195,1,0,30,0,100,32,0,32,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,224,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,28,0,
-0,0,28,0,0,0,12,0,0,0,12,0,0,0,0,0,0,0,176,63,64,254,15,32,0,0,0,0,0,120,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,96,0,0,0,0,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,135,1,4,14,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,128,9,0,0,0,0,0,0,64,127,
-229,31,248,159,0,0,0,0,0,0,255,127,0,0,0,0,0,0,0,0,15,0,0,0,0,0,208,23,4,0,0,
-0,0,248,15,0,3,0,0,0,60,59,0,0,0,0,0,0,64,163,3,0,0,0,0,0,0,240,207,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,247,255,253,33,16,3,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,255,255,255,255,255,255,255,
-251,0,248,0,0,0,124,0,0,0,0,0,0,223,255,0,0,0,0,0,0,0,0,0,0,0,0,255,255,255,
-255,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,128,3,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,128,0,0,0,0,0,0,0,0,0,0,0,0,255,255,255,255,0,0,0,0,
-0,60,0,0,0,0,0,0,0,0,0,0,0,0,0,6,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,128,247,63,0,0,0,192,0,0,0,0,0,0,0,0,0,0,3,0,68,8,0,0,96,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,48,0,0,0,255,255,3,128,0,0,0,0,192,63,0,0,128,255,3,0,
-0,0,0,0,7,0,0,0,0,0,200,51,0,0,0,0,32,0,0,0,0,0,0,0,0,126,102,0,8,16,0,0,0,0,
-0,16,0,0,0,0,0,0,157,193,2,0,0,0,0,48,64,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,32,33,0,0,0,0,0,64,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,255,255,0,0,255,255,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,128,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,14,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,32,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,192,7,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,110,240,0,0,0,0,0,135,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,96,0,0,
-0,0,0,0,0,240,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,192,255,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,2,0,0,0,0,0,0,255,
-127,0,0,0,0,0,0,128,3,0,0,0,0,0,120,38,0,32,0,0,0,0,0,0,7,0,0,0,128,239,31,0,
-0,0,0,0,0,0,8,0,3,0,0,0,0,0,192,127,0,30,0,0,0,0,0,0,0,0,0,0,0,128,211,64,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,128,248,7,0,0,3,0,0,0,0,0,0,24,1,0,0,0,192,
-31,31,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,255,92,0,0,64,0,0,0,0,0,
-0,0,0,0,0,248,133,13,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,60,176,1,0,0,48,0,0,0,
-0,0,0,0,0,0,0,248,167,1,0,0,0,0,0,0,0,0,0,0,0,0,40,191,0,0,0,0,0,0,0,0,0,0,0,
-0,224,188,15,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-128,255,6,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,240,12,1,0,0,0,254,7,0,0,0,0,248,121,128,0,
-126,14,0,0,0,0,0,252,127,3,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,127,191,0,0,0,
-0,0,0,0,0,0,0,252,255,255,252,109,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,126,180,191,0,
-0,0,0,0,0,0,0,0,163,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,24,
-0,0,0,0,0,0,0,255,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,31,0,0,0,0,0,0,0,127,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,128,0,0,0,0,0,0,
-0,128,7,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,96,15,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,128,3,248,255,231,15,0,0,0,60,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,28,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,255,255,255,255,255,255,127,248,255,255,255,255,255,31,32,0,16,0,0,248,
-254,255,0,0,0,0,0,0,0,0,0,
-0,127,255,255,249,219,7,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,127,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,240,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,127,0,0,0,0,0,0,0,0,0,0,0,0,0,240,7,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,
diff --git a/sys/cmd/term/rules.mk b/sys/cmd/term/rules.mk
deleted file mode 100644
index 45c9eb2..0000000
--- a/sys/cmd/term/rules.mk
+++ /dev/null
@@ -1,24 +0,0 @@
-include share/push.mk
-# Iterate through subdirectory tree
-
-# Local sources
-SRCS_$(d) := $(d)/term.c $(d)/x.c #$(d)/hb.c
-BINS_$(d) := $(d)/term
-
-include share/paths.mk
-
-# Local rules
-include share/dynamic.mk
-$(BINS_$(d)): TCFLAGS = \
-			`$(PKG) --cflags fontconfig` \
-			`$(PKG) --cflags freetype2`
-
-$(BINS_$(d)): TCLIBS = \
-	`$(PKG) --libs fontconfig` \
-    `$(PKG) --libs freetype2`  \
-	-lm -lrt -lX11 -lutil -lXft -lXrender #-lharfbuzz
-
-$(BINS_$(d)): $(OBJS_$(d)) $(OBJ_DIR)/sys/libutf/libutf.a $(OBJ_DIR)/sys/base/base.a
-	$(COMPLINK)
-
-include share/pop.mk
diff --git a/sys/cmd/term/term.c b/sys/cmd/term/term.c
deleted file mode 100644
index 50ab29c..0000000
--- a/sys/cmd/term/term.c
+++ /dev/null
@@ -1,2417 +0,0 @@
-/* See LICENSE for license details. */
-#include "term.h"
-
-#include <pwd.h>
-#include <termios.h>
-#if   defined(__linux)
- #include <pty.h>
-#elif defined(__OpenBSD__) || defined(__NetBSD__) || defined(__APPLE__)
- #include <util.h>
-#elif defined(__FreeBSD__) || defined(__DragonFly__)
- #include <libutil.h>
-#endif
-
-/* macros */
-#define IS_SET(flag)		((term.mode & (flag)) != 0)
-#define ISCONTROLC0(c)		(BETWEEN(c, 0, 0x1f) || (c) == 0x7f)
-#define ISCONTROLC1(c)		(BETWEEN(c, 0x80, 0x9f))
-#define ISCONTROL(c)		(ISCONTROLC0(c) || ISCONTROLC1(c))
-#define ISDELIM(u)		    (u && wcschr(worddelimiters, u))
-
-/* forward declare functions */
-static void    execsh(char *, char **);
-static void    stty(char **);
-static void    sigchld(int);
-static void    ttywriteraw(char *, size_t);
-
-static void    csidump(void);
-static void    csihandle(void);
-static void    csiparse(void);
-static void    csireset(void);
-static int     eschandle(uchar);
-static void    strdump(void);
-static void    strhandle(void);
-static void    strparse(void);
-static void    strreset(void);
-
-static void    tprinter(char *, size_t);
-static void    tdumpsel(void);
-static void    tdumpline(int);
-static void    tdump(void);
-static void    tclearregion(int, int, int, int);
-static void    tcursor(int);
-static void    tdeletechar(int);
-static void    tdeleteline(int);
-static void    tinsertblank(int);
-static void    tinsertblankline(int);
-static int     tlinelen(int);
-static void    tmoveto(int, int);
-static void    tmoveato(int, int);
-static void    tnewline(int);
-static void    tputtab(int);
-static void    tputc(rune);
-static void    treset(void);
-static void    tscrollup(int, int);
-static void    tscrolldown(int, int);
-static void    tsetattr(int *, int);
-static void    tsetchar(rune, Letter *, int, int);
-static void    tsetdirt(int, int);
-static void    tsetscroll(int, int);
-static void    tswapscreen(void);
-static void    tsetmode(int, int, int *, int);
-static int     twrite(char *, int, int);
-static void    tfulldirt(void);
-static void    tcontrolcode(uchar );
-static void    tdectest(char );
-static void    tdefutf8(char);
-static int32   tdefcolor(int *, int *, int);
-static void    tdeftran(char);
-static void    tstrsequence(uchar);
-
-static void    drawregion(int, int, int, int);
-
-static void    selnormalize(void);
-static void    selscroll(int, int);
-static void    selsnap(int *, int *, int);
-
-static char   *base64dec(char *);
-static char    base64dec_getc(char **);
-
-static uintptr xwrite(int, char *, size_t);
-extern int     wcwidth(wchar_t wc);
-
-/* globals */
-static Terminal  term;
-static Selection sel;
-static CSIEscape csiescseq;
-static STREscape strescseq;
-static int       iofd = 1;
-static int       cmdfd;
-static pid_t     pid;
-
-/* functions */
-uintptr
-xwrite(int fd, char *s, size_t len)
-{
-	size_t aux = len;
-	ssize_t r;
-
-	while (len > 0) {
-		r = write(fd, s, len);
-		if (r < 0)
-			return r;
-		len -= r;
-		s += r;
-	}
-
-	return aux;
-}
-
-void *
-xmalloc(size_t len)
-{
-	void *p;
-
-	if (!(p = malloc(len)))
-		fatal("malloc: %s\n", strerror(errno));
-
-	return p;
-}
-
-void *
-xrealloc(void *p, size_t len)
-{
-	if ((p = realloc(p, len)) == nil)
-		fatal("realloc: %s\n", strerror(errno));
-
-	return p;
-}
-
-char *
-xstrdup(char *s)
-{
-	if ((s = strdup(s)) == nil)
-		fatal("strdup: %s\n", strerror(errno));
-
-	return s;
-}
-
-static char base64_digits[] = {
-	0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-	0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 62, 0, 0, 0,
-	63, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 0, 0, 0, -1, 0, 0, 0, 0, 1,
-	2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
-	22, 23, 24, 25, 0, 0, 0, 0, 0, 0, 26, 27, 28, 29, 30, 31, 32, 33, 34,
-	35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 0,
-	0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-	0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-	0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-	0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-	0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-	0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0
-};
-
-char
-base64dec_getc(char **src)
-{
-	while (**src && !isprint(**src))
-		(*src)++;
-	return **src ? *((*src)++) : '=';  /* emulate padding if string ends */
-}
-
-char *
-base64dec(char *src)
-{
-	size_t in_len = strlen(src);
-	char *result, *dst;
-
-	if (in_len % 4)
-		in_len += 4 - (in_len % 4);
-	result = dst = xmalloc(in_len / 4 * 3 + 1);
-	while (*src) {
-		int a = base64_digits[(unsigned char) base64dec_getc(&src)];
-		int b = base64_digits[(unsigned char) base64dec_getc(&src)];
-		int c = base64_digits[(unsigned char) base64dec_getc(&src)];
-		int d = base64_digits[(unsigned char) base64dec_getc(&src)];
-
-		/* invalid input. 'a' can be -1, e.g. if src is "\n" (c-str) */
-		if (a == -1 || b == -1)
-			break;
-
-		*dst++ = (a << 2) | ((b & 0x30) >> 4);
-		if (c == -1)
-			break;
-		*dst++ = ((b & 0x0f) << 4) | ((c & 0x3c) >> 2);
-		if (d == -1)
-			break;
-		*dst++ = ((c & 0x03) << 6) | d;
-	}
-	*dst = '\0';
-	return result;
-}
-
-void
-selinit(void)
-{
-	sel.mode = SelIdle;
-	sel.snap = 0;
-	sel.ob.x = -1;
-}
-
-int
-tlinelen(int y)
-{
-	int i = term.col;
-
-	if (term.line[y][i - 1].mode & Gwrap)
-		return i;
-
-	while (i > 0 && term.line[y][i - 1].u == ' ')
-		--i;
-
-	return i;
-}
-
-void
-selstart(int col, int row, int snap)
-{
-	selclear();
-	sel.mode = SelEmpty;
-	sel.type = SelRegular;
-	sel.alt = IS_SET(Taltscreen);
-	sel.snap = snap;
-	sel.oe.x = sel.ob.x = col;
-	sel.oe.y = sel.ob.y = row;
-	selnormalize();
-
-	if (sel.snap != 0)
-		sel.mode = SelReady;
-	tsetdirt(sel.nb.y, sel.ne.y);
-}
-
-void
-selextend(int col, int row, int type, int done)
-{
-	int oldey, oldex, oldsby, oldsey, oldtype;
-
-	if (sel.mode == SelIdle)
-		return;
-	if (done && sel.mode == SelEmpty) {
-		selclear();
-		return;
-	}
-
-	oldey = sel.oe.y;
-	oldex = sel.oe.x;
-	oldsby = sel.nb.y;
-	oldsey = sel.ne.y;
-	oldtype = sel.type;
-
-	sel.oe.x = col;
-	sel.oe.y = row;
-	selnormalize();
-	sel.type = type;
-
-	if (oldey != sel.oe.y || oldex != sel.oe.x || oldtype != sel.type || sel.mode == SelEmpty)
-		tsetdirt(MIN(sel.nb.y, oldsby), MAX(sel.ne.y, oldsey));
-
-	sel.mode = done ? SelIdle : SelReady;
-}
-
-void
-selnormalize(void)
-{
-	int i;
-
-	if (sel.type == SelRegular && sel.ob.y != sel.oe.y) {
-		sel.nb.x = sel.ob.y < sel.oe.y ? sel.ob.x : sel.oe.x;
-		sel.ne.x = sel.ob.y < sel.oe.y ? sel.oe.x : sel.ob.x;
-	} else {
-		sel.nb.x = MIN(sel.ob.x, sel.oe.x);
-		sel.ne.x = MAX(sel.ob.x, sel.oe.x);
-	}
-	sel.nb.y = MIN(sel.ob.y, sel.oe.y);
-	sel.ne.y = MAX(sel.ob.y, sel.oe.y);
-
-	selsnap(&sel.nb.x, &sel.nb.y, -1);
-	selsnap(&sel.ne.x, &sel.ne.y, +1);
-
-	/* expand selection over line breaks */
-	if (sel.type == SelRectangular)
-		return;
-	i = tlinelen(sel.nb.y);
-	if (i < sel.nb.x)
-		sel.nb.x = i;
-	if (tlinelen(sel.ne.y) <= sel.ne.x)
-		sel.ne.x = term.col - 1;
-}
-
-int
-selected(int x, int y)
-{
-	if(sel.mode == SelEmpty || sel.ob.x == -1 ||
-			sel.alt != IS_SET(Taltscreen))
-		return 0;
-
-	if(sel.type == SelRectangular)
-		return BETWEEN(y, sel.nb.y, sel.ne.y)
-		    && BETWEEN(x, sel.nb.x, sel.ne.x);
-
-	return BETWEEN(y, sel.nb.y, sel.ne.y)
-	    && (y != sel.nb.y || x >= sel.nb.x)
-	    && (y != sel.ne.y || x <= sel.ne.x);
-}
-
-void
-selsnap(int *x, int *y, int direction)
-{
-	int newx, newy, xt, yt;
-	int delim, prevdelim;
-	Letter *gp, *prevgp;
-
-	switch (sel.snap) {
-	case SnapWord:
-		/*
-		 * Snap around if the word wraps around at the end or
-		 * beginning of a line.
-		 */
-		prevgp = &term.line[*y][*x];
-		prevdelim = ISDELIM(prevgp->u);
-		for (;;) {
-			newx = *x + direction;
-			newy = *y;
-			if (!BETWEEN(newx, 0, term.col - 1)) {
-				newy += direction;
-				newx = (newx + term.col) % term.col;
-				if (!BETWEEN(newy, 0, term.row - 1))
-					break;
-
-				if (direction > 0)
-					yt = *y, xt = *x;
-				else
-					yt = newy, xt = newx;
-				if (!(term.line[yt][xt].mode & Gwrap))
-					break;
-			}
-
-			if (newx >= tlinelen(newy))
-				break;
-
-			gp = &term.line[newy][newx];
-			delim = ISDELIM(gp->u);
-			if (!(gp->mode & Gwdummy) && (delim != prevdelim
-					|| (delim && gp->u != prevgp->u)))
-				break;
-
-			*x = newx;
-			*y = newy;
-			prevgp = gp;
-			prevdelim = delim;
-		}
-		break;
-	case SnapLine:
-		/*
-		 * Snap around if the the previous line or the current one
-		 * has set ATTR_WRAP at its end. Then the whole next or
-		 * previous line will be selected.
-		 */
-		*x = (direction < 0) ? 0 : term.col - 1;
-		if (direction < 0) {
-			for (; *y > 0; *y += direction) {
-				if (!(term.line[*y-1][term.col-1].mode
-						& Gwrap)) {
-					break;
-				}
-			}
-		} else if (direction > 0) {
-			for (; *y < term.row-1; *y += direction) {
-				if (!(term.line[*y][term.col-1].mode
-						& Gwrap)) {
-					break;
-				}
-			}
-		}
-		break;
-	}
-}
-
-char *
-getsel(void)
-{
-	char *str, *ptr;
-	int y, bufsize, lastx, linelen;
-	Letter *gp, *last;
-
-	if (sel.ob.x == -1)
-		return nil;
-
-	bufsize = (term.col+1) * (sel.ne.y-sel.nb.y+1) * UTFmax;
-	ptr = str = xmalloc(bufsize);
-
-	/* append every set & selected glyph to the selection */
-	for(y = sel.nb.y; y <= sel.ne.y; y++) {
-		if((linelen = tlinelen(y)) == 0) {
-			*ptr++ = '\n';
-			continue;
-		}
-
-		if(sel.type == SelRectangular) {
-			gp = &term.line[y][sel.nb.x];
-			lastx = sel.ne.x;
-		}else{
-			gp = &term.line[y][sel.nb.y == y ? sel.nb.x : 0];
-			lastx = (sel.ne.y == y) ? sel.ne.x : term.col-1;
-		}
-		last = &term.line[y][MIN(lastx, linelen-1)];
-		while (last >= gp && last->u == ' ')
-			--last;
-
-		for ( ; gp <= last; ++gp) {
-			if (gp->mode & Gwdummy)
-				continue;
-
-			ptr += utf8·encode(&gp->u, ptr);
-		}
-
-		/*
-		 * Copy and pasting of line endings is inconsistent
-		 * in the inconsistent terminal and GUI world.
-		 * The best solution seems like to produce '\n' when
-		 * something is copied from st and convert '\n' to
-		 * '\r', when something to be pasted is received by
-		 * st.
-		 * FIXME: Fix the computer world.
-		 */
-		if ((y < sel.ne.y || lastx >= linelen) &&
-		    (!(last->mode & Gwrap) || sel.type == SelRectangular))
-			*ptr++ = '\n';
-	}
-	*ptr = 0;
-	return str;
-}
-
-void
-selclear(void)
-{
-	if (sel.ob.x == -1)
-		return;
-	sel.mode = SelIdle;
-	sel.ob.x = -1;
-	tsetdirt(sel.nb.y, sel.ne.y);
-}
-
-void
-fatal(char *errstr, ...)
-{
-	va_list ap;
-
-	va_start(ap, errstr);
-	vfprintf(stderr, errstr, ap);
-	va_end(ap);
-	exit(1);
-}
-
-void
-execsh(char *cmd, char **args)
-{
-	char *sh, *prog, *arg;
-	struct passwd *pw;
-
-	errno = 0;
-	if ((pw = getpwuid(getuid())) == nil) {
-		if (errno)
-			fatal("getpwuid: %s\n", strerror(errno));
-		else
-			fatal("who are you?\n");
-	}
-
-	if ((sh = getenv("SHELL")) == nil)
-		sh = (pw->pw_shell[0]) ? pw->pw_shell : cmd;
-
-	if (args) {
-		prog = args[0];
-		arg = nil;
-	} else if (scroll) {
-		prog = scroll;
-		arg = utmp ? utmp : sh;
-	} else if (utmp) {
-		prog = utmp;
-		arg = nil;
-	} else {
-		prog = sh;
-		arg = nil;
-	}
-	DEFAULT(args, ((char *[]) {prog, arg, nil}));
-
-	unsetenv("COLUMNS");
-	unsetenv("LINES");
-	unsetenv("TERMCAP");
-	setenv("LOGNAME", pw->pw_name, 1);
-	setenv("USER", pw->pw_name, 1);
-	setenv("SHELL", sh, 1);
-	setenv("HOME", pw->pw_dir, 1);
-	setenv("TERM", termname, 1);
-
-	signal(SIGCHLD, SIG_DFL);
-	signal(SIGHUP, SIG_DFL);
-	signal(SIGINT, SIG_DFL);
-	signal(SIGQUIT, SIG_DFL);
-	signal(SIGTERM, SIG_DFL);
-	signal(SIGALRM, SIG_DFL);
-
-	execvp(prog, args);
-	_exit(1);
-}
-
-void
-sigchld(int a)
-{
-	int stat;
-	pid_t p;
-
-	if ((p = waitpid(pid, &stat, WNOHANG)) < 0)
-		fatal("waiting for pid %hd failed: %s\n", pid, strerror(errno));
-
-	if (pid != p)
-		return;
-
-	if (WIFEXITED(stat) && WEXITSTATUS(stat))
-		fatal("child exited with status %d\n", WEXITSTATUS(stat));
-	else if (WIFSIGNALED(stat))
-		fatal("child terminated due to signal %d\n", WTERMSIG(stat));
-	_exit(0);
-}
-
-void
-stty(char **args)
-{
-	char cmd[_POSIX_ARG_MAX], **p, *q, *s;
-	size_t n, siz;
-
-	if ((n = strlen(stty_args)) > sizeof(cmd)-1)
-		fatal("incorrect stty parameters\n");
-	memcpy(cmd, stty_args, n);
-	q = cmd + n;
-	siz = sizeof(cmd) - n;
-	for (p = args; p && (s = *p); ++p) {
-		if ((n = strlen(s)) > siz-1)
-			fatal("stty parameter length too long\n");
-		*q++ = ' ';
-		memcpy(q, s, n);
-		q += n;
-		siz -= n + 1;
-	}
-	*q = '\0';
-	if (system(cmd) != 0)
-		perror("Couldn't call stty");
-}
-
-int
-ttynew(char *line, char *cmd, char *out, char **args)
-{
-	int m, s;
-
-	if (out) {
-		term.mode |= Tprint;
-		iofd = (!strcmp(out, "-")) ?
-			  1 : open(out, O_WRONLY | O_CREAT, 0666);
-		if (iofd < 0) {
-			fprintf(stderr, "Error opening %s:%s\n",
-				out, strerror(errno));
-		}
-	}
-
-	if (line) {
-		if ((cmdfd = open(line, O_RDWR)) < 0)
-			fatal("open line '%s' failed: %s\n",
-			    line, strerror(errno));
-		dup2(cmdfd, 0);
-		stty(args);
-		return cmdfd;
-	}
-
-	/* seems to work fine on linux, openbsd and freebsd */
-	if (openpty(&m, &s, nil, nil, nil) < 0)
-		fatal("openpty failed: %s\n", strerror(errno));
-
-	switch (pid = fork()) {
-	case -1:
-		fatal("fork failed: %s\n", strerror(errno));
-		break;
-	case 0:
-		close(iofd);
-		setsid(); /* create a new process group */
-		dup2(s, 0);
-		dup2(s, 1);
-		dup2(s, 2);
-		if (ioctl(s, TIOCSCTTY, nil) < 0)
-			fatal("ioctl TIOCSCTTY failed: %s\n", strerror(errno));
-		close(s);
-		close(m);
-#ifdef __OpenBSD__
-		if (pledge("stdio getpw proc exec", nil) == -1)
-			fatal("pledge\n");
-#endif
-		execsh(cmd, args);
-		break;
-	default:
-#ifdef __OpenBSD__
-		if (pledge("stdio rpath tty proc", nil) == -1)
-			fatal("pledge\n");
-#endif
-		close(s);
-		cmdfd = m;
-		signal(SIGCHLD, sigchld);
-		break;
-	}
-	return cmdfd;
-}
-
-size_t
-ttyread(void)
-{
-	static char buf[BUFSIZ];
-	static int buflen = 0;
-	int ret, written;
-
-	/* append read bytes to unprocessed bytes */
-	ret = read(cmdfd, buf+buflen, arrlen(buf)-buflen);
-
-	switch (ret) {
-	case 0:
-		exit(0);
-	case -1:
-		fatal("couldn't read from shell: %s\n", strerror(errno));
-	default:
-		buflen += ret;
-		written = twrite(buf, buflen, 0);
-		buflen -= written;
-		/* keep any incomplete UTF-8 byte sequence for the next call */
-		if(buflen > 0)
-			memmove(buf, buf + written, buflen);
-		return ret;
-	}
-}
-
-void
-ttywrite(char *s, size_t n, int may_echo)
-{
-	char *next;
-
-	if (may_echo && IS_SET(Techo))
-		twrite(s, n, 1);
-
-	if (!IS_SET(Tcrlf)) {
-		ttywriteraw(s, n);
-		return;
-	}
-
-	/* This is similar to how the kernel handles ONLCR for ttys */
-	while (n > 0) {
-		if (*s == '\r') {
-			next = s + 1;
-			ttywriteraw("\r\n", 2);
-		} else {
-			next = memchr(s, '\r', n);
-			DEFAULT(next, s + n);
-			ttywriteraw(s, next - s);
-		}
-		n -= next - s;
-		s = next;
-	}
-}
-
-void
-ttywriteraw(char *s, size_t n)
-{
-	fd_set wfd, rfd;
-	ssize_t r;
-	size_t lim = 256;
-
-	/*
-	 * Remember that we are using a pty, which might be a modem line.
-	 * Writing too much will clog the line. That's why we are doing this
-	 * dance.
-	 * FIXME: Migrate the world to Plan 9.
-	 */
-	while (n > 0) {
-		FD_ZERO(&wfd);
-		FD_ZERO(&rfd);
-		FD_SET(cmdfd, &wfd);
-		FD_SET(cmdfd, &rfd);
-
-		/* Check if we can write. */
-		if (pselect(cmdfd+1, &rfd, &wfd, nil, nil, nil) < 0) {
-			if (errno == EINTR)
-				continue;
-			fatal("select failed: %s\n", strerror(errno));
-		}
-		if (FD_ISSET(cmdfd, &wfd)) {
-			/*
-			 * Only write the bytes written by ttywrite() or the
-			 * default of 256. This seems to be a reasonable value
-			 * for a serial line. Bigger values might clog the I/O.
-			 */
-			if ((r = write(cmdfd, s, (n < lim)? n : lim)) < 0)
-				goto write_error;
-			if (r < n) {
-				/*
-				 * We weren't able to write out everything.
-				 * This means the buffer is getting full
-				 * again. Empty it.
-				 */
-				if (n < lim)
-					lim = ttyread();
-				n -= r;
-				s += r;
-			} else {
-				/* All bytes have been written. */
-				break;
-			}
-		}
-		if (FD_ISSET(cmdfd, &rfd))
-			lim = ttyread();
-	}
-	return;
-
-write_error:
-	fatal("write error on tty: %s\n", strerror(errno));
-}
-
-void
-ttyresize(int tw, int th)
-{
-	struct winsize w;
-
-	w.ws_row = term.row;
-	w.ws_col = term.col;
-	w.ws_xpixel = tw;
-	w.ws_ypixel = th;
-	if (ioctl(cmdfd, TIOCSWINSZ, &w) < 0)
-		fprintf(stderr, "Couldn't set window size: %s\n", strerror(errno));
-}
-
-void
-ttyhangup()
-{
-	/* Send SIGHUP to shell */
-	kill(pid, SIGHUP);
-}
-
-int
-tattrset(int attr)
-{
-	int i, j;
-
-	for (i = 0; i < term.row-1; i++) {
-		for (j = 0; j < term.col-1; j++) {
-			if (term.line[i][j].mode & attr)
-				return 1;
-		}
-	}
-
-	return 0;
-}
-
-void
-tsetdirt(int top, int bot)
-{
-	int i;
-
-	LIMIT(top, 0, term.row-1);
-	LIMIT(bot, 0, term.row-1);
-
-	for (i = top; i <= bot; i++)
-		term.dirty[i] = 1;
-}
-
-void
-tsetdirtattr(int attr)
-{
-	int i, j;
-
-	for (i = 0; i < term.row-1; i++) {
-		for (j = 0; j < term.col-1; j++) {
-			if (term.line[i][j].mode & attr) {
-				tsetdirt(i, i);
-				break;
-			}
-		}
-	}
-}
-
-void
-tfulldirt(void)
-{
-	tsetdirt(0, term.row-1);
-}
-
-void
-tcursor(int mode)
-{
-	static Dot c[2];
-	int alt = IS_SET(Taltscreen);
-
-	if (mode == CursorSave) {
-		c[alt] = term.c;
-	} else if (mode == CursorLoad) {
-		term.c = c[alt];
-		tmoveto(c[alt].x, c[alt].y);
-	}
-}
-
-void
-treset(void)
-{
-	uint i;
-
-	term.c = (Dot){{
-		.mode = Gnil,
-		.fg = defaultfg,
-		.bg = defaultbg
-	}, .x = 0, .y = 0, .state = CursorDefault};
-
-	memset(term.tabs, 0, term.col * sizeof(*term.tabs));
-	for (i = tabspaces; i < term.col; i += tabspaces)
-		term.tabs[i] = 1;
-	term.top = 0;
-	term.bot = term.row - 1;
-	term.mode = Twrap|Tutf8;
-	memset(term.trantbl, CSusa, sizeof(term.trantbl));
-	term.charset = 0;
-
-	for (i = 0; i < 2; i++) {
-		tmoveto(0, 0);
-		tcursor(CursorSave);
-		tclearregion(0, 0, term.col-1, term.row-1);
-		tswapscreen();
-	}
-}
-
-void
-tnew(int col, int row)
-{
-	term = (Terminal){ .c = { .attr = { .fg = defaultfg, .bg = defaultbg } } };
-	tresize(col, row);
-	treset();
-}
-
-void
-tswapscreen(void)
-{
-	Letter **tmp = term.line;
-
-	term.line = term.alt;
-	term.alt = tmp;
-	term.mode ^= Taltscreen;
-	tfulldirt();
-}
-
-void
-tscrolldown(int orig, int n)
-{
-	int i;
-	Letter *temp;
-
-	LIMIT(n, 0, term.bot-orig+1);
-
-	tsetdirt(orig, term.bot-n);
-	tclearregion(0, term.bot-n+1, term.col-1, term.bot);
-
-	for (i = term.bot; i >= orig+n; i--) {
-		temp = term.line[i];
-		term.line[i] = term.line[i-n];
-		term.line[i-n] = temp;
-	}
-
-	selscroll(orig, n);
-}
-
-void
-tscrollup(int orig, int n)
-{
-	int i;
-	Letter *temp;
-
-	LIMIT(n, 0, term.bot-orig+1);
-
-	tclearregion(0, orig, term.col-1, orig+n-1);
-	tsetdirt(orig+n, term.bot);
-
-	for (i = orig; i <= term.bot-n; i++) {
-		temp = term.line[i];
-		term.line[i] = term.line[i+n];
-		term.line[i+n] = temp;
-	}
-
-	selscroll(orig, -n);
-}
-
-void
-selscroll(int orig, int n)
-{
-	if (sel.ob.x == -1)
-		return;
-
-	if (BETWEEN(sel.nb.y, orig, term.bot) != BETWEEN(sel.ne.y, orig, term.bot)) {
-		selclear();
-	} else if (BETWEEN(sel.nb.y, orig, term.bot)) {
-		sel.ob.y += n;
-		sel.oe.y += n;
-		if (sel.ob.y < term.top || sel.ob.y > term.bot ||
-		    sel.oe.y < term.top || sel.oe.y > term.bot) {
-			selclear();
-		} else {
-			selnormalize();
-		}
-	}
-}
-
-void
-tnewline(int first_col)
-{
-	int y = term.c.y;
-
-	if (y == term.bot) {
-		tscrollup(term.top, 1);
-	} else {
-		y++;
-	}
-	tmoveto(first_col ? 0 : term.c.x, y);
-}
-
-void
-csiparse(void)
-{
-	char *p = csiescseq.buf, *np;
-	long int v;
-
-	csiescseq.narg = 0;
-	if (*p == '?') {
-		csiescseq.priv = 1;
-		p++;
-	}
-
-	csiescseq.buf[csiescseq.len] = '\0';
-	while (p < csiescseq.buf+csiescseq.len) {
-		np = nil;
-		v = strtol(p, &np, 10);
-		if (np == p)
-			v = 0;
-		if (v == LONG_MAX || v == LONG_MIN)
-			v = -1;
-		csiescseq.arg[csiescseq.narg++] = v;
-		p = np;
-		if (*p != ';' || csiescseq.narg == ESC_ARG_SIZ)
-			break;
-		p++;
-	}
-	csiescseq.mode[0] = *p++;
-	csiescseq.mode[1] = (p < csiescseq.buf+csiescseq.len) ? *p : '\0';
-}
-
-/* for absolute user moves, when decom is set */
-void
-tmoveato(int x, int y)
-{
-	tmoveto(x, y + ((term.c.state & CursorOrigin) ? term.top: 0));
-}
-
-void
-tmoveto(int x, int y)
-{
-	int miny, maxy;
-
-	if (term.c.state & CursorOrigin) {
-		miny = term.top;
-		maxy = term.bot;
-	} else {
-		miny = 0;
-		maxy = term.row - 1;
-	}
-	term.c.state &= ~CursorWrap;
-	term.c.x = LIMIT(x, 0, term.col-1);
-	term.c.y = LIMIT(y, miny, maxy);
-}
-
-void
-tsetchar(rune u, Letter *attr, int x, int y)
-{
-	static char *vt100_0[62] = { /* 0x41 - 0x7e */
-		"↑", "↓", "→", "←", "█", "▚", "☃", /* A - G */
-		0, 0, 0, 0, 0, 0, 0, 0, /* H - O */
-		0, 0, 0, 0, 0, 0, 0, 0, /* P - W */
-		0, 0, 0, 0, 0, 0, 0, " ", /* X - _ */
-		"◆", "▒", "␉", "␌", "␍", "␊", "°", "±", /* ` - g */
-		"␤", "␋", "┘", "┐", "┌", "└", "┼", "⎺", /* h - o */
-		"⎻", "─", "⎼", "⎽", "├", "┤", "┴", "┬", /* p - w */
-		"│", "≤", "≥", "π", "≠", "£", "·", /* x - ~ */
-	};
-
-	/*
-	 * table is proudly stolen from rxvt.
-	 */
-	if (term.trantbl[term.charset] == CSgfx0 &&
-	   BETWEEN(u, 0x41, 0x7e) && vt100_0[u - 0x41])
-		utf8·decode(vt100_0[u - 0x41], &u);
-
-	if (term.line[y][x].mode & Gwide) {
-		if (x+1 < term.col) {
-			term.line[y][x+1].u = ' ';
-			term.line[y][x+1].mode &= ~Gwdummy;
-		}
-	} else if (term.line[y][x].mode & Gwdummy) {
-		term.line[y][x-1].u = ' ';
-		term.line[y][x-1].mode &= ~Gwide;
-	}
-
-	term.dirty[y] = 1;
-	term.line[y][x] = *attr;
-	term.line[y][x].u = u;
-}
-
-void
-tclearregion(int x1, int y1, int x2, int y2)
-{
-	int x, y, temp;
-	Letter *gp;
-
-	if(x1 > x2)
-		temp = x1, x1 = x2, x2 = temp;
-	if(y1 > y2)
-		temp = y1, y1 = y2, y2 = temp;
-
-	LIMIT(x1, 0, term.col-1);
-	LIMIT(x2, 0, term.col-1);
-	LIMIT(y1, 0, term.row-1);
-	LIMIT(y2, 0, term.row-1);
-
-	for(y = y1; y <= y2; y++) {
-		term.dirty[y] = 1;
-		for(x = x1; x <= x2; x++) {
-			gp = &term.line[y][x];
-			if(selected(x, y))
-				selclear();
-			gp->fg = term.c.attr.fg;
-			gp->bg = term.c.attr.bg;
-			gp->mode = 0;
-			gp->u = ' ';
-		}
-	}
-}
-
-void
-tdeletechar(int n)
-{
-	int dst, src, size;
-	Letter *line;
-
-	LIMIT(n, 0, term.col - term.c.x);
-
-	dst = term.c.x;
-	src = term.c.x + n;
-	size = term.col - src;
-	line = term.line[term.c.y];
-
-	memmove(&line[dst], &line[src], size * sizeof(Letter));
-	tclearregion(term.col-n, term.c.y, term.col-1, term.c.y);
-}
-
-void
-tinsertblank(int n)
-{
-	int dst, src, size;
-	Letter *line;
-
-	LIMIT(n, 0, term.col - term.c.x);
-
-	dst = term.c.x + n;
-	src = term.c.x;
-	size = term.col - dst;
-	line = term.line[term.c.y];
-
-	memmove(&line[dst], &line[src], size * sizeof(Letter));
-	tclearregion(src, term.c.y, dst - 1, term.c.y);
-}
-
-void
-tinsertblankline(int n)
-{
-	if (BETWEEN(term.c.y, term.top, term.bot))
-		tscrolldown(term.c.y, n);
-}
-
-void
-tdeleteline(int n)
-{
-	if (BETWEEN(term.c.y, term.top, term.bot))
-		tscrollup(term.c.y, n);
-}
-
-int32_t
-tdefcolor(int *attr, int *npar, int l)
-{
-	int32_t idx = -1;
-	uint r, g, b;
-
-	switch (attr[*npar + 1]) {
-	case 2: /* direct color in RGB space */
-		if (*npar + 4 >= l) {
-			fprintf(stderr, "erresc(38): Incorrect number of parameters (%d)\n", *npar);
-			break;
-		}
-		r = attr[*npar + 2];
-		g = attr[*npar + 3];
-		b = attr[*npar + 4];
-		*npar += 4;
-		if (!BETWEEN(r, 0, 255) || !BETWEEN(g, 0, 255) || !BETWEEN(b, 0, 255))
-			fprintf(stderr, "erresc(38): bad rgb color (%u,%u,%u)\n", r, g, b);
-		else
-			idx = TRUECOLOR(r, g, b);
-		break;
-	case 5: /* indexed color */
-		if (*npar + 2 >= l) {
-			fprintf(stderr, "erresc(38): Incorrect number of parameters (%d)\n", *npar);
-			break;
-		}
-		*npar += 2;
-		if (!BETWEEN(attr[*npar], 0, 255))
-			fprintf(stderr, "erresc: bad color %d\n", attr[*npar]);
-		else
-			idx = attr[*npar];
-		break;
-	case 0: /* implemented defined (only foreground) */
-	case 1: /* transparent */
-	case 3: /* direct color in CMY space */
-	case 4: /* direct color in CMYK space */
-	default:
-		fprintf(stderr, "erresc(38): gfx attr %d unknown\n", attr[*npar]);
-		break;
-	}
-
-	return idx;
-}
-
-void
-tsetattr(int *attr, int l)
-{
-	int i;
-	int32_t idx;
-
-	for (i = 0; i < l; i++) {
-		switch (attr[i]) {
-		case 0:
-			term.c.attr.mode &= ~(
-				Gbold       |
-				Gfaint      |
-				Gitalic     |
-				Gunline     |
-				Gblink      |
-				Greverse    |
-				Ginvisible  |
-				Gstruck     );
-			term.c.attr.fg = defaultfg;
-			term.c.attr.bg = defaultbg;
-			break;
-		case 1:
-			term.c.attr.mode |= Gbold;
-			break;
-		case 2:
-			term.c.attr.mode |= Gfaint;
-			break;
-		case 3:
-			term.c.attr.mode |= Gitalic;
-			break;
-		case 4:
-			term.c.attr.mode |= Gunline;
-			break;
-		case 5: /* slow blink */
-			/* FALLTHROUGH */
-		case 6: /* rapid blink */
-			term.c.attr.mode |= Gblink;
-			break;
-		case 7:
-			term.c.attr.mode |= Greverse;
-			break;
-		case 8:
-			term.c.attr.mode |= Ginvisible;
-			break;
-		case 9:
-			term.c.attr.mode |= Gstruck;
-			break;
-		case 22:
-			term.c.attr.mode &= ~(Gbold | Gfaint);
-			break;
-		case 23:
-			term.c.attr.mode &= ~Gitalic;
-			break;
-		case 24:
-			term.c.attr.mode &= ~Gunline;
-			break;
-		case 25:
-			term.c.attr.mode &= ~Gblink;
-			break;
-		case 27:
-			term.c.attr.mode &= ~Greverse;
-			break;
-		case 28:
-			term.c.attr.mode &= ~Ginvisible;
-			break;
-		case 29:
-			term.c.attr.mode &= ~Gstruck;
-			break;
-		case 38:
-			if ((idx = tdefcolor(attr, &i, l)) >= 0)
-				term.c.attr.fg = idx;
-			break;
-		case 39:
-			term.c.attr.fg = defaultfg;
-			break;
-		case 48:
-			if ((idx = tdefcolor(attr, &i, l)) >= 0)
-				term.c.attr.bg = idx;
-			break;
-		case 49:
-			term.c.attr.bg = defaultbg;
-			break;
-		default:
-			if (BETWEEN(attr[i], 30, 37)) {
-				term.c.attr.fg = attr[i] - 30;
-			} else if (BETWEEN(attr[i], 40, 47)) {
-				term.c.attr.bg = attr[i] - 40;
-			} else if (BETWEEN(attr[i], 90, 97)) {
-				term.c.attr.fg = attr[i] - 90 + 8;
-			} else if (BETWEEN(attr[i], 100, 107)) {
-				term.c.attr.bg = attr[i] - 100 + 8;
-			} else {
-				fprintf(stderr,
-					"erresc(default): gfx attr %d unknown\n",
-					attr[i]);
-				csidump();
-			}
-			break;
-		}
-	}
-}
-
-void
-tsetscroll(int t, int b)
-{
-	int temp;
-
-	LIMIT(t, 0, term.row-1);
-	LIMIT(b, 0, term.row-1);
-	if (t > b) {
-		temp = t;
-		t = b;
-		b = temp;
-	}
-	term.top = t;
-	term.bot = b;
-}
-
-void
-tsetmode(int priv, int set, int *args, int narg)
-{
-	int alt, *lim;
-
-	for (lim = args + narg; args < lim; ++args) {
-		if (priv) {
-			switch (*args) {
-			case 1: /* DECCKM -- Cursor key */
-				xsetmode(set, Wappcursor);
-				break;
-			case 5: /* DECSCNM -- Reverse video */
-				xsetmode(set, Wreverse);
-				break;
-			case 6: /* DECOM -- Origin */
-				MODBIT(term.c.state, set, CursorOrigin);
-				tmoveato(0, 0);
-				break;
-			case 7: /* DECAWM -- Auto wrap */
-				MODBIT(term.mode, set, Twrap);
-				break;
-			case 0:  /* Error (IGNORED) */
-			case 2:  /* DECANM -- ANSI/VT52 (IGNORED) */
-			case 3:  /* DECCOLM -- Column  (IGNORED) */
-			case 4:  /* DECSCLM -- Scroll (IGNORED) */
-			case 8:  /* DECARM -- Auto repeat (IGNORED) */
-			case 18: /* DECPFF -- Printer feed (IGNORED) */
-			case 19: /* DECPEX -- Printer extent (IGNORED) */
-			case 42: /* DECNRCM -- National characters (IGNORED) */
-			case 12: /* att610 -- Start blinking cursor (IGNORED) */
-				break;
-			case 25: /* DECTCEM -- Text Cursor Enable Mode */
-				xsetmode(!set, Whide);
-				break;
-			case 9:    /* X10 mouse compatibility mode */
-				xsetpointermotion(0);
-				xsetmode(0, Wmouse);
-				xsetmode(set, Wmousex10);
-				break;
-			case 1000: /* 1000: report button press */
-				xsetpointermotion(0);
-				xsetmode(0, Wmouse);
-				xsetmode(set, Wmousebtn);
-				break;
-			case 1002: /* 1002: report motion on button press */
-				xsetpointermotion(0);
-				xsetmode(0, Wmouse);
-				xsetmode(set, Wmousemotion);
-				break;
-			case 1003: /* 1003: enable all mouse motions */
-				xsetpointermotion(set);
-				xsetmode(0, Wmouse);
-				xsetmode(set, Wmousemany);
-				break;
-			case 1004: /* 1004: send focus events to tty */
-				xsetmode(set, Wfocus);
-				break;
-			case 1006: /* 1006: extended reporting mode */
-				xsetmode(set, Wmousesgr);
-				break;
-			case 1034:
-				xsetmode(set, W8bit);
-				break;
-			case 1049: /* swap screen & set/restore cursor as xterm */
-				if (!allowaltscreen)
-					break;
-				tcursor((set) ? CursorSave : CursorLoad);
-				/* FALLTHROUGH */
-			case 47: /* swap screen */
-			case 1047:
-				if (!allowaltscreen)
-					break;
-				alt = IS_SET(Taltscreen);
-				if (alt) {
-					tclearregion(0, 0, term.col-1,
-							term.row-1);
-				}
-				if (set ^ alt) /* set is always 1 or 0 */
-					tswapscreen();
-				if (*args != 1049)
-					break;
-				/* FALLTHROUGH */
-			case 1048:
-				tcursor((set) ? CursorSave : CursorLoad);
-				break;
-			case 2004: /* 2004: bracketed paste mode */
-				xsetmode(set, Wbrcktpaste);
-				break;
-			/* Not implemented mouse modes. See comments there. */
-			case 1001: /* mouse highlight mode; can hang the
-				      terminal by design when implemented. */
-			case 1005: /* UTF-8 mouse mode; will confuse
-				      applications not supporting UTF-8
-				      and luit. */
-			case 1015: /* urxvt mangled mouse mode; incompatible
-				      and can be mistaken for other control
-				      codes. */
-				break;
-			default:
-				fprintf(stderr,
-					"erresc: unknown private set/reset mode %d\n",
-					*args);
-				break;
-			}
-		} else {
-			switch (*args) {
-			case 0:  /* Error (IGNORED) */
-				break;
-			case 2:
-				xsetmode(set, Wkbdblock);
-				break;
-			case 4:  /* IRM -- Insertion-replacement */
-				MODBIT(term.mode, set, Tinsert);
-				break;
-			case 12: /* SRM -- Send/Receive */
-				MODBIT(term.mode, !set, Techo);
-				break;
-			case 20: /* LNM -- Linefeed/new line */
-				MODBIT(term.mode, set, Tcrlf);
-				break;
-			default:
-				fprintf(stderr,
-					"erresc: unknown set/reset mode %d\n",
-					*args);
-				break;
-			}
-		}
-	}
-}
-
-void
-csihandle(void)
-{
-	char buf[40];
-	int len;
-
-	switch (csiescseq.mode[0]) {
-	default:
-	unknown:
-		fprintf(stderr, "erresc: unknown csi ");
-		csidump();
-		/* fatal(""); */
-		break;
-	case '@': /* ICH -- Insert <n> blank char */
-		DEFAULT(csiescseq.arg[0], 1);
-		tinsertblank(csiescseq.arg[0]);
-		break;
-	case 'A': /* CUU -- Cursor <n> Up */
-		DEFAULT(csiescseq.arg[0], 1);
-		tmoveto(term.c.x, term.c.y-csiescseq.arg[0]);
-		break;
-	case 'B': /* CUD -- Cursor <n> Down */
-	case 'e': /* VPR --Cursor <n> Down */
-		DEFAULT(csiescseq.arg[0], 1);
-		tmoveto(term.c.x, term.c.y+csiescseq.arg[0]);
-		break;
-	case 'i': /* MC -- Media Copy */
-		switch (csiescseq.arg[0]) {
-		case 0:
-			tdump();
-			break;
-		case 1:
-			tdumpline(term.c.y);
-			break;
-		case 2:
-			tdumpsel();
-			break;
-		case 4:
-			term.mode &= ~Tprint;
-			break;
-		case 5:
-			term.mode |= Tprint;
-			break;
-		}
-		break;
-	case 'c': /* DA -- Device Attributes */
-		if (csiescseq.arg[0] == 0)
-			ttywrite(vtiden, strlen(vtiden), 0);
-		break;
-	case 'b': /* REP -- if last char is printable print it <n> more times */
-		DEFAULT(csiescseq.arg[0], 1);
-		if (term.lastc)
-			while (csiescseq.arg[0]-- > 0)
-				tputc(term.lastc);
-		break;
-	case 'C': /* CUF -- Cursor <n> Forward */
-	case 'a': /* HPR -- Cursor <n> Forward */
-		DEFAULT(csiescseq.arg[0], 1);
-		tmoveto(term.c.x+csiescseq.arg[0], term.c.y);
-		break;
-	case 'D': /* CUB -- Cursor <n> Backward */
-		DEFAULT(csiescseq.arg[0], 1);
-		tmoveto(term.c.x-csiescseq.arg[0], term.c.y);
-		break;
-	case 'E': /* CNL -- Cursor <n> Down and first col */
-		DEFAULT(csiescseq.arg[0], 1);
-		tmoveto(0, term.c.y+csiescseq.arg[0]);
-		break;
-	case 'F': /* CPL -- Cursor <n> Up and first col */
-		DEFAULT(csiescseq.arg[0], 1);
-		tmoveto(0, term.c.y-csiescseq.arg[0]);
-		break;
-	case 'g': /* TBC -- Tabulation clear */
-		switch (csiescseq.arg[0]) {
-		case 0: /* clear current tab stop */
-			term.tabs[term.c.x] = 0;
-			break;
-		case 3: /* clear all the tabs */
-			memset(term.tabs, 0, term.col * sizeof(*term.tabs));
-			break;
-		default:
-			goto unknown;
-		}
-		break;
-	case 'G': /* CHA -- Move to <col> */
-	case '`': /* HPA */
-		DEFAULT(csiescseq.arg[0], 1);
-		tmoveto(csiescseq.arg[0]-1, term.c.y);
-		break;
-	case 'H': /* CUP -- Move to <row> <col> */
-	case 'f': /* HVP */
-		DEFAULT(csiescseq.arg[0], 1);
-		DEFAULT(csiescseq.arg[1], 1);
-		tmoveato(csiescseq.arg[1]-1, csiescseq.arg[0]-1);
-		break;
-	case 'I': /* CHT -- Cursor Forward Tabulation <n> tab stops */
-		DEFAULT(csiescseq.arg[0], 1);
-		tputtab(csiescseq.arg[0]);
-		break;
-	case 'J': /* ED -- Clear screen */
-		switch (csiescseq.arg[0]) {
-		case 0: /* below */
-			tclearregion(term.c.x, term.c.y, term.col-1, term.c.y);
-			if (term.c.y < term.row-1) {
-				tclearregion(0, term.c.y+1, term.col-1,
-						term.row-1);
-			}
-			break;
-		case 1: /* above */
-			if (term.c.y > 1)
-				tclearregion(0, 0, term.col-1, term.c.y-1);
-			tclearregion(0, term.c.y, term.c.x, term.c.y);
-			break;
-		case 2: /* all */
-			tclearregion(0, 0, term.col-1, term.row-1);
-			break;
-		default:
-			goto unknown;
-		}
-		break;
-	case 'K': /* EL -- Clear line */
-		switch (csiescseq.arg[0]) {
-		case 0: /* right */
-			tclearregion(term.c.x, term.c.y, term.col-1,
-					term.c.y);
-			break;
-		case 1: /* left */
-			tclearregion(0, term.c.y, term.c.x, term.c.y);
-			break;
-		case 2: /* all */
-			tclearregion(0, term.c.y, term.col-1, term.c.y);
-			break;
-		}
-		break;
-	case 'S': /* SU -- Scroll <n> line up */
-		DEFAULT(csiescseq.arg[0], 1);
-		tscrollup(term.top, csiescseq.arg[0]);
-		break;
-	case 'T': /* SD -- Scroll <n> line down */
-		DEFAULT(csiescseq.arg[0], 1);
-		tscrolldown(term.top, csiescseq.arg[0]);
-		break;
-	case 'L': /* IL -- Insert <n> blank lines */
-		DEFAULT(csiescseq.arg[0], 1);
-		tinsertblankline(csiescseq.arg[0]);
-		break;
-	case 'l': /* RM -- Reset Mode */
-		tsetmode(csiescseq.priv, 0, csiescseq.arg, csiescseq.narg);
-		break;
-	case 'M': /* DL -- Delete <n> lines */
-		DEFAULT(csiescseq.arg[0], 1);
-		tdeleteline(csiescseq.arg[0]);
-		break;
-	case 'X': /* ECH -- Erase <n> char */
-		DEFAULT(csiescseq.arg[0], 1);
-		tclearregion(term.c.x, term.c.y,
-				term.c.x + csiescseq.arg[0] - 1, term.c.y);
-		break;
-	case 'P': /* DCH -- Delete <n> char */
-		DEFAULT(csiescseq.arg[0], 1);
-		tdeletechar(csiescseq.arg[0]);
-		break;
-	case 'Z': /* CBT -- Cursor Backward Tabulation <n> tab stops */
-		DEFAULT(csiescseq.arg[0], 1);
-		tputtab(-csiescseq.arg[0]);
-		break;
-	case 'd': /* VPA -- Move to <row> */
-		DEFAULT(csiescseq.arg[0], 1);
-		tmoveato(term.c.x, csiescseq.arg[0]-1);
-		break;
-	case 'h': /* SM -- Set terminal mode */
-		tsetmode(csiescseq.priv, 1, csiescseq.arg, csiescseq.narg);
-		break;
-	case 'm': /* SGR -- Terminal attribute (color) */
-		tsetattr(csiescseq.arg, csiescseq.narg);
-		break;
-	case 'n': /* DSR – Device Status Report (cursor position) */
-		if (csiescseq.arg[0] == 6) {
-			len = snprintf(buf, sizeof(buf), "\033[%i;%iR", term.c.y+1, term.c.x+1);
-			ttywrite(buf, len, 0);
-		}
-		break;
-	case 'r': /* DECSTBM -- Set Scrolling Region */
-		if (csiescseq.priv) {
-			goto unknown;
-		} else {
-			DEFAULT(csiescseq.arg[0], 1);
-			DEFAULT(csiescseq.arg[1], term.row);
-			tsetscroll(csiescseq.arg[0]-1, csiescseq.arg[1]-1);
-			tmoveato(0, 0);
-		}
-		break;
-	case 's': /* DECSC -- Save cursor position (ANSI.SYS) */
-		tcursor(CursorSave);
-		break;
-	case 'u': /* DECRC -- Restore cursor position (ANSI.SYS) */
-		tcursor(CursorLoad);
-		break;
-	case ' ':
-		switch (csiescseq.mode[1]) {
-		case 'q': /* DECSCUSR -- Set Cursor Style */
-			if (xsetcursor(csiescseq.arg[0]))
-				goto unknown;
-			break;
-		default:
-			goto unknown;
-		}
-		break;
-	}
-}
-
-void
-csidump(void)
-{
-	size_t i;
-	uint c;
-
-	fprintf(stderr, "ESC[");
-	for (i = 0; i < csiescseq.len; i++) {
-		c = csiescseq.buf[i] & 0xff;
-		if (isprint(c)) {
-			putc(c, stderr);
-		} else if (c == '\n') {
-			fprintf(stderr, "(\\n)");
-		} else if (c == '\r') {
-			fprintf(stderr, "(\\r)");
-		} else if (c == 0x1b) {
-			fprintf(stderr, "(\\e)");
-		} else {
-			fprintf(stderr, "(%02x)", c);
-		}
-	}
-	putc('\n', stderr);
-}
-
-void
-csireset(void)
-{
-	memset(&csiescseq, 0, sizeof(csiescseq));
-}
-
-void
-strhandle(void)
-{
-	char *p = nil, *dec;
-	int j, narg, par;
-
-	term.esc &= ~(Xstrend|Xstr);
-	strparse();
-	par = (narg = strescseq.narg) ? atoi(strescseq.args[0]) : 0;
-
-	switch (strescseq.type) {
-	case ']': /* OSC -- Operating System Command */
-		switch (par) {
-		case 0:
-		case 1:
-		case 2:
-			if (narg > 1)
-				xsettitle(strescseq.args[1]);
-			return;
-		case 52:
-			if (narg > 2 && allowwindowops) {
-				dec = base64dec(strescseq.args[2]);
-				if (dec) {
-					xsetsel(dec);
-					xclipcopy();
-				} else {
-					fprintf(stderr, "erresc: invalid base64\n");
-				}
-			}
-			return;
-		case 4: /* color set */
-			if (narg < 3)
-				break;
-			p = strescseq.args[2];
-			/* FALLTHROUGH */
-		case 104: /* color reset, here p = nil */
-			j = (narg > 1) ? atoi(strescseq.args[1]) : -1;
-			if (xsetcolorname(j, p)) {
-				if (par == 104 && narg <= 1)
-					return; /* color reset without parameter */
-				fprintf(stderr, "erresc: invalid color j=%d, p=%s\n",
-				        j, p ? p : "(null)");
-			} else {
-				/*
-				 * TODO if defaultbg color is changed, borders
-				 * are dirty
-				 */
-				redraw();
-			}
-			return;
-		}
-		break;
-	case 'k': /* old title set compatibility */
-		xsettitle(strescseq.args[0]);
-		return;
-	case 'P': /* DCS -- Device Control String */
-		term.mode |= Xdcs;
-	case '_': /* APC -- Application Program Command */
-	case '^': /* PM -- Privacy Message */
-		return;
-	}
-
-	fprintf(stderr, "erresc: unknown str ");
-	strdump();
-}
-
-void
-strparse(void)
-{
-	int c;
-	char *p = strescseq.buf;
-
-	strescseq.narg = 0;
-	strescseq.buf[strescseq.len] = '\0';
-
-	if (*p == '\0')
-		return;
-
-	while (strescseq.narg < STR_ARG_SIZ) {
-		strescseq.args[strescseq.narg++] = p;
-		while ((c = *p) != ';' && c != '\0')
-			++p;
-		if (c == '\0')
-			return;
-		*p++ = '\0';
-	}
-}
-
-void
-strdump(void)
-{
-	size_t i;
-	uint c;
-
-	fprintf(stderr, "ESC%c", strescseq.type);
-	for (i = 0; i < strescseq.len; i++) {
-		c = strescseq.buf[i] & 0xff;
-		if (c == '\0') {
-			putc('\n', stderr);
-			return;
-		} else if (isprint(c)) {
-			putc(c, stderr);
-		} else if (c == '\n') {
-			fprintf(stderr, "(\\n)");
-		} else if (c == '\r') {
-			fprintf(stderr, "(\\r)");
-		} else if (c == 0x1b) {
-			fprintf(stderr, "(\\e)");
-		} else {
-			fprintf(stderr, "(%02x)", c);
-		}
-	}
-	fprintf(stderr, "ESC\\\n");
-}
-
-void
-strreset(void)
-{
-	strescseq = (STREscape){
-		.buf = xrealloc(strescseq.buf, STR_BUF_SIZ),
-		.siz = STR_BUF_SIZ,
-	};
-}
-
-void
-sendbreak(Arg *arg)
-{
-	if (tcsendbreak(cmdfd, 0))
-		perror("Error sending break");
-}
-
-void
-tprinter(char *s, size_t len)
-{
-	if (iofd != -1 && xwrite(iofd, s, len) < 0) {
-		perror("Error writing to output file");
-		close(iofd);
-		iofd = -1;
-	}
-}
-
-void
-toggleprinter(Arg *arg)
-{
-	term.mode ^= Tprint;
-}
-
-void
-printscreen(Arg *arg)
-{
-	tdump();
-}
-
-void
-printsel(Arg *arg)
-{
-	tdumpsel();
-}
-
-void
-tdumpsel(void)
-{
-	char *ptr;
-
-	if ((ptr = getsel())) {
-		tprinter(ptr, strlen(ptr));
-		free(ptr);
-	}
-}
-
-void
-tdumpline(int n)
-{
-	char buf[UTFmax];
-	Letter *bp, *end;
-
-	bp = &term.line[n][0];
-	end = &bp[MIN(tlinelen(n), term.col) - 1];
-	if (bp != end || bp->u != ' ') {
-		for ( ; bp <= end; ++bp)
-			tprinter(buf, utf8·encode(&bp->u, buf));
-	}
-	tprinter("\n", 1);
-}
-
-void
-tdump(void)
-{
-	int i;
-
-	for (i = 0; i < term.row; ++i)
-		tdumpline(i);
-}
-
-void
-tputtab(int n)
-{
-	uint x = term.c.x;
-
-	if (n > 0) {
-		while (x < term.col && n--)
-			for (++x; x < term.col && !term.tabs[x]; ++x)
-				/* nothing */ ;
-	} else if (n < 0) {
-		while (x > 0 && n++)
-			for (--x; x > 0 && !term.tabs[x]; --x)
-				/* nothing */ ;
-	}
-	term.c.x = LIMIT(x, 0, term.col-1);
-}
-
-void
-tdefutf8(char ascii)
-{
-	if (ascii == 'G')
-		term.mode |= Tutf8;
-	else if (ascii == '@')
-		term.mode &= ~Tutf8;
-}
-
-void
-tdeftran(char ascii)
-{
-	static char cs[] = "0B";
-	static int vcs[] = {CSgfx0, CSusa};
-	char *p;
-
-	if ((p = strchr(cs, ascii)) == nil) {
-		fprintf(stderr, "esc unhandled charset: ESC ( %c\n", ascii);
-	} else {
-		term.trantbl[term.icharset] = vcs[p - cs];
-	}
-}
-
-void
-tdectest(char c)
-{
-	int x, y;
-
-	if (c == '8') { /* DEC screen alignment test. */
-		for (x = 0; x < term.col; ++x) {
-			for (y = 0; y < term.row; ++y)
-				tsetchar('E', &term.c.attr, x, y);
-		}
-	}
-}
-
-void
-tstrsequence(uchar c)
-{
-	strreset();
-
-	switch (c) {
-	case 0x90:   /* DCS -- Device Control String */
-		c = 'P';
-		term.esc |= Xdcs;
-		break;
-	case 0x9f:   /* APC -- Application Program Command */
-		c = '_';
-		break;
-	case 0x9e:   /* PM -- Privacy Message */
-		c = '^';
-		break;
-	case 0x9d:   /* OSC -- Operating System Command */
-		c = ']';
-		break;
-	}
-	strescseq.type = c;
-	term.esc |= Xstr;
-}
-
-void
-tcontrolcode(uchar ascii)
-{
-	switch (ascii) {
-	case '\t':   /* HT */
-		tputtab(1);
-		return;
-	case '\b':   /* BS */
-		tmoveto(term.c.x-1, term.c.y);
-		return;
-	case '\r':   /* CR */
-		tmoveto(0, term.c.y);
-		return;
-	case '\f':   /* LF */
-	case '\v':   /* VT */
-	case '\n':   /* LF */
-		/* go to first col if the mode is set */
-		tnewline(IS_SET(Tcrlf));
-		return;
-	case '\a':   /* BEL */
-		if (term.esc & Xstrend) {
-			/* backwards compatibility to xterm */
-			strhandle();
-		} else {
-			xbell();
-		}
-		break;
-	case '\033': /* ESC */
-		csireset();
-		term.esc &= ~(Xcsi|Xaltcs|Xtest);
-		term.esc |= Xstart;
-		return;
-	case '\016': /* SO (LS1 -- Locking shift 1) */
-	case '\017': /* SI (LS0 -- Locking shift 0) */
-		term.charset = 1 - (ascii - '\016');
-		return;
-	case '\032': /* SUB */
-		tsetchar('?', &term.c.attr, term.c.x, term.c.y);
-		/* FALLTHROUGH */
-	case '\030': /* CAN */
-		csireset();
-		break;
-	case '\005': /* ENQ (IGNORED) */
-	case '\000': /* NUL (IGNORED) */
-	case '\021': /* XON (IGNORED) */
-	case '\023': /* XOFF (IGNORED) */
-	case 0177:   /* DEL (IGNORED) */
-		return;
-	case 0x80:   /* TODO: PAD */
-	case 0x81:   /* TODO: HOP */
-	case 0x82:   /* TODO: BPH */
-	case 0x83:   /* TODO: NBH */
-	case 0x84:   /* TODO: IND */
-		break;
-	case 0x85:   /* NEL -- Next line */
-		tnewline(1); /* always go to first col */
-		break;
-	case 0x86:   /* TODO: SSA */
-	case 0x87:   /* TODO: ESA */
-		break;
-	case 0x88:   /* HTS -- Horizontal tab stop */
-		term.tabs[term.c.x] = 1;
-		break;
-	case 0x89:   /* TODO: HTJ */
-	case 0x8a:   /* TODO: VTS */
-	case 0x8b:   /* TODO: PLD */
-	case 0x8c:   /* TODO: PLU */
-	case 0x8d:   /* TODO: RI */
-	case 0x8e:   /* TODO: SS2 */
-	case 0x8f:   /* TODO: SS3 */
-	case 0x91:   /* TODO: PU1 */
-	case 0x92:   /* TODO: PU2 */
-	case 0x93:   /* TODO: STS */
-	case 0x94:   /* TODO: CCH */
-	case 0x95:   /* TODO: MW */
-	case 0x96:   /* TODO: SPA */
-	case 0x97:   /* TODO: EPA */
-	case 0x98:   /* TODO: SOS */
-	case 0x99:   /* TODO: SGCI */
-		break;
-	case 0x9a:   /* DECID -- Identify Terminal */
-		ttywrite(vtiden, strlen(vtiden), 0);
-		break;
-	case 0x9b:   /* TODO: CSI */
-	case 0x9c:   /* TODO: ST */
-		break;
-	case 0x90:   /* DCS -- Device Control String */
-	case 0x9d:   /* OSC -- Operating System Command */
-	case 0x9e:   /* PM -- Privacy Message */
-	case 0x9f:   /* APC -- Application Program Command */
-		tstrsequence(ascii);
-		return;
-	}
-	/* only CAN, SUB, \a and C1 chars interrupt a sequence */
-	term.esc &= ~(Xstrend|Xstr);
-}
-
-/*
- * returns 1 when the sequence is finished and it hasn't to read
- * more characters for this sequence, otherwise 0
- */
-int
-eschandle(uchar ascii)
-{
-	switch (ascii) {
-	case '[':
-		term.esc |= Xcsi;
-		return 0;
-	case '#':
-		term.esc |= Xtest;
-		return 0;
-	case '%':
-		term.esc |= Xutf8;
-		return 0;
-	case 'P': /* DCS -- Device Control String */
-	case '_': /* APC -- Application Program Command */
-	case '^': /* PM -- Privacy Message */
-	case ']': /* OSC -- Operating System Command */
-	case 'k': /* old title set compatibility */
-		tstrsequence(ascii);
-		return 0;
-	case 'n': /* LS2 -- Locking shift 2 */
-	case 'o': /* LS3 -- Locking shift 3 */
-		term.charset = 2 + (ascii - 'n');
-		break;
-	case '(': /* GZD4 -- set primary charset G0 */
-	case ')': /* G1D4 -- set secondary charset G1 */
-	case '*': /* G2D4 -- set tertiary charset G2 */
-	case '+': /* G3D4 -- set quaternary charset G3 */
-		term.icharset = ascii - '(';
-		term.esc |= Xaltcs;
-		return 0;
-	case 'D': /* IND -- Linefeed */
-		if (term.c.y == term.bot) {
-			tscrollup(term.top, 1);
-		} else {
-			tmoveto(term.c.x, term.c.y+1);
-		}
-		break;
-	case 'E': /* NEL -- Next line */
-		tnewline(1); /* always go to first col */
-		break;
-	case 'H': /* HTS -- Horizontal tab stop */
-		term.tabs[term.c.x] = 1;
-		break;
-	case 'M': /* RI -- Reverse index */
-		if (term.c.y == term.top) {
-			tscrolldown(term.top, 1);
-		} else {
-			tmoveto(term.c.x, term.c.y-1);
-		}
-		break;
-	case 'Z': /* DECID -- Identify Terminal */
-		ttywrite(vtiden, strlen(vtiden), 0);
-		break;
-	case 'c': /* RIS -- Reset to initial state */
-		treset();
-		resettitle();
-		xloadcols();
-		break;
-	case '=': /* DECPAM -- Application keypad */
-		xsetmode(1, Wappkeypad);
-		break;
-	case '>': /* DECPNM -- Normal keypad */
-		xsetmode(0, Wappkeypad);
-		break;
-	case '7': /* DECSC -- Save Cursor */
-		tcursor(CursorSave);
-		break;
-	case '8': /* DECRC -- Restore Cursor */
-		tcursor(CursorLoad);
-		break;
-	case '\\': /* ST -- String Terminator */
-		if (term.esc & Xstrend)
-			strhandle();
-		break;
-	default:
-		fprintf(stderr, "erresc: unknown sequence ESC 0x%02X '%c'\n",
-			(uchar) ascii, isprint(ascii)? ascii:'.');
-		break;
-	}
-	return 1;
-}
-
-void
-tputc(rune u)
-{
-	char c[UTFmax];
-	int  control;
-	int  width, len;
-    rune nu;
-	Letter *gp;
-
-	control = ISCONTROL(u);
-	if (u < 127 || !IS_SET(Tutf8 | Tsixel)) {
-		c[0] = u;
-		width = len = 1;
-	} else {
-		len = utf8·encode(&u, c);
-		if(!control && (width = wcwidth(u)) == -1)
-			width = 1;
-	}
-
-    /* combining characters */
-    if(!width){
-        if(term.c.x > 0)
-            gp = &term.line[term.c.y][term.c.x-1];
-        else if(term.c.y > 0)
-            gp = &term.line[term.c.y-1][term.col-1];
-        else
-            return;
-
-#if 0
-        if(!hb_unicode_compose(hb_unicode_funcs_get_default(),gp->u, u, &nu)) {
-            return;
-        }
-#endif
-
-        gp->u = nu;
-        return;
-    }
-
-	if (IS_SET(Tprint))
-		tprinter(c, len);
-
-	/*
-	 * STR sequence must be checked before anything else
-	 * because it uses all following characters until it
-	 * receives a ESC, a SUB, a ST or any other C1 control
-	 * character.
-	 */
-	if(term.esc & Xstr) {
-		if (u == '\a' || u == 030 || u == 032 || u == 033 ||
-		   ISCONTROLC1(u)) {
-			term.esc &= ~(Xstart|Xstr|Xdcs);
-			if (IS_SET(Tsixel)) {
-				/* TODO: render sixel */;
-				term.mode &= ~Tsixel;
-				return;
-			}
-			term.esc |= Xstrend;
-			goto check_control_code;
-		}
-
-		if(IS_SET(Tsixel)) {
-			/* TODO: implement sixel mode */
-			return;
-		}
-		if (term.esc&Xdcs && strescseq.len == 0 && u == 'q')
-			term.mode |= Tsixel;
-
-		if (strescseq.len+len >= strescseq.siz) {
-			/*
-			 * Here is a bug in terminals. If the user never sends
-			 * some code to stop the str or esc command, then st
-			 * will stop responding. But this is better than
-			 * silently failing with unknown characters. At least
-			 * then users will report back.
-			 *
-			 * In the case users ever get fixed, here is the code:
-			 */
-			/*
-			 * term.esc = 0;
-			 * strhandle();
-			 */
-			if(strescseq.siz > (SIZE_MAX - UTFmax) / 2)
-				return;
-			strescseq.siz *= 2;
-			strescseq.buf = xrealloc(strescseq.buf, strescseq.siz);
-		}
-
-		memmove(&strescseq.buf[strescseq.len], c, len);
-		strescseq.len += len;
-		return;
-	}
-
-check_control_code:
-	/*
-	 * Actions of control codes must be performed as soon they arrive
-	 * because they can be embedded inside a control sequence, and
-	 * they must not cause conflicts with sequences.
-	 */
-	if(control) {
-		tcontrolcode(u);
-		/*
-		 * control codes are not shown ever
-		 */
-		if (!term.esc)
-			term.lastc = 0;
-		return;
-	} else if(term.esc & Xstart) {
-		if (term.esc & Xcsi) {
-			csiescseq.buf[csiescseq.len++] = u;
-			if (BETWEEN(u, 0x40, 0x7E)
-					|| csiescseq.len >= \
-					sizeof(csiescseq.buf)-1) {
-				term.esc = 0;
-				csiparse();
-				csihandle();
-			}
-			return;
-		} else if (term.esc & Xutf8) {
-			tdefutf8(u);
-		} else if (term.esc & Xaltcs) {
-			tdeftran(u);
-		} else if (term.esc & Xtest) {
-			tdectest(u);
-		} else {
-			if (!eschandle(u))
-				return;
-			/* sequence already finished */
-		}
-		term.esc = 0;
-		/*
-		 * All characters which form part of a sequence are not
-		 * printed
-		 */
-		return;
-	}
-
-	if(selected(term.c.x, term.c.y))
-		selclear();
-
-	gp = &term.line[term.c.y][term.c.x];
-	if(IS_SET(Twrap) && (term.c.state & CursorWrap)) {
-		gp->mode |= Gwrap;
-		tnewline(1);
-		gp = &term.line[term.c.y][term.c.x];
-	}
-
-	if(IS_SET(Tinsert) && term.c.x+width < term.col)
-		memmove(gp+width, gp, (term.col - term.c.x - width) * sizeof(Letter));
-
-	if(term.c.x+width > term.col) {
-		tnewline(1);
-		gp = &term.line[term.c.y][term.c.x];
-	}
-
-	tsetchar(u, &term.c.attr, term.c.x, term.c.y);
-	term.lastc = u;
-
-	if(width == 2) {
-		gp->mode |= Gwrap;
-		if (term.c.x+1 < term.col) {
-			gp[1].u = '\0';
-			gp[1].mode = Gwdummy;
-		}
-	}
-	if(term.c.x+width < term.col) {
-		tmoveto(term.c.x+width, term.c.y);
-	}else{
-		term.c.state |= CursorWrap;
-	}
-}
-
-int
-twrite(char *buf, int buflen, int show_ctrl)
-{
-	int charsize;
-	rune u;
-	int n;
-
-	for (n = 0; n < buflen; n += charsize) {
-		if(IS_SET(Tutf8) && !IS_SET(Tsixel)) {
-			/* process a complete utf8 char */
-			charsize = utf8·decode(buf + n, &u);
-			if(charsize == 0)
-				break;
-		} else {
-			u = buf[n] & 0xFF;
-			charsize = 1;
-		}
-		if(show_ctrl && ISCONTROL(u)) {
-			if (u & 0x80) {
-				u &= 0x7f;
-				tputc('^');
-				tputc('[');
-			} else if (u != '\n' && u != '\r' && u != '\t') {
-				u ^= 0x40;
-				tputc('^');
-			}
-		}
-		tputc(u);
-	}
-	return n;
-}
-
-void
-tresize(int col, int row)
-{
-	int i;
-	int minrow = MIN(row, term.row);
-	int mincol = MIN(col, term.col);
-	int *bp;
-	Dot c;
-
-	if (col < 1 || row < 1) {
-		fprintf(stderr,
-		        "tresize: error resizing to %dx%d\n", col, row);
-		return;
-	}
-
-	/*
-	 * slide screen to keep cursor where we expect it -
-	 * tscrollup would work here, but we can optimize to
-	 * memmove because we're freeing the earlier lines
-	 */
-	for (i = 0; i <= term.c.y - row; i++) {
-		free(term.line[i]);
-		free(term.alt[i]);
-	}
-	/* ensure that both src and dst are not nil */
-	if (i > 0) {
-		memmove(term.line, term.line + i, row * sizeof(Letter*));
-		memmove(term.alt, term.alt + i, row * sizeof(Letter*));
-	}
-	for (i += row; i < term.row; i++) {
-		free(term.line[i]);
-		free(term.alt[i]);
-	}
-
-	/* resize to new height */
-	term.line = xrealloc(term.line, row * sizeof(Letter*));
-	term.alt  = xrealloc(term.alt,  row * sizeof(Letter*));
-	term.dirty = xrealloc(term.dirty, row * sizeof(*term.dirty));
-	term.tabs = xrealloc(term.tabs, col * sizeof(*term.tabs));
-
-	/* resize each row to new width, zero-pad if needed */
-	for (i = 0; i < minrow; i++) {
-		term.line[i] = xrealloc(term.line[i], col * sizeof(Letter));
-		term.alt[i]  = xrealloc(term.alt[i],  col * sizeof(Letter));
-	}
-
-	/* allocate any new rows */
-	for (/* i = minrow */; i < row; i++) {
-		term.line[i] = xmalloc(col * sizeof(Letter));
-		term.alt[i] = xmalloc(col * sizeof(Letter));
-	}
-	if (col > term.col) {
-		bp = term.tabs + term.col;
-
-		memset(bp, 0, sizeof(*term.tabs) * (col - term.col));
-		while (--bp > term.tabs && !*bp)
-			/* nothing */ ;
-		for (bp += tabspaces; bp < term.tabs + col; bp += tabspaces)
-			*bp = 1;
-	}
-	/* update terminal size */
-	term.col = col;
-	term.row = row;
-	/* reset scrolling region */
-	tsetscroll(0, row-1);
-	/* make use of the LIMIT in tmoveto */
-	tmoveto(term.c.x, term.c.y);
-	/* Clearing both screens (it makes dirty all lines) */
-	c = term.c;
-	for (i = 0; i < 2; i++) {
-		if (mincol < col && 0 < minrow) {
-			tclearregion(mincol, 0, col - 1, minrow - 1);
-		}
-		if (0 < col && minrow < row) {
-			tclearregion(0, minrow, col - 1, row - 1);
-		}
-		tswapscreen();
-		tcursor(CursorLoad);
-	}
-	term.c = c;
-}
-
-void
-resettitle(void)
-{
-	xsettitle(nil);
-}
-
-void
-drawregion(int x1, int y1, int x2, int y2)
-{
-	int y;
-
-	for (y = y1; y < y2; y++) {
-		if (!term.dirty[y])
-			continue;
-
-		term.dirty[y] = 0;
-		xdrawline(term.line[y], x1, y, x2);
-	}
-}
-
-void
-draw(void)
-{
-	int cx = term.c.x, ocx = term.ocx, ocy = term.ocy;
-
-	if (!xstartdraw())
-		return;
-
-	/* adjust cursor position */
-	LIMIT(term.ocx, 0, term.col-1);
-	LIMIT(term.ocy, 0, term.row-1);
-	if (term.line[term.ocy][term.ocx].mode & Gwdummy)
-		term.ocx--;
-	if (term.line[term.c.y][cx].mode & Gwdummy)
-		cx--;
-
-	drawregion(0, 0, term.col, term.row);
-	xdrawcursor(cx, term.c.y, term.line[term.c.y][cx],
-            term.ocx, term.ocy, term.line[term.ocy][term.ocx],
-            term.line[term.ocy], term.col
-    );
-	term.ocx = cx;
-	term.ocy = term.c.y;
-	xfinishdraw();
-	if (ocx != term.ocx || ocy != term.ocy)
-		xximspot(term.ocx, term.ocy);
-}
-
-void
-redraw(void)
-{
-	tfulldirt();
-	draw();
-}
diff --git a/sys/cmd/term/term.h b/sys/cmd/term/term.h
deleted file mode 100644
index 6784974..0000000
--- a/sys/cmd/term/term.h
+++ /dev/null
@@ -1,316 +0,0 @@
-/* See LICENSE for license details. */
-#pragma once
-
-#include <u.h>
-#include <base.h>
-#include <libutf.h>
-
-#include <signal.h>
-#include <sys/ioctl.h>
-#include <sys/select.h>
-#include <sys/types.h>
-#include <sys/wait.h>
-
-#include <harfbuzz/hb.h>
-
-// -----------------------------------------------------------------------
-// macros
-
-#define BETWEEN(x, a, b)	((a) <= (x) && (x) <= (b))
-#define DIVCEIL(n, d)		(((n) + ((d) - 1)) / (d))
-#define DEFAULT(a, b)		(a) = (a) ? (a) : (b)
-#define LIMIT(x, a, b)		(x) = (x) < (a) ? (a) : (x) > (b) ? (b) : (x)
-#define GLYPHCMP(a, b)		(((a).mode & (~Gwrap) & (~Gliga)) != ((b).mode & (~Gwrap) & (~Gliga)) || \
-                            (a).fg != (b).fg || (a).bg != (b).bg)
-#define TIMEDIFF(t1, t2)	((t1.tv_sec-t2.tv_sec)*1000 + (t1.tv_nsec-t2.tv_nsec)/1E6)
-#define MODBIT(x, set, bit)	((set) ? ((x) |= (bit)) : ((x) &= ~(bit)))
-#define TRUECOLOR(r,g,b)	(1 << 24 | (r) << 16 | (g) << 8 | (b))
-#define IS_TRUECOL(x)		(1 << 24 & (x))
-
-#define iota(x)             1 << (x)
-
-/* arbitrary sizes */
-#define ESC_BUF_SIZ   (128*UTFmax)
-#define ESC_ARG_SIZ   16
-#define STR_BUF_SIZ   ESC_BUF_SIZ
-#define STR_ARG_SIZ   ESC_ARG_SIZ
-
-// -----------------------------------------------------------------------
-// constants 
-
-enum {
-	Gnil,
-	Gbold      = iota(0),
-	Gfaint     = iota(1),
-	Gitalic    = iota(2),
-	Gunline    = iota(3),
-	Gblink     = iota(4),
-	Greverse   = iota(5),
-	Ginvisible = iota(6),
-	Gstruck    = iota(7),
-	Gwrap      = iota(8),
-	Gwide      = iota(9),
-	Gwdummy    = iota(10),
-	Gliga      = iota(11),
-	Gboldfaint = Gbold | Gfaint,
-};
-
-enum {
-	SelIdle  = 0,
-	SelEmpty = 1,
-	SelReady = 2
-};
-
-enum {
-	SelRegular     = 1,
-	SelRectangular = 2
-};
-
-enum {
-	SnapWord = 1,
-	SnapLine = 2
-};
-
-/* cursor state */
-enum {
-	CursorSave,
-	CursorLoad
-};
-
-/* cursor mode */
-enum {
-	CursorDefault  = 0,
-	CursorWrap     = 1,
-	CursorOrigin   = 2
-};
-
-/* character set */
-enum {
-	CSgfx0,
-	CSgfx1,
-	CSuk,
-	CSusa,
-	CSmulti,
-	CSger,
-	CSfin,
-};
-
-/* escape sequences */
-enum {
-	Xstart   = 1,
-	Xcsi     = 2,
-	Xstr     = 4,  /* OSC, PM, APC */
-	Xaltcs   = 8,
-	Xstrend  = 16, /* a final string was encountered */
-	Xtest    = 32, /* Enter in test mode */
-	Xutf8    = 64,
-	Xdcs     =128,
-};
-
-/* terminal mode */
-enum {
-	Twrap      = iota(0),
-	Tinsert    = iota(1),
-	Taltscreen = iota(2),
-	Tcrlf      = iota(3),
-	Techo      = iota(4),
-	Tprint     = iota(5),
-	Tutf8      = iota(6),
-	Tsixel     = iota(7),
-};
-
-/* window mode */
-enum {
-	Wvisible     = iota(0),
-	Wfocused     = iota(1),
-	Wappkeypad   = iota(2),
-	Wmousebtn    = iota(3),
-	Wmousemotion = iota(4),
-	Wreverse     = iota(5),
-	Wkbdblock    = iota(6),
-	Whide        = iota(7),
-	Wappcursor   = iota(8),
-	Wmousesgr    = iota(9),
-	W8bit        = iota(10),
-	Wblink       = iota(11),
-	Wbflink      = iota(12),
-	Wfocus       = iota(13),
-	Wmousex10    = iota(14),
-	Wmousemany   = iota(15),
-	Wbrcktpaste  = iota(16),
-	Wnumlock     = iota(17),
-	Wmouse       = Wmousebtn|Wmousemotion|Wmousex10|Wmousemany,
-};
-
-
-// -----------------------------------------------------------------------
-// types
-
-/* term.c */
-typedef struct Letter    Letter;
-typedef struct Dot       Dot;
-typedef struct Selection Selection;
-typedef struct Terminal  Terminal;
-
-typedef union Arg Arg;
-
-struct Letter {
-	rune u;           /* character code */
-	ushort mode;      /* attribute flags */
-	uint32 fg;        /* foreground  */
-	uint32 bg;        /* background  */
-};
-
-struct Dot {
-	Letter attr; /* current char attributes */
-	int x;
-	int y;
-	char state;
-};
-
-struct Selection {
-	int mode;
-	int type;
-	int snap;
-	/*
-	 * Selection variables:
-	 * nb – normalized coordinates of the beginning of the selection
-	 * ne – normalized coordinates of the end of the selection
-	 * ob – original coordinates of the beginning of the selection
-	 * oe – original coordinates of the end of the selection
-	 */
-	struct {
-		int x, y;
-	} nb, ne, ob, oe;
-
-	int alt;
-};
-
-/* Internal representation of the screen */
-struct Terminal {
-	int  row;       /* nb row */
-	int  col;       /* nb col */
-	Letter **line;  /* screen */
-	Letter **alt;   /* alternate screen */
-	int  *dirty;    /* dirtyness of lines */
-	Dot  c;         /* cursor */
-	int  ocx;       /* old cursor col */
-	int  ocy;       /* old cursor row */
-	int  top;       /* top    scroll limit */
-	int  bot;       /* bottom scroll limit */
-	int  mode;      /* terminal mode flags */
-	int  esc;       /* escape state flags */
-	char trantbl[4];/* charset table translation */
-	int  charset;   /* current charset */
-	int  icharset;  /* selected charset for sequence */
-	int  *tabs;
-	rune lastc;     /* last printed char outside of sequence, 0 if control */
-};
-
-/* CSI Escape sequence structs */
-/* ESC '[' [[ [<priv>] <arg> [;]] <mode> [<mode>]] */
-typedef struct {
-	char  buf[ESC_BUF_SIZ]; /* raw string */
-	ulong len;              /* raw string length */
-	char  priv;
-	int   arg[ESC_ARG_SIZ];
-	int   narg;              /* nb of args */
-	char  mode[2];
-} CSIEscape;
-
-/* STR Escape sequence structs */
-/* ESC type [[ [<priv>] <arg> [;]] <mode>] ESC '\' */
-typedef struct {
-	char type;             /* ESC type ... */
-	char *buf;             /* allocated raw string */
-	size_t siz;            /* allocation size */
-	size_t len;            /* raw string length */
-	char *args[STR_ARG_SIZ];
-	int narg;              /* nb of args */
-} STREscape;
-
-/* x.c */
-typedef struct TermWindow TermWindow;
-
-struct TermWindow {
-	int tw, th;     /* tty width and height */
-	int w, h;       /* window width and height */
-    int hb, vb;     /* horizontal and vertical border (in pix) */
-	int ch;         /* char height */
-	int cw;         /* char width  */
-	int mode;       /* window state/mode flags */
-	int cursor;     /* cursor style */
-};
-
-/* used for user hooks */
-union Arg {
-	int   i;
-	uint  ui;
-	float f;
-	void *v;
-	char *s;
-};
-
-// -----------------------------------------------------------------------
-// x.c (backend functions)
-
-void xbell(void);
-void xclipcopy(void);
-void xdrawcursor(int, int, Letter, int, int, Letter, Letter*, int);
-void xdrawline(Letter*, int, int, int);
-void xfinishdraw(void);
-void xloadcols(void);
-int  xsetcolorname(int, char *);
-void xsettitle(char *);
-int  xsetcursor(int);
-void xsetmode(int, uint);
-void xsetpointermotion(int);
-void xsetsel(char *);
-int  xstartdraw(void);
-void xximspot(int, int);
-
-void fatal( char *, ...);
-void redraw(void);
-void draw(void);
-
-void  printscreen(Arg *);
-void  printsel(Arg *);
-void  sendbreak(Arg *);
-void  toggleprinter(Arg *);
-
-int   tattrset(int);
-void  tnew(int, int);
-void  tresize(int, int);
-void  tsetdirtattr(int);
-void  ttyhangup(void);
-int   ttynew(char *, char *, char *, char **);
-ulong ttyread(void);
-void  ttyresize(int, int);
-void  ttywrite( char *, size_t, int);
-
-void resettitle(void);
-
-void selclear(void);
-void selinit(void);
-void selstart(int, int, int);
-void selextend(int, int, int, int);
-int  selected(int, int);
-char *getsel(void);
-
-void *xmalloc(size_t);
-void *xrealloc(void *, size_t);
-char *xstrdup(char *);
-
-/* config.h globals */
-extern char  *utmp;
-extern char  *scroll;
-extern char  *stty_args;
-extern char  *vtiden;
-extern wchar *worddelimiters;
-extern int   allowaltscreen;
-extern int   allowwindowops;
-extern char  *termname;
-extern uint  tabspaces;
-extern uint  defaultfg;
-extern uint  defaultbg;
-extern float alpha;
diff --git a/sys/cmd/term/term.info b/sys/cmd/term/term.info
deleted file mode 100644
index 7b90344..0000000
--- a/sys/cmd/term/term.info
+++ /dev/null
@@ -1,250 +0,0 @@
-term+mono| simpleterm monocolor,
-	acsc=+C\,D-A.B0E``aaffgghFiGjjkkllmmnnooppqqrrssttuuvvwwxxyyzz{{||}}~~,
-	am,
-	bce,
-	bel=^G,
-	blink=\E[5m,
-	bold=\E[1m,
-	cbt=\E[Z,
-	cvvis=\E[?25h,
-	civis=\E[?25l,
-	clear=\E[H\E[2J,
-	cnorm=\E[?12l\E[?25h,
-	colors#2,
-	cols#80,
-	cr=^M,
-	csr=\E[%i%p1%d;%p2%dr,
-	cub=\E[%p1%dD,
-	cub1=^H,
-	cud1=^J,
-	cud=\E[%p1%dB,
-	cuf1=\E[C,
-	cuf=\E[%p1%dC,
-	cup=\E[%i%p1%d;%p2%dH,
-	cuu1=\E[A,
-	cuu=\E[%p1%dA,
-	dch=\E[%p1%dP,
-	dch1=\E[P,
-	dim=\E[2m,
-	dl=\E[%p1%dM,
-	dl1=\E[M,
-	ech=\E[%p1%dX,
-	ed=\E[J,
-	el=\E[K,
-	el1=\E[1K,
-	enacs=\E)0,
-	flash=\E[?5h$<80/>\E[?5l,
-	fsl=^G,
-	home=\E[H,
-	hpa=\E[%i%p1%dG,
-	hs,
-	ht=^I,
-	hts=\EH,
-	ich=\E[%p1%d@,
-	il1=\E[L,
-	il=\E[%p1%dL,
-	ind=^J,
-	indn=\E[%p1%dS,
-	invis=\E[8m,
-	is2=\E[4l\E>\E[?1034l,
-	it#4,
-	kel=\E[1;2F,
-	ked=\E[1;5F,
-	ka1=\E[1~,
-	ka3=\E[5~,
-	kc1=\E[4~,
-	kc3=\E[6~,
-	kbs=\177,
-	kcbt=\E[Z,
-	kb2=\EOu,
-	kcub1=\EOD,
-	kcud1=\EOB,
-	kcuf1=\EOC,
-	kcuu1=\EOA,
-	kDC=\E[3;2~,
-	kent=\EOM,
-	kEND=\E[1;2F,
-	kIC=\E[2;2~,
-	kNXT=\E[6;2~,
-	kPRV=\E[5;2~,
-	kHOM=\E[1;2H,
-	kLFT=\E[1;2D,
-	kRIT=\E[1;2C,
-	kind=\E[1;2B,
-	kri=\E[1;2A,
-	kclr=\E[3;5~,
-	kdl1=\E[3;2~,
-	kdch1=\E[3~,
-	kich1=\E[2~,
-	kend=\E[4~,
-	kf1=\EOP,
-	kf2=\EOQ,
-	kf3=\EOR,
-	kf4=\EOS,
-	kf5=\E[15~,
-	kf6=\E[17~,
-	kf7=\E[18~,
-	kf8=\E[19~,
-	kf9=\E[20~,
-	kf10=\E[21~,
-	kf11=\E[23~,
-	kf12=\E[24~,
-	kf13=\E[1;2P,
-	kf14=\E[1;2Q,
-	kf15=\E[1;2R,
-	kf16=\E[1;2S,
-	kf17=\E[15;2~,
-	kf18=\E[17;2~,
-	kf19=\E[18;2~,
-	kf20=\E[19;2~,
-	kf21=\E[20;2~,
-	kf22=\E[21;2~,
-	kf23=\E[23;2~,
-	kf24=\E[24;2~,
-	kf25=\E[1;5P,
-	kf26=\E[1;5Q,
-	kf27=\E[1;5R,
-	kf28=\E[1;5S,
-	kf29=\E[15;5~,
-	kf30=\E[17;5~,
-	kf31=\E[18;5~,
-	kf32=\E[19;5~,
-	kf33=\E[20;5~,
-	kf34=\E[21;5~,
-	kf35=\E[23;5~,
-	kf36=\E[24;5~,
-	kf37=\E[1;6P,
-	kf38=\E[1;6Q,
-	kf39=\E[1;6R,
-	kf40=\E[1;6S,
-	kf41=\E[15;6~,
-	kf42=\E[17;6~,
-	kf43=\E[18;6~,
-	kf44=\E[19;6~,
-	kf45=\E[20;6~,
-	kf46=\E[21;6~,
-	kf47=\E[23;6~,
-	kf48=\E[24;6~,
-	kf49=\E[1;3P,
-	kf50=\E[1;3Q,
-	kf51=\E[1;3R,
-	kf52=\E[1;3S,
-	kf53=\E[15;3~,
-	kf54=\E[17;3~,
-	kf55=\E[18;3~,
-	kf56=\E[19;3~,
-	kf57=\E[20;3~,
-	kf58=\E[21;3~,
-	kf59=\E[23;3~,
-	kf60=\E[24;3~,
-	kf61=\E[1;4P,
-	kf62=\E[1;4Q,
-	kf63=\E[1;4R,
-	khome=\E[1~,
-	kil1=\E[2;5~,
-	krmir=\E[2;2~,
-	knp=\E[6~,
-	kmous=\E[M,
-	kpp=\E[5~,
-	lines#24,
-	mir,
-	msgr,
-	npc,
-	op=\E[39;49m,
-	pairs#64,
-	mc0=\E[i,
-	mc4=\E[4i,
-	mc5=\E[5i,
-	rc=\E8,
-	rev=\E[7m,
-	ri=\EM,
-	rin=\E[%p1%dT,
-	ritm=\E[23m,
-	rmacs=\E(B,
-	rmcup=\E[?1049l,
-	rmir=\E[4l,
-	rmkx=\E[?1l\E>,
-	rmso=\E[27m,
-	rmul=\E[24m,
-	rs1=\Ec,
-	rs2=\E[4l\E>\E[?1034l,
-	sc=\E7,
-	sitm=\E[3m,
-	sgr0=\E[0m,
-	smacs=\E(0,
-	smcup=\E[?1049h,
-	smir=\E[4h,
-	smkx=\E[?1h\E=,
-	smso=\E[7m,
-	smul=\E[4m,
-	tbc=\E[3g,
-	tsl=\E]0;,
-	xenl,
-	vpa=\E[%i%p1%dd,
-# XTerm extensions
-	rmxx=\E[29m,
-	smxx=\E[9m,
-# disabled rep for now: causes some issues with older ncurses versions.
-#	rep=%p1%c\E[%p2%{1}%-%db,
-# tmux extensions, see TERMINFO EXTENSIONS in tmux(1)
-	Tc,
-	Ms=\E]52;%p1%s;%p2%s\007,
-	Se=\E[2 q,
-	Ss=\E[%p1%d q,
-
-term| simpleterm,
-	use=term+mono,
-	colors#8, pairs#64,
-	setab=\E[4%p1%dm,
-	setaf=\E[3%p1%dm,
-	setb=\E[4%?%p1%{1}%=%t4%e%p1%{3}%=%t6%e%p1%{4}%=%t1%e%p1%{6}%=%t3%e%p1%d%;m,
-	setf=\E[3%?%p1%{1}%=%t4%e%p1%{3}%=%t6%e%p1%{4}%=%t1%e%p1%{6}%=%t3%e%p1%d%;m,
-	sgr=%?%p9%t\E(0%e\E(B%;\E[0%?%p6%t;1%;%?%p2%t;4%;%?%p1%p3%|%t;7%;%?%p4%t;5%;%?%p7%t;8%;m,
-
-term-256color| simpleterm with 256 colors,
-	use=term,
-	ccc,
-	colors#256, pairs#32767,
-	oc=\E]104\007,
-#	Nicked from xterm-256color
-	initc=\E]4;%p1%d;rgb\:%p2%{255}%*%{1000}%/%2.2X/%p3%{255}%*%{1000}%/%2.2X/%p4%{255}%*%{1000}%/%2.2X\E\\,
-	setab=\E[%?%p1%{8}%<%t4%p1%d%e%p1%{16}%<%t10%p1%{8}%-%d%e48;5;%p1%d%;m,
-	setaf=\E[%?%p1%{8}%<%t3%p1%d%e%p1%{16}%<%t9%p1%{8}%-%d%e38;5;%p1%d%;m,
-
-term-direct| simpleterm with true color,
-	use=term,
-    RGB,
-#	Nicked from xterm-direct
-    colors#0x1000000, pairs#0x7FFFF,
-    initc@, op=\E[39;49m,
-    setab=\E[%?%p1%{8}%<%t4%p1%d%e48;2;%p1%{65536}%/%d;%p1%{256}
-          %/%{255}%&%d;%p1%{255}%&%d%;m,
-    setaf=\E[%?%p1%{8}%<%t3%p1%d%e38;2;%p1%{65536}%/%d;%p1%{256}
-          %/%{255}%&%d;%p1%{255}%&%d%;m,
-    setb@, setf@,
-
-term-meta| simpleterm with meta key,
-	use=term,
-	km,
-	rmm=\E[?1034l,
-	smm=\E[?1034h,
-	rs2=\E[4l\E>\E[?1034h,
-	is2=\E[4l\E>\E[?1034h,
-
-term-meta-256color| simpleterm with meta key and 256 colors,
-	use=term-256color,
-	km,
-	rmm=\E[?1034l,
-	smm=\E[?1034h,
-	rs2=\E[4l\E>\E[?1034h,
-	is2=\E[4l\E>\E[?1034h,
-
-term-bs| simpleterm with backspace as backspace,
-	use=term,
-	kbs=\010,
-	kdch1=\177,
-
-term-bs-256color| simpleterm with backspace as backspace and 256colors,
-	use=term-256color,
-	kbs=\010,
-	kdch1=\177,
diff --git a/sys/cmd/term/util.c b/sys/cmd/term/util.c
deleted file mode 100644
index 3e7d81b..0000000
--- a/sys/cmd/term/util.c
+++ /dev/null
@@ -1,30 +0,0 @@
-#include <u.h>
-
-static const uchar table[] = {
-#include "nonspacing.h"
-};
-
-static const uchar wtable[] = {
-#include "wide.h"
-};
-
-int 
-wcwidth(wchar_t wc)
-{
-	if (wc < 0xffU)
-		return (wc+1 & 0x7f) >= 0x21 ? 1 : wc ? -1 : 0;
-	if ((wc & 0xfffeffffU) < 0xfffe) {
-		if ((table[table[wc>>8]*32+((wc&255)>>3)]>>(wc&7))&1)
-			return 0;
-		if ((wtable[wtable[wc>>8]*32+((wc&255)>>3)]>>(wc&7))&1)
-			return 2;
-		return 1;
-	}
-	if ((wc & 0xfffe) == 0xfffe)
-		return -1;
-	if (wc-0x20000U < 0x20000)
-		return 2;
-	if (wc == 0xe0001 || wc-0xe0020U < 0x5f || wc-0xe0100U < 0xef)
-		return 0;
-	return 1;
-}
diff --git a/sys/cmd/term/wide.h b/sys/cmd/term/wide.h
deleted file mode 100644
index e403c9a..0000000
--- a/sys/cmd/term/wide.h
+++ /dev/null
@@ -1,65 +0,0 @@
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,18,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,19,16,20,21,22,16,16,16,23,16,16,24,25,26,27,28,17,
-17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,29,
-17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,
-17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,
-17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,
-17,17,17,17,17,17,17,17,30,16,16,16,16,31,16,16,17,17,17,17,17,17,17,17,17,17,
-17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,
-17,17,17,17,17,17,17,32,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,17,17,16,16,16,33,
-34,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,35,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,17,
-17,17,17,17,17,17,36,17,17,37,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,17,38,39,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,16,
-16,16,16,16,16,16,16,40,41,42,43,44,45,46,47,16,48,49,16,16,16,16,
-16,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,255,255,
-255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,
-255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,
-255,255,255,255,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,12,0,6,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,30,9,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,96,0,0,48,0,0,0,0,0,0,255,15,0,0,0,0,128,0,0,8,
-0,2,12,0,96,48,64,16,0,0,4,44,36,32,12,0,0,0,1,0,0,0,80,184,0,0,0,0,0,0,0,224,
-0,0,0,1,128,0,0,0,0,0,0,0,0,0,0,0,24,0,0,0,0,0,0,33,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,255,255,255,251,255,255,255,255,255,255,255,
-255,255,255,15,0,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,
-255,255,255,255,255,255,255,255,255,255,255,63,0,0,0,255,15,255,255,255,255,
-255,255,255,127,254,255,255,255,255,255,255,255,255,255,127,254,255,255,255,
-255,255,255,255,255,255,255,255,255,224,255,255,255,255,255,254,255,255,255,
-255,255,255,255,255,255,255,127,255,255,255,255,255,7,255,255,255,255,15,0,
-255,255,255,255,255,127,255,255,255,255,255,0,255,255,255,255,255,255,255,255,
-255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,
-255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,0,
-0,0,0,0,0,0,0,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,
-255,31,255,255,255,255,255,255,127,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,255,
-255,255,31,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,
-255,15,0,0,0,0,0,0,0,0,0,0,0,0,0,255,3,0,0,255,255,255,255,247,255,127,15,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,254,255,255,255,255,255,255,255,255,255,255,
-255,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,127,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,15,0,0,0,255,255,255,255,255,255,255,255,255,255,255,
-255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,
-255,0,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,
-255,255,255,255,255,255,255,255,255,255,255,255,7,0,255,255,255,127,0,0,0,0,0,
-0,7,0,240,0,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,
-255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,
-255,255,255,255,255,255,255,255,255,255,255,255,255,255,
-15,16,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,128,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,64,254,7,0,0,0,0,0,0,0,0,0,0,0,0,7,0,255,255,255,
-255,255,15,255,1,3,0,63,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,255,255,255,255,
-1,224,191,255,255,255,255,255,255,255,255,223,255,255,15,0,255,255,255,255,
-255,135,15,0,255,255,17,255,255,255,255,255,255,255,255,127,253,255,255,255,
-255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,255,
-159,255,255,255,255,255,255,255,63,0,120,255,255,255,0,0,4,0,0,96,0,16,0,0,0,
-0,0,0,0,0,0,0,248,255,255,255,255,255,255,255,255,255,255,0,0,0,0,0,0,255,255,
-255,255,255,255,255,255,63,16,39,0,0,24,240,7,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,255,15,0,
-0,0,224,255,255,255,255,255,255,255,255,255,255,255,255,123,252,255,255,255,
-255,231,199,255,255,255,231,255,255,255,255,255,255,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,15,7,7,0,63,0,0,0,0,0,0,0,0,0,0,0,0,0,
diff --git a/sys/cmd/term/x.c b/sys/cmd/term/x.c
deleted file mode 100644
index 27a2e7a..0000000
--- a/sys/cmd/term/x.c
+++ /dev/null
@@ -1,2070 +0,0 @@
-/* See LICENSE for license details. */
-#include "term.h"
-
-#include <locale.h>
-#include <time.h>
-
-#include <X11/Xatom.h>
-#include <X11/Xlib.h>
-#include <X11/cursorfont.h>
-#include <X11/keysym.h>
-#include <X11/Xft/Xft.h>
-#include <X11/XKBlib.h>
-
-/* harfbuzz additions */
-#if 0
-void hbunloadfonts();
-void hbtransform(XftGlyphFontSpec *, const Letter*, size_t, int, int);
-#endif
-
-/* types used in config.h */
-typedef struct Shortcut      Shortcut;
-typedef struct MouseShortcut MouseShortcut;
-typedef struct Key           Key;
-
-struct Shortcut{
-	uint   mod;
-	KeySym keysym;
-	void (*func)(Arg *);
-	Arg    arg;
-};
-
-struct MouseShortcut {
-	uint mod;
-	uint button;
-	void (*func)(Arg *);
-	Arg  arg;
-	uint release;
-};
-
-struct Key {
-	KeySym k;
-	uint mask;
-	char *s;
-	/* three-valued logic variables: 0 indifferent, 1 on, -1 off */
-	schar appkey;    /* application keypad */
-	schar appcursor; /* application cursor */
-};
-
-/* X modifiers */
-#define XK_ANY_MOD    UINT_MAX
-#define XK_NO_MOD     0
-#define XK_SWITCH_MOD (1<<13)
-
-/* function definitions used in config.h */
-static void clipcopy(Arg *);
-static void clippaste(Arg *);
-static void numlock(Arg *);
-static void selpaste(Arg *);
-static void zoom(Arg *);
-static void zoomabs(Arg *);
-static void zoomreset(Arg *);
-static void ttysend(Arg *);
-
-/* config.h for applying patches and the configuration. */
-#include "config.h"
-
-/* XEMBED messages */
-#define XEMBED_FOCUS_IN  4
-#define XEMBED_FOCUS_OUT 5
-
-/* macros */
-#define IS_SET(flag)		((win.mode & (flag)) != 0)
-#define TRUERED(x)		(((x) & 0xff0000) >> 8)
-#define TRUEGREEN(x)		(((x) & 0xff00))
-#define TRUEBLUE(x)		(((x) & 0xff) << 8)
-
-typedef XftDraw *Draw;
-typedef XftColor Color;
-typedef XftGlyphFontSpec GlyphFontSpec;
-
-/* Purely graphic info */
-typedef struct {
-	Display *dpy;
-	Colormap cmap;
-	Window win;
-	Drawable buf;
-	GlyphFontSpec *specbuf; /* font spec buffer used for rendering */
-	Atom xembed, wmdeletewin, netwmname, netwmpid;
-	struct {
-		XIM xim;
-		XIC xic;
-		XPoint spot;
-		XVaNestedList spotlist;
-	} ime;
-	Draw draw;
-	Visual *vis;
-	XSetWindowAttributes attrs;
-	int scr;
-	int isfixed;        /* is fixed geometry? */
-    int depth;          /* color depth */
-	int l, t;           /* left and top offset */
-	int gm;             /* geometry mask */
-} XWindow;
-
-typedef struct {
-	Atom xtarget;
-	char *primary, *clipboard;
-	struct timespec tclick1;
-	struct timespec tclick2;
-} XSelection;
-
-/* Font structure */
-#define Font Font_
-typedef struct {
-	int height;
-	int width;
-	int ascent;
-	int descent;
-	int badslant;
-	int badweight;
-	short lbearing;
-	short rbearing;
-	XftFont *match;
-	FcFontSet *set;
-	FcPattern *pattern;
-} Font;
-
-/* Drawing Context */
-typedef struct {
-	Color *col;
-	size_t collen;
-	Font font, bfont, ifont, ibfont;
-	GC gc;
-} DC;
-
-static inline ushort sixd_to_16bit(int);
-static int    xmakeglyphfontspecs(XftGlyphFontSpec *, Letter *, int, int, int);
-static void   xdrawglyphfontspecs(XftGlyphFontSpec *, Letter, int, int, int);
-static void   xdrawglyph(Letter, int, int);
-static void   xclear(int, int, int, int);
-static int    xgeommasktogravity(int);
-static int    ximopen(Display *);
-static void   ximinstantiate(Display *, XPointer, XPointer);
-static void   ximdestroy(XIM, XPointer, XPointer);
-static int    xicdestroy(XIC, XPointer, XPointer);
-static void   xinit(int, int);
-static void   cresize(int, int);
-static void   xresize(int, int);
-static void   xhints(void);
-static int    xloadcolor(int, char *, Color *);
-static int    xloadfont(Font *, FcPattern *);
-static void   xloadfonts(char *, double);
-static void   xunloadfont(Font *);
-static void   xunloadfonts(void);
-static void   xsetenv(void);
-static void   xseturgency(int);
-static int    evcol(XEvent *);
-static int    evrow(XEvent *);
-
-static void   expose(XEvent *);
-static void   visibility(XEvent *);
-static void   unmap(XEvent *);
-static void   kpress(XEvent *);
-static void   cmessage(XEvent *);
-static void   resize(XEvent *);
-static void   focus(XEvent *);
-static uint   buttonmask(uint);
-static int    mouseaction(XEvent *, uint);
-static void   brelease(XEvent *);
-static void   bpress(XEvent *);
-static void   bmotion(XEvent *);
-static void   propnotify(XEvent *);
-static void   selnotify(XEvent *);
-static void   selclear_(XEvent *);
-static void   selrequest(XEvent *);
-static void   setsel(char *, Time);
-static void   mousesel(XEvent *, int);
-static void   mousereport(XEvent *);
-static char   *kmap(KeySym, uint);
-static int    match(uint, uint);
-
-static void   run(void);
-static void   usage(void);
-
-static void (*handler[LASTEvent])(XEvent *) = {
-	[KeyPress] = kpress,
-	[ClientMessage] = cmessage,
-	[ConfigureNotify] = resize,
-	[VisibilityNotify] = visibility,
-	[UnmapNotify] = unmap,
-	[Expose] = expose,
-	[FocusIn] = focus,
-	[FocusOut] = focus,
-	[MotionNotify] = bmotion,
-	[ButtonPress] = bpress,
-	[ButtonRelease] = brelease,
-    [SelectionClear] = selclear_,
-	[SelectionNotify] = selnotify,
-/*
- * PropertyNotify is only turned on when there is some INCR transfer happening
- * for the selection retrieval.
- */
-	[PropertyNotify] = propnotify,
-	[SelectionRequest] = selrequest,
-};
-
-/* Globals */
-static DC dc;
-static XWindow xw;
-static XSelection xsel;
-static TermWindow win;
-
-/* Font Ring Cache */
-enum {
-	FRC_NORMAL,
-	FRC_ITALIC,
-	FRC_BOLD,
-	FRC_ITALICBOLD
-};
-
-typedef struct {
-	XftFont *font;
-	int flags;
-	rune unicodep;
-} Fontcache;
-
-/* Fontcache is an array now. A new font will be appended to the array. */
-static Fontcache *frc = nil;
-static int frclen     = 0;
-static int frccap     = 0;
-static char *usedfont = nil;
-static double usedfontsize = 0;
-static double defaultfontsize = 0;
-
-static char *opt_alpha = nil;
-static char *opt_class = nil;
-static char **opt_cmd  = nil;
-static char *opt_embed = nil;
-static char *opt_font  = nil;
-static char *opt_io    = nil;
-static char *opt_line  = nil;
-static char *opt_name  = nil;
-static char *opt_title = nil;
-
-static int oldbutton = 3; /* button event on startup: 3 = release */
-
-void
-clipcopy(Arg *_)
-{
-	Atom clipboard;
-
-	free(xsel.clipboard);
-	xsel.clipboard = nil;
-
-	if (xsel.primary != nil) {
-		xsel.clipboard = xstrdup(xsel.primary);
-		clipboard = XInternAtom(xw.dpy, "CLIPBOARD", 0);
-		XSetSelectionOwner(xw.dpy, clipboard, xw.win, CurrentTime);
-	}
-}
-
-void
-clippaste(Arg *_)
-{
-	Atom clipboard;
-
-	clipboard = XInternAtom(xw.dpy, "CLIPBOARD", 0);
-	XConvertSelection(xw.dpy, clipboard, xsel.xtarget, clipboard,
-			xw.win, CurrentTime);
-}
-
-void
-selpaste(Arg *_)
-{
-	XConvertSelection(xw.dpy, XA_PRIMARY, xsel.xtarget, XA_PRIMARY,
-			xw.win, CurrentTime);
-}
-
-void
-numlock(Arg *_)
-{
-	win.mode ^= Wnumlock;
-}
-
-void
-zoom(Arg *arg)
-{
-	Arg larg;
-
-	larg.f = usedfontsize + arg->f;
-	zoomabs(&larg);
-}
-
-void
-zoomabs(Arg *arg)
-{
-	xunloadfonts();
-	xloadfonts(usedfont, arg->f);
-	cresize(0, 0);
-	redraw();
-	xhints();
-}
-
-void
-zoomreset(Arg *arg)
-{
-	Arg larg;
-
-	if (defaultfontsize > 0) {
-		larg.f = defaultfontsize;
-		zoomabs(&larg);
-	}
-}
-
-void
-ttysend(Arg *arg)
-{
-	ttywrite(arg->s, strlen(arg->s), 1);
-}
-
-int
-evcol(XEvent *e)
-{
-	int x = e->xbutton.x - win.hb;
-	LIMIT(x, 0, win.tw - 1);
-	return x / win.cw;
-}
-
-int
-evrow(XEvent *e)
-{
-	int y = e->xbutton.y - win.vb;
-	LIMIT(y, 0, win.th - 1);
-	return y / win.ch;
-}
-
-void
-mousesel(XEvent *e, int done)
-{
-	int type, seltype = SelRegular;
-	uint state = e->xbutton.state & ~(Button1Mask | forcemousemod);
-
-	for (type = 1; type < arrlen(selmasks); ++type) {
-		if (match(selmasks[type], state)) {
-			seltype = type;
-			break;
-		}
-	}
-	selextend(evcol(e), evrow(e), seltype, done);
-	if (done)
-		setsel(getsel(), e->xbutton.time);
-}
-
-void
-mousereport(XEvent *e)
-{
-	int len, x = evcol(e), y = evrow(e),
-	    button = e->xbutton.button, state = e->xbutton.state;
-	char buf[40];
-	static int ox, oy;
-
-	/* from urxvt */
-	if (e->xbutton.type == MotionNotify) {
-		if (x == ox && y == oy)
-			return;
-		if (!IS_SET(Wmousemotion) && !IS_SET(Wmousemany))
-			return;
-		/* MOUSE_MOTION: no reporting if no button is pressed */
-		if (IS_SET(Wmousemotion) && oldbutton == 3)
-			return;
-
-		button = oldbutton + 32;
-		ox = x;
-		oy = y;
-	} else {
-		if (!IS_SET(Wmousesgr) && e->xbutton.type == ButtonRelease) {
-			button = 3;
-		} else {
-			button -= Button1;
-			if (button >= 3)
-				button += 64 - 3;
-		}
-		if (e->xbutton.type == ButtonPress) {
-			oldbutton = button;
-			ox = x;
-			oy = y;
-		} else if (e->xbutton.type == ButtonRelease) {
-			oldbutton = 3;
-			/* Wmousex10: no button release reporting */
-			if (IS_SET(Wmousex10))
-				return;
-			if (button == 64 || button == 65)
-				return;
-		}
-	}
-
-	if (!IS_SET(Wmousex10)) {
-		button += ((state & ShiftMask  ) ? 4  : 0)
-			+ ((state & Mod4Mask   ) ? 8  : 0)
-			+ ((state & ControlMask) ? 16 : 0);
-	}
-
-	if (IS_SET(Wmousesgr)) {
-		len = snprintf(buf, sizeof(buf), "\033[<%d;%d;%d%c",
-				button, x+1, y+1,
-				e->xbutton.type == ButtonRelease ? 'm' : 'M');
-	} else if (x < 223 && y < 223) {
-		len = snprintf(buf, sizeof(buf), "\033[M%c%c%c",
-				32+button, 32+x+1, 32+y+1);
-	} else {
-		return;
-	}
-
-	ttywrite(buf, len, 0);
-}
-
-uint
-buttonmask(uint button)
-{
-	return button == Button1 ? Button1Mask
-	     : button == Button2 ? Button2Mask
-	     : button == Button3 ? Button3Mask
-	     : button == Button4 ? Button4Mask
-	     : button == Button5 ? Button5Mask
-	     : 0;
-}
-
-int
-mouseaction(XEvent *e, uint release)
-{
-	MouseShortcut *ms;
-
-	/* ignore Button<N>mask for Button<N> - it's set on release */
-	uint state = e->xbutton.state & ~buttonmask(e->xbutton.button);
-
-	for (ms = mshortcuts; ms < mshortcuts + arrlen(mshortcuts); ms++) {
-		if (ms->release == release &&
-		    ms->button == e->xbutton.button &&
-		    (match(ms->mod, state) ||  /* exact or forced */
-		     match(ms->mod, state & ~forcemousemod))) {
-			ms->func(&(ms->arg));
-			return 1;
-		}
-	}
-
-	return 0;
-}
-
-void
-bpress(XEvent *e)
-{
-	struct timespec now;
-	int snap;
-
-	if (IS_SET(Wmouse) && !(e->xbutton.state & forcemousemod)) {
-		mousereport(e);
-		return;
-	}
-
-	if (mouseaction(e, 0))
-		return;
-
-	if (e->xbutton.button == Button1) {
-		/*
-		 * If the user clicks below predefined timeouts specific
-		 * snapping behaviour is exposed.
-		 */
-		clock_gettime(CLOCK_MONOTONIC, &now);
-		if (TIMEDIFF(now, xsel.tclick2) <= tripleclicktimeout) {
-			snap = SnapLine;
-		} else if (TIMEDIFF(now, xsel.tclick1) <= doubleclicktimeout) {
-			snap = SnapWord;
-		} else {
-			snap = 0;
-		}
-		xsel.tclick2 = xsel.tclick1;
-		xsel.tclick1 = now;
-
-		selstart(evcol(e), evrow(e), snap);
-	}
-}
-
-void
-propnotify(XEvent *e)
-{
-	XPropertyEvent *xpev;
-	Atom clipboard = XInternAtom(xw.dpy, "CLIPBOARD", 0);
-
-	xpev = &e->xproperty;
-	if (xpev->state == PropertyNewValue &&
-			(xpev->atom == XA_PRIMARY ||
-			 xpev->atom == clipboard)) {
-		selnotify(e);
-	}
-}
-
-void
-selnotify(XEvent *e)
-{
-	ulong nitems, ofs, rem;
-	int format;
-	uchar *data, *last, *repl;
-	Atom type, incratom, property = None;
-
-	incratom = XInternAtom(xw.dpy, "INCR", 0);
-
-	ofs = 0;
-	if (e->type == SelectionNotify)
-		property = e->xselection.property;
-	else if (e->type == PropertyNotify)
-		property = e->xproperty.atom;
-
-	if (property == None)
-		return;
-
-	do {
-		if (XGetWindowProperty(xw.dpy, xw.win, property, ofs,
-					BUFSIZ/4, False, AnyPropertyType,
-					&type, &format, &nitems, &rem,
-					&data)) {
-			fprintf(stderr, "Clipboard allocation failed\n");
-			return;
-		}
-
-		if (e->type == PropertyNotify && nitems == 0 && rem == 0) {
-			/*
-			 * If there is some PropertyNotify with no data, then
-			 * this is the signal of the selection owner that all
-			 * data has been transferred. We won't need to receive
-			 * PropertyNotify events anymore.
-			 */
-			MODBIT(xw.attrs.event_mask, 0, PropertyChangeMask);
-			XChangeWindowAttributes(xw.dpy, xw.win, CWEventMask,
-					&xw.attrs);
-		}
-
-		if (type == incratom) {
-			/*
-			 * Activate the PropertyNotify events so we receive
-			 * when the selection owner does send us the next
-			 * chunk of data.
-			 */
-			MODBIT(xw.attrs.event_mask, 1, PropertyChangeMask);
-			XChangeWindowAttributes(xw.dpy, xw.win, CWEventMask,
-					&xw.attrs);
-
-			/*
-			 * Deleting the property is the transfer start signal.
-			 */
-			XDeleteProperty(xw.dpy, xw.win, (int)property);
-			continue;
-		}
-
-		/*
-		 * As seen in getsel:
-		 * Line endings are inconsistent in the terminal and GUI world
-		 * copy and pasting. When receiving some selection data,
-		 * replace all '\n' with '\r'.
-		 * FIXME: Fix the computer world.
-		 */
-		repl = data;
-		last = data + nitems * format / 8;
-		while ((repl = memchr(repl, '\n', last - repl))) {
-			*repl++ = '\r';
-		}
-
-		if (IS_SET(Wbrcktpaste) && ofs == 0)
-			ttywrite("\033[200~", 6, 0);
-		ttywrite((char *)data, nitems * format / 8, 1);
-		if (IS_SET(Wbrcktpaste) && rem == 0)
-			ttywrite("\033[201~", 6, 0);
-		XFree(data);
-		/* number of 32-bit chunks returned */
-		ofs += nitems * format / 32;
-	} while (rem > 0);
-
-	/*
-	 * Deleting the property again tells the selection owner to send the
-	 * next data chunk in the property.
-	 */
-	XDeleteProperty(xw.dpy, xw.win, (int)property);
-}
-
-void
-xclipcopy(void)
-{
-	clipcopy(nil);
-}
-
-void
-selclear_(XEvent *e)
-{
-	selclear();
-}
-
-void
-selrequest(XEvent *e)
-{
-	XSelectionRequestEvent *xsre;
-	XSelectionEvent xev;
-	Atom xa_targets, string, clipboard;
-	char *seltext;
-
-	xsre = (XSelectionRequestEvent *) e;
-	xev.type = SelectionNotify;
-	xev.requestor = xsre->requestor;
-	xev.selection = xsre->selection;
-	xev.target = xsre->target;
-	xev.time = xsre->time;
-	if (xsre->property == None)
-		xsre->property = xsre->target;
-
-	/* reject */
-	xev.property = None;
-
-	xa_targets = XInternAtom(xw.dpy, "TARGETS", 0);
-	if (xsre->target == xa_targets) {
-		/* respond with the supported type */
-		string = xsel.xtarget;
-		XChangeProperty(xsre->display, xsre->requestor, xsre->property,
-				XA_ATOM, 32, PropModeReplace,
-				(uchar *) &string, 1);
-		xev.property = xsre->property;
-	} else if (xsre->target == xsel.xtarget || xsre->target == XA_STRING) {
-		/*
-		 * xith XA_STRING non ascii characters may be incorrect in the
-		 * requestor. It is not our problem, use utf8.
-		 */
-		clipboard = XInternAtom(xw.dpy, "CLIPBOARD", 0);
-		if (xsre->selection == XA_PRIMARY) {
-			seltext = xsel.primary;
-		} else if (xsre->selection == clipboard) {
-			seltext = xsel.clipboard;
-		} else {
-			fprintf(stderr,
-				"Unhandled clipboard selection 0x%lx\n",
-				xsre->selection);
-			return;
-		}
-		if (seltext != nil) {
-			XChangeProperty(xsre->display, xsre->requestor,
-					xsre->property, xsre->target,
-					8, PropModeReplace,
-					(uchar *)seltext, strlen(seltext));
-			xev.property = xsre->property;
-		}
-	}
-
-	/* all done, send a notification to the listener */
-	if (!XSendEvent(xsre->display, xsre->requestor, 1, 0, (XEvent *) &xev))
-		fprintf(stderr, "Error sending SelectionNotify event\n");
-}
-
-void
-setsel(char *str, Time t)
-{
-	if (!str)
-		return;
-
-	free(xsel.primary);
-	xsel.primary = str;
-
-	XSetSelectionOwner(xw.dpy, XA_PRIMARY, xw.win, t);
-	if (XGetSelectionOwner(xw.dpy, XA_PRIMARY) != xw.win)
-		selclear();
-}
-
-void
-xsetsel(char *str)
-{
-	setsel(str, CurrentTime);
-}
-
-void
-brelease(XEvent *e)
-{
-	if (IS_SET(Wmouse) && !(e->xbutton.state & forcemousemod)) {
-		mousereport(e);
-		return;
-	}
-
-	if (mouseaction(e, 1))
-		return;
-	if (e->xbutton.button == Button1)
-		mousesel(e, 1);
-}
-
-void
-bmotion(XEvent *e)
-{
-	if (IS_SET(Wmouse) && !(e->xbutton.state & forcemousemod)) {
-		mousereport(e);
-		return;
-	}
-
-	mousesel(e, 0);
-}
-
-void
-cresize(int width, int height)
-{
-	int col, row;
-
-	if (width != 0)
-		win.w = width;
-	if (height != 0)
-		win.h = height;
-
-	col = (win.w - 2 * borderpx) / win.cw;
-	row = (win.h - 2 * borderpx) / win.ch;
-	col = MAX(1, col);
-	row = MAX(1, row);
-
-    win.hb = (win.w - col*win.cw)/2;
-    win.vb = (win.h - row*win.ch)/2;
-
-	tresize(col, row);
-	xresize(col, row);
-	ttyresize(win.tw, win.th);
-}
-
-void
-xresize(int col, int row)
-{
-	win.tw = col * win.cw;
-	win.th = row * win.ch;
-
-	XFreePixmap(xw.dpy, xw.buf);
-	xw.buf = XCreatePixmap(xw.dpy, xw.win, win.w, win.h, xw.depth);
-			
-	XftDrawChange(xw.draw, xw.buf);
-	xclear(0, 0, win.w, win.h);
-
-	/* resize to new width */
-	xw.specbuf = xrealloc(xw.specbuf, col * sizeof(GlyphFontSpec));
-}
-
-ushort
-sixd_to_16bit(int x)
-{
-	return x == 0 ? 0 : 0x3737 + 0x2828 * x;
-}
-
-int
-xloadcolor(int i, char *name, Color *ncolor)
-{
-	XRenderColor color = { .alpha = 0xffff };
-
-	if (!name) {
-		if (BETWEEN(i, 16, 255)) { /* 256 color */
-			if (i < 6*6*6+16) { /* same colors as xterm */
-				color.red   = sixd_to_16bit( ((i-16)/36)%6 );
-				color.green = sixd_to_16bit( ((i-16)/6) %6 );
-				color.blue  = sixd_to_16bit( ((i-16)/1) %6 );
-			} else { /* greyscale */
-				color.red = 0x0808 + 0x0a0a * (i - (6*6*6+16));
-				color.green = color.blue = color.red;
-			}
-			return XftColorAllocValue(xw.dpy, xw.vis, xw.cmap, &color, ncolor);
-		} else
-			name = colorname[i];
-	}
-
-	return XftColorAllocName(xw.dpy, xw.vis, xw.cmap, name, ncolor);
-}
-
-void
-xloadcols(void)
-{
-	int i;
-	static int loaded;
-	Color *cp;
-
-	if (loaded) {
-		for (cp = dc.col; cp < &dc.col[dc.collen]; ++cp)
-			XftColorFree(xw.dpy, xw.vis, xw.cmap, cp);
-	} else {
-		dc.collen = MAX(arrlen(colorname), 256);
-		dc.col = xmalloc(dc.collen * sizeof(Color));
-	}
-
-	for (i = 0; i < dc.collen; i++)
-		if (!xloadcolor(i, nil, &dc.col[i])) {
-			if (colorname[i])
-				fatal("could not allocate color '%s'\n", colorname[i]);
-			else
-				fatal("could not allocate color %d\n", i);
-		}
-
-    if (opt_alpha)
-        alpha = strtof(opt_alpha, nil);
-
-    dc.col[defaultbg].color.alpha = (ushort)(0xffff * alpha);
-    dc.col[defaultbg].pixel      &= 0x00ffffff;
-    dc.col[defaultbg].pixel      |= (uchar)(0xff*alpha) << 24;
-	loaded = 1;
-}
-
-int
-xsetcolorname(int x, char *name)
-{
-	Color ncolor;
-
-	if (!BETWEEN(x, 0, dc.collen))
-		return 1;
-
-	if (!xloadcolor(x, name, &ncolor))
-		return 1;
-
-	XftColorFree(xw.dpy, xw.vis, xw.cmap, &dc.col[x]);
-	dc.col[x] = ncolor;
-
-	return 0;
-}
-
-/*
- * Absolute coordinates.
- */
-void
-xclear(int x1, int y1, int x2, int y2)
-{
-	XftDrawRect(xw.draw, &dc.col[IS_SET(Wreverse)? defaultfg : defaultbg], x1, y1, x2-x1, y2-y1);
-}
-
-void
-xhints(void)
-{
-	XClassHint class = {opt_name ? opt_name : termname,
-	                    opt_class ? opt_class : termname};
-	XWMHints wm = {.flags = InputHint, .input = 1};
-	XSizeHints *sizeh;
-
-	sizeh = XAllocSizeHints();
-
-	sizeh->flags = PSize | PResizeInc | PBaseSize | PMinSize;
-	sizeh->height = win.h, sizeh->width  = win.w;
-	sizeh->height_inc = 1;
-	sizeh->width_inc  = 1;
-	sizeh->base_height = 2 * borderpx;
-	sizeh->base_width  = 2 * borderpx;
-	sizeh->min_height = win.ch + 2 * borderpx;
-	sizeh->min_width  = win.cw + 2 * borderpx;
-	if (xw.isfixed) {
-		sizeh->flags |= PMaxSize;
-		sizeh->min_width = sizeh->max_width = win.w;
-		sizeh->min_height = sizeh->max_height = win.h;
-	}
-	if (xw.gm & (XValue|YValue)) {
-		sizeh->flags |= USPosition | PWinGravity;
-		sizeh->x = xw.l;
-		sizeh->y = xw.t;
-		sizeh->win_gravity = xgeommasktogravity(xw.gm);
-	}
-
-	XSetWMProperties(xw.dpy, xw.win, nil, nil, nil, 0, sizeh, &wm,
-			&class);
-	XFree(sizeh);
-}
-
-int
-xgeommasktogravity(int mask)
-{
-	switch (mask & (XNegative|YNegative)) {
-	case 0:
-		return NorthWestGravity;
-	case XNegative:
-		return NorthEastGravity;
-	case YNegative:
-		return SouthWestGravity;
-	}
-
-	return SouthEastGravity;
-}
-
-int
-xloadfont(Font *f, FcPattern *pattern)
-{
-	FcPattern *configured;
-	FcPattern *match;
-	FcResult result;
-	XGlyphInfo extents;
-	int wantattr, haveattr;
-
-	/*
-	 * Manually configure instead of calling XftMatchFont
-	 * so that we can use the configured pattern for
-	 * "missing glyph" lookups.
-	 */
-	configured = FcPatternDuplicate(pattern);
-	if (!configured)
-		return 1;
-
-	FcConfigSubstitute(nil, configured, FcMatchPattern);
-	XftDefaultSubstitute(xw.dpy, xw.scr, configured);
-
-	match = FcFontMatch(nil, configured, &result);
-	if (!match) {
-		FcPatternDestroy(configured);
-		return 1;
-	}
-
-	if (!(f->match = XftFontOpenPattern(xw.dpy, match))) {
-		FcPatternDestroy(configured);
-		FcPatternDestroy(match);
-		return 1;
-	}
-
-	if ((XftPatternGetInteger(pattern, "slant", 0, &wantattr) ==
-	    XftResultMatch)) {
-		/*
-		 * Check if xft was unable to find a font with the appropriate
-		 * slant but gave us one anyway. Try to mitigate.
-		 */
-		if ((XftPatternGetInteger(f->match->pattern, "slant", 0,
-		    &haveattr) != XftResultMatch) || haveattr < wantattr) {
-			f->badslant = 1;
-			fputs("font slant does not match\n", stderr);
-		}
-	}
-
-	if ((XftPatternGetInteger(pattern, "weight", 0, &wantattr) ==
-	    XftResultMatch)) {
-		if ((XftPatternGetInteger(f->match->pattern, "weight", 0,
-		    &haveattr) != XftResultMatch) || haveattr != wantattr) {
-			f->badweight = 1;
-			fputs("font weight does not match\n", stderr);
-		}
-	}
-
-	XftTextExtentsUtf8(xw.dpy, f->match,
-		(const FcChar8 *) ascii_printable,
-		strlen(ascii_printable), &extents);
-
-	f->set = nil;
-	f->pattern = configured;
-
-	f->ascent = f->match->ascent;
-	f->descent = f->match->descent;
-	f->lbearing = 0;
-	f->rbearing = f->match->max_advance_width;
-
-	f->height = f->ascent + f->descent;
-	f->width = DIVCEIL(extents.xOff, strlen(ascii_printable));
-
-	return 0;
-}
-
-void
-xloadfonts(char *fontstr, double fontsize)
-{
-	FcPattern *pattern;
-	double fontval;
-
-	if (fontstr[0] == '-')
-		pattern = XftXlfdParse(fontstr, False, False);
-	else
-		pattern = FcNameParse((FcChar8 *)fontstr);
-
-	if (!pattern)
-		fatal("can't open font %s\n", fontstr);
-
-	if (fontsize > 1) {
-		FcPatternDel(pattern, FC_PIXEL_SIZE);
-		FcPatternDel(pattern, FC_SIZE);
-		FcPatternAddDouble(pattern, FC_PIXEL_SIZE, (double)fontsize);
-		usedfontsize = fontsize;
-	} else {
-		if (FcPatternGetDouble(pattern, FC_PIXEL_SIZE, 0, &fontval) ==
-				FcResultMatch) {
-			usedfontsize = fontval;
-		} else if (FcPatternGetDouble(pattern, FC_SIZE, 0, &fontval) ==
-				FcResultMatch) {
-			usedfontsize = -1;
-		} else {
-			/*
-			 * Default font size is 12, if none given. This is to
-			 * have a known usedfontsize value.
-			 */
-			FcPatternAddDouble(pattern, FC_PIXEL_SIZE, 12);
-			usedfontsize = 12;
-		}
-		defaultfontsize = usedfontsize;
-	}
-
-	if (xloadfont(&dc.font, pattern))
-		fatal("can't open font %s\n", fontstr);
-
-	if (usedfontsize < 0) {
-		FcPatternGetDouble(dc.font.match->pattern,
-		                   FC_PIXEL_SIZE, 0, &fontval);
-		usedfontsize = fontval;
-		if (fontsize == 0)
-			defaultfontsize = fontval;
-	}
-
-	/* Setting character width and height. */
-	win.cw = ceilf(dc.font.width * cwscale);
-	win.ch = ceilf(dc.font.height * chscale);
-
-	FcPatternDel(pattern, FC_SLANT);
-	FcPatternAddInteger(pattern, FC_SLANT, FC_SLANT_ITALIC);
-	if (xloadfont(&dc.ifont, pattern))
-		fatal("can't open font %s\n", fontstr);
-
-	FcPatternDel(pattern, FC_WEIGHT);
-	FcPatternAddInteger(pattern, FC_WEIGHT, FC_WEIGHT_BOLD);
-	if (xloadfont(&dc.ibfont, pattern))
-		fatal("can't open font %s\n", fontstr);
-
-	FcPatternDel(pattern, FC_SLANT);
-	FcPatternAddInteger(pattern, FC_SLANT, FC_SLANT_ROMAN);
-	if (xloadfont(&dc.bfont, pattern))
-		fatal("can't open font %s\n", fontstr);
-
-	FcPatternDestroy(pattern);
-}
-
-void
-xunloadfont(Font *f)
-{
-	XftFontClose(xw.dpy, f->match);
-	FcPatternDestroy(f->pattern);
-	if (f->set)
-		FcFontSetDestroy(f->set);
-}
-
-void
-xunloadfonts(void)
-{
-#if 0
-    hbunloadfonts();
-#endif
-
-	/* Free the loaded fonts in the font cache.  */
-	while (frclen > 0)
-		XftFontClose(xw.dpy, frc[--frclen].font);
-
-	xunloadfont(&dc.font);
-	xunloadfont(&dc.bfont);
-	xunloadfont(&dc.ifont);
-	xunloadfont(&dc.ibfont);
-}
-
-int
-ximopen(Display *dpy)
-{
-	XIMCallback imdestroy = { .client_data = nil, .callback = ximdestroy };
-	XICCallback icdestroy = { .client_data = nil, .callback = xicdestroy };
-
-	xw.ime.xim = XOpenIM(xw.dpy, nil, nil, nil);
-	if (xw.ime.xim == nil)
-		return 0;
-
-	if (XSetIMValues(xw.ime.xim, XNDestroyCallback, &imdestroy, nil))
-		fprintf(stderr, "XSetIMValues: "
-		                "Could not set XNDestroyCallback.\n");
-
-	xw.ime.spotlist = XVaCreateNestedList(0, XNSpotLocation, &xw.ime.spot,
-	                                      nil);
-
-	if (xw.ime.xic == nil) {
-		xw.ime.xic = XCreateIC(xw.ime.xim, XNInputStyle,
-		                       XIMPreeditNothing | XIMStatusNothing,
-		                       XNClientWindow, xw.win,
-		                       XNDestroyCallback, &icdestroy,
-		                       nil);
-	}
-	if (xw.ime.xic == nil)
-		fprintf(stderr, "XCreateIC: Could not create input context.\n");
-
-	return 1;
-}
-
-void
-ximinstantiate(Display *dpy, XPointer client, XPointer call)
-{
-	if (ximopen(dpy))
-		XUnregisterIMInstantiateCallback(xw.dpy, nil, nil, nil,
-		                                 ximinstantiate, nil);
-}
-
-void
-ximdestroy(XIM xim, XPointer client, XPointer call)
-{
-	xw.ime.xim = nil;
-	XRegisterIMInstantiateCallback(xw.dpy, nil, nil, nil,
-	                               ximinstantiate, nil);
-	XFree(xw.ime.spotlist);
-}
-
-int
-xicdestroy(XIC xim, XPointer client, XPointer call)
-{
-	xw.ime.xic = nil;
-	return 1;
-}
-
-void
-xinit(int cols, int rows)
-{
-	XGCValues gcvalues;
-	Cursor    cursor;
-	Window    parent;
-	XColor    xmousefg, xmousebg;
-    XWindowAttributes attr;
-    XVisualInfo       vis;
-	pid_t thispid = getpid();
-
-	if (!(xw.dpy = XOpenDisplay(nil)))
-		fatal("can't open display\n");
-
-    if (!(opt_embed && (parent == strtol(opt_embed, nil, 0)))) {
-        parent   = XRootWindow(xw.dpy, xw.scr);
-        xw.depth = 32;
-    } else {
-        XGetWindowAttributes(xw.dpy, parent, &attr);
-        xw.depth = attr.depth;
-    }
-
-    XMatchVisualInfo(xw.dpy, xw.scr, xw.depth, TrueColor, &vis);
-    xw.vis = vis.visual;
-	xw.scr = XDefaultScreen(xw.dpy);
-
-	/* font */
-	if (!FcInit())
-		fatal("could not init fontconfig.\n");
-
-	usedfont = (opt_font == nil)? font : opt_font;
-	xloadfonts(usedfont, 0);
-
-	/* colors */
-	xw.cmap = XCreateColormap(xw.dpy, parent, xw.vis, None);
-	xloadcols();
-
-	/* adjust fixed window geometry */
-	win.w = 2 * win.hb + cols*win.cw;
-	win.h = 2 * win.vb + rows*win.ch;
-
-	if (xw.gm & XNegative)
-		xw.l += DisplayWidth(xw.dpy, xw.scr) - win.w - 2;
-	if (xw.gm & YNegative)
-		xw.t += DisplayHeight(xw.dpy, xw.scr) - win.h - 2;
-
-	/* Events */
-	xw.attrs.background_pixel = dc.col[defaultbg].pixel;
-	xw.attrs.border_pixel     = dc.col[defaultbg].pixel;
-	xw.attrs.bit_gravity      = NorthWestGravity;
-	xw.attrs.event_mask       = FocusChangeMask | KeyPressMask | KeyReleaseMask
-                    | ExposureMask | VisibilityChangeMask | StructureNotifyMask
-                    | ButtonMotionMask | ButtonPressMask | ButtonReleaseMask;
-	xw.attrs.colormap = xw.cmap;
-
-	xw.win = XCreateWindow(xw.dpy, parent, xw.l, xw.t,
-			win.w, win.h, 0, xw.depth, InputOutput,
-			xw.vis, CWBackPixel | CWBorderPixel | CWBitGravity
-			| CWEventMask | CWColormap, &xw.attrs);
-
-	memset(&gcvalues, 0, sizeof(gcvalues));
-	gcvalues.graphics_exposures = False;
-
-    xw.buf = XCreatePixmap(xw.dpy, xw.win, win.w, win.h, xw.depth);
-    dc.gc  = XCreateGC(xw.dpy, xw.buf, GCGraphicsExposures, &gcvalues);
-
-	XSetForeground(xw.dpy, dc.gc, dc.col[defaultbg].pixel);
-	XFillRectangle(xw.dpy, xw.buf, dc.gc, 0, 0, win.w, win.h);
-
-	/* font spec buffer */
-	xw.specbuf = xmalloc(cols * sizeof(GlyphFontSpec));
-
-	/* Xft rendering context */
-	xw.draw = XftDrawCreate(xw.dpy, xw.buf, xw.vis, xw.cmap);
-
-	/* input methods */
-	if (!ximopen(xw.dpy))
-		XRegisterIMInstantiateCallback(xw.dpy, nil, nil, nil, ximinstantiate, nil);
-
-	/* white cursor, black outline */
-	cursor = XCreateFontCursor(xw.dpy, mouseshape);
-	XDefineCursor(xw.dpy, xw.win, cursor);
-
-	if (XParseColor(xw.dpy, xw.cmap, colorname[mousefg], &xmousefg) == 0) {
-		xmousefg.red   = 0xffff;
-		xmousefg.green = 0xffff;
-		xmousefg.blue  = 0xffff;
-	}
-
-	if (XParseColor(xw.dpy, xw.cmap, colorname[mousebg], &xmousebg) == 0) {
-		xmousebg.red   = 0x0000;
-		xmousebg.green = 0x0000;
-		xmousebg.blue  = 0x0000;
-	}
-
-	XRecolorCursor(xw.dpy, cursor, &xmousefg, &xmousebg);
-
-	xw.xembed      = XInternAtom(xw.dpy, "_XEMBED", False);
-	xw.wmdeletewin = XInternAtom(xw.dpy, "WM_DELETE_WINDOW", False);
-	xw.netwmname   = XInternAtom(xw.dpy, "_NET_WM_NAME", False);
-	XSetWMProtocols(xw.dpy, xw.win, &xw.wmdeletewin, 1);
-
-	xw.netwmpid = XInternAtom(xw.dpy, "_NET_WM_PID", False);
-	XChangeProperty(xw.dpy, xw.win, xw.netwmpid, XA_CARDINAL, 32,
-			PropModeReplace, (uchar *)&thispid, 1);
-
-	win.mode = Wnumlock;
-	resettitle();
-	xhints();
-
-	XMapWindow(xw.dpy, xw.win);
-	XSync(xw.dpy, False);
-
-	clock_gettime(CLOCK_MONOTONIC, &xsel.tclick1);
-	clock_gettime(CLOCK_MONOTONIC, &xsel.tclick2);
-	xsel.primary = nil;
-	xsel.clipboard = nil;
-	xsel.xtarget = XInternAtom(xw.dpy, "UTF8_STRING", 0);
-	if (xsel.xtarget == None)
-		xsel.xtarget = XA_STRING;
-}
-
-int
-xmakeglyphfontspecs(XftGlyphFontSpec *specs, Letter *glyphs, int len, int x, int y)
-{
-	float winx = win.hb + x * win.cw, winy = win.vb + y * win.ch, xp, yp;
-	ushort mode, prevmode = USHRT_MAX;
-	Font *font      = &dc.font;
-	int frcflags    = FRC_NORMAL;
-	float runewidth = win.cw;
-	rune r;
-	FT_UInt glyphidx;
-	FcResult fcres;
-	FcPattern *fcpattern, *fontpattern;
-	FcFontSet *fcsets[] = { nil };
-	FcCharSet *fccharset;
-	int i, f, numspecs = 0;
-
-	for(i = 0, xp = winx, yp = winy + font->ascent; i < len; ++i) {
-		/* Fetch rune and mode for current glyph. */
-		r = glyphs[i].u;
-		mode = glyphs[i].mode;
-
-		/* Skip dummy wide-character spacing. */
-#if 0
-		if(mode & Gwdummy)
-#endif
-        if(mode == Gwdummy)
-			continue;
-
-		/* Determine font for glyph if different from previous glyph. */
-		if(prevmode != mode){
-			prevmode = mode;
-			font = &dc.font;
-			frcflags = FRC_NORMAL;
-			runewidth = win.cw * ((mode & Gwide) ? 2.0f : 1.0f);
-			if ((mode & Gitalic) && (mode & Gbold)) {
-				font = &dc.ibfont;
-				frcflags = FRC_ITALICBOLD;
-			} else if (mode & Gitalic) {
-				font = &dc.ifont;
-				frcflags = FRC_ITALIC;
-			} else if (mode & Gbold) {
-				font = &dc.bfont;
-				frcflags = FRC_BOLD;
-			}
-			yp = winy + font->ascent;
-		}
-
-		/* lookup character index with default font. */
-		glyphidx = XftCharIndex(xw.dpy, font->match, r);
-		if(glyphidx){
-			specs[numspecs].font  = font->match;
-			specs[numspecs].glyph = glyphidx;
-			specs[numspecs].x     = (short)xp;
-			specs[numspecs].y     = (short)yp;
-			xp += runewidth;
-			numspecs++;
-			continue;
-		}
-
-		/* Fallback on font cache, search the font cache for match. */
-		for(f = 0; f < frclen; f++) {
-			glyphidx = XftCharIndex(xw.dpy, frc[f].font, r);
-			/* Everything correct. */
-			if (glyphidx && frc[f].flags == frcflags)
-				break;
-			/* We got a default font for a not found glyph. */
-			if (!glyphidx && frc[f].flags == frcflags
-					&& frc[f].unicodep == r) {
-				break;
-			}
-		}
-
-		/* Nothing was found. Use fontconfig to find matching font. */
-		if(f >= frclen) {
-			if (!font->set)
-				font->set = FcFontSort(0, font->pattern,
-				                       1, 0, &fcres);
-			fcsets[0] = font->set;
-
-			/*
-			 * Nothing was found in the cache. Now use
-			 * some dozen of Fontconfig calls to get the
-			 * font for one single character.
-			 *
-			 * Xft and fontconfig are design failures.
-			 */
-			fcpattern = FcPatternDuplicate(font->pattern);
-			fccharset = FcCharSetCreate();
-
-			FcCharSetAddChar(fccharset, r);
-			FcPatternAddCharSet(fcpattern, FC_CHARSET,
-					fccharset);
-			FcPatternAddBool(fcpattern, FC_SCALABLE, 1);
-
-			FcConfigSubstitute(0, fcpattern,
-					FcMatchPattern);
-			FcDefaultSubstitute(fcpattern);
-
-			fontpattern = FcFontSetMatch(0, fcsets, 1,
-					fcpattern, &fcres);
-
-			/* Allocate memory for the new cache entry. */
-			if (frclen >= frccap) {
-				frccap += 16;
-				frc = xrealloc(frc, frccap * sizeof(Fontcache));
-			}
-
-			frc[frclen].font = XftFontOpenPattern(xw.dpy,
-					fontpattern);
-			if (!frc[frclen].font)
-				fatal("XftFontOpenPattern failed seeking fallback font: %s\n",
-					strerror(errno));
-			frc[frclen].flags = frcflags;
-			frc[frclen].unicodep = r;
-
-			glyphidx = XftCharIndex(xw.dpy, frc[frclen].font, r);
-
-			f = frclen;
-			frclen++;
-
-			FcPatternDestroy(fcpattern);
-			FcCharSetDestroy(fccharset);
-		}
-
-		specs[numspecs].font = frc[f].font;
-		specs[numspecs].glyph = glyphidx;
-		specs[numspecs].x = (short)xp;
-		specs[numspecs].y = (short)yp;
-		xp += runewidth;
-		numspecs++;
-	}
-
-#if 0
-    hbtransform(specs, glyphs, len, x, y);
-#endif
-
-	return numspecs;
-}
-
-void
-xdrawglyphfontspecs(XftGlyphFontSpec *specs, Letter base, int len, int x, int y)
-{
-	int charlen = len * ((base.mode & Gwide) ? 2 : 1);
-	int winx = win.hb + x * win.cw, winy = win.vb + y * win.ch, width = charlen * win.cw;
-	Color *fg, *bg, *temp, revfg, revbg, truefg, truebg;
-	XRenderColor colfg, colbg;
-	XRectangle r;
-
-	/* Fallback on color display for attributes not supported by the font */
-	if (base.mode & Gitalic && base.mode & Gbold) {
-		if (dc.ibfont.badslant || dc.ibfont.badweight)
-			base.fg = defaultattr;
-	} else if ((base.mode & Gitalic && dc.ifont.badslant) ||
-	    (base.mode & Gbold && dc.bfont.badweight)) {
-		base.fg = defaultattr;
-	}
-
-	if (IS_TRUECOL(base.fg)) {
-		colfg.alpha = 0xffff;
-		colfg.red   = TRUERED(base.fg);
-		colfg.green = TRUEGREEN(base.fg);
-		colfg.blue  = TRUEBLUE(base.fg);
-		XftColorAllocValue(xw.dpy, xw.vis, xw.cmap, &colfg, &truefg);
-		fg = &truefg;
-	} else {
-		fg = &dc.col[base.fg];
-	}
-
-	if (IS_TRUECOL(base.bg)) {
-		colbg.alpha = 0xffff;
-		colbg.green = TRUEGREEN(base.bg);
-		colbg.red   = TRUERED(base.bg);
-		colbg.blue  = TRUEBLUE(base.bg);
-		XftColorAllocValue(xw.dpy, xw.vis, xw.cmap, &colbg, &truebg);
-		bg = &truebg;
-	} else {
-		bg = &dc.col[base.bg];
-	}
-
-	/* Change basic system colors [0-7] to bright system colors [8-15] */
-	if ((base.mode & Gfaint) == Gbold && BETWEEN(base.fg, 0, 7))
-		fg = &dc.col[base.fg + 8];
-
-	if (IS_SET(Wreverse)) {
-		if (fg == &dc.col[defaultfg]) {
-			fg = &dc.col[defaultbg];
-		} else {
-			colfg.red   = ~fg->color.red;
-			colfg.green = ~fg->color.green;
-			colfg.blue  = ~fg->color.blue;
-			colfg.alpha = fg->color.alpha;
-			XftColorAllocValue(xw.dpy, xw.vis, xw.cmap, &colfg, &revfg);
-			fg = &revfg;
-		}
-
-		if (bg == &dc.col[defaultbg]) {
-			bg = &dc.col[defaultfg];
-		} else {
-			colbg.red   = ~bg->color.red;
-			colbg.green = ~bg->color.green;
-			colbg.blue  = ~bg->color.blue;
-			colbg.alpha = bg->color.alpha;
-			XftColorAllocValue(xw.dpy, xw.vis, xw.cmap, &colbg, &revbg);
-			bg = &revbg;
-		}
-	}
-
-	if ((base.mode & Gboldfaint) == Gfaint) {
-		colfg.red   = fg->color.red / 2;
-		colfg.green = fg->color.green / 2;
-		colfg.blue  = fg->color.blue / 2;
-		colfg.alpha = fg->color.alpha;
-		XftColorAllocValue(xw.dpy, xw.vis, xw.cmap, &colfg, &revfg);
-		fg = &revfg;
-	}
-
-	if (base.mode & Greverse)
-		temp = fg, fg = bg, bg = temp;
-
-	if (base.mode & Gblink && win.mode & Wblink)
-		fg = bg;
-
-	if (base.mode & Ginvisible)
-		fg = bg;
-
-	/* Intelligent cleaning up of the borders. */
-	if (x == 0) {
-		xclear(0, (y == 0)? 0 : winy, win.vb,
-			winy + win.ch +
-			((winy + win.ch >= win.vb + win.th)? win.h : 0));
-	}
-	if (winx + width >= win.hb + win.tw) {
-		xclear(winx + width, (y == 0)? 0 : winy, win.w,
-			((winy + win.ch >= win.vb + win.th)? win.h : (winy + win.ch)));
-	}
-	if (y == 0)
-		xclear(winx, 0, winx + width, win.hb);
-	if (winy + win.ch >= win.hb + win.th)
-		xclear(winx, winy + win.ch, winx + width, win.h);
-
-	/* Clean up the region we want to draw to. */
-	XftDrawRect(xw.draw, bg, winx, winy, width, win.ch);
-
-	/* Set the clip region because Xft is sometimes dirty. */
-	r.x = 0, r.y = 0;
-	r.height = win.ch;
-	r.width  = width;
-	XftDrawSetClipRectangles(xw.draw, winx, winy, &r, 1);
-
-	/* Render the glyphs. */
-	XftDrawGlyphFontSpec(xw.draw, fg, specs, len);
-
-	/* Render underline and strikethrough. */
-	if (base.mode & Gunline) 
-		XftDrawRect(xw.draw, fg, winx, winy + dc.font.ascent + 1, width, 1);
-
-	if (base.mode & Gstruck)
-		XftDrawRect(xw.draw, fg, winx, winy + 2 * dc.font.ascent / 3, width, 1);
-
-	/* Reset clip to none. */
-	XftDrawSetClip(xw.draw, 0);
-}
-
-void
-xdrawglyph(Letter g, int x, int y)
-{
-	int numspecs;
-	XftGlyphFontSpec spec;
-
-	numspecs = xmakeglyphfontspecs(&spec, &g, 1, x, y);
-	xdrawglyphfontspecs(&spec, g, numspecs, x, y);
-}
-
-void
-xdrawcursor(int cx, int cy, Letter g, int ox, int oy, Letter og, Letter *line, int len)
-{
-	Color drawcol;
-
-	/* remove the old cursor */
-	if(selected(ox, oy))
-		og.mode ^= Greverse;
-    xdrawglyph(og, ox, oy);
-#if 0
-	xdrawline(line, 0, oy, len);
-#endif
-
-	if(IS_SET(Whide))
-		return;
-
-	/*
-	 * Select the right color for the right mode.
-	 */
-	g.mode &= Gbold|Gitalic|Gunline|Gstruck|Gwide;
-
-	if(IS_SET(Wreverse)) {
-		g.mode |= Greverse;
-		g.bg    = defaultfg;
-		if (selected(cx, cy)) {
-			drawcol = dc.col[defaultcs];
-			g.fg    = defaultrcs;
-		} else {
-			drawcol = dc.col[defaultrcs];
-			g.fg = defaultcs;
-		}
-	} else {
-		if(selected(cx, cy)) {
-			g.fg = defaultfg;
-			g.bg = defaultrcs;
-		} else {
-            g.fg = og.bg; //defaultbg;
-            g.bg = og.fg; //defaultcs;
-            if (IS_TRUECOL(og.fg)) {
-                drawcol.color.alpha = 0xffff;
-                drawcol.color.red   = TRUERED(og.fg);
-                drawcol.color.green = TRUEGREEN(og.fg);
-                drawcol.color.blue  = TRUEBLUE(og.fg);
-                goto drawnew;
-            }
-		}
-		drawcol = dc.col[g.bg];
-	}
-
-drawnew:
-	if(IS_SET(Wfocused)) {
-		switch (win.cursor) {
-		case 7: /* st extension */
-			g.u = 0x2603; /* snowman (U+2603) */
-			/* fallthrough */
-		case 0: /* Blinking Block */
-		case 1: /* Blinking Block (Default) */
-		case 2: /* Steady Block */
-			xdrawglyph(g, cx, cy);
-			break;
-		case 3: /* Blinking Underline */
-		case 4: /* Steady Underline */
-			XftDrawRect(xw.draw, &drawcol, 
-                    win.hb + cx * win.cw,
-					win.vb + (cy + 1) * win.ch - cursorthickness,
-					win.cw, cursorthickness);
-			break;
-		case 5: /* Blinking bar */
-		case 6: /* Steady bar */
-			XftDrawRect(xw.draw, &drawcol,
-					win.hb + cx * win.cw,
-					win.vb + cy * win.ch,
-					cursorthickness, win.ch);
-			break;
-		}
-	} else {
-		XftDrawRect(xw.draw, &drawcol,
-				win.hb + cx * win.cw,
-				win.vb + cy * win.ch,
-				win.cw - 1, 1);
-		XftDrawRect(xw.draw, &drawcol,
-				win.hb + cx * win.cw,
-				win.vb + cy * win.ch,
-				1, win.ch - 1);
-		XftDrawRect(xw.draw, &drawcol,
-				win.hb + (cx + 1) * win.cw - 1,
-				win.vb + cy * win.ch,
-				1, win.ch - 1);
-		XftDrawRect(xw.draw, &drawcol,
-				win.hb + cx * win.cw,
-				win.vb + (cy + 1) * win.ch - 1,
-				win.cw, 1);
-	}
-}
-
-void
-xsetenv(void)
-{
-	char buf[sizeof(long) * 8 + 1];
-
-	snprintf(buf, sizeof(buf), "%lu", xw.win);
-	setenv("WINDOWID", buf, 1);
-}
-
-void
-xsettitle(char *p)
-{
-	XTextProperty prop;
-	DEFAULT(p, opt_title);
-
-	Xutf8TextListToTextProperty(xw.dpy, &p, 1, XUTF8StringStyle,
-			&prop);
-	XSetWMName(xw.dpy, xw.win, &prop);
-	XSetTextProperty(xw.dpy, xw.win, &prop, xw.netwmname);
-	XFree(prop.value);
-}
-
-int
-xstartdraw(void)
-{
-	return IS_SET(Wvisible);
-}
-
-void
-xdrawline(Letter *line, int x1, int y1, int x2)
-{
-	int i, x, ox, numspecs;
-	Letter base, new;
-	XftGlyphFontSpec *specs = xw.specbuf;
-
-	numspecs = xmakeglyphfontspecs(specs, &line[x1], x2 - x1, x1, y1);
-	i = ox = 0;
-	for (x = x1; x < x2 && i < numspecs; x++) {
-		new = line[x];
-		if (new.mode == Gwdummy)
-			continue;
-		if (selected(x, y1))
-			new.mode ^= Greverse;
-		if (i > 0 && GLYPHCMP(base, new)) {
-			xdrawglyphfontspecs(specs, base, i, ox, y1);
-			specs += i;
-			numspecs -= i;
-			i = 0;
-		}
-		if (i == 0) {
-			ox = x;
-			base = new;
-		}
-		i++;
-	}
-	if (i > 0)
-		xdrawglyphfontspecs(specs, base, i, ox, y1);
-}
-
-void
-xfinishdraw(void)
-{
-	XCopyArea(xw.dpy, xw.buf, xw.win, dc.gc, 0, 0, win.w,
-			win.h, 0, 0);
-	XSetForeground(xw.dpy, dc.gc,
-			dc.col[IS_SET(Wreverse)?
-				defaultfg : defaultbg].pixel);
-}
-
-void
-xximspot(int x, int y)
-{
-	if (xw.ime.xic == nil)
-		return;
-
-	xw.ime.spot.x = borderpx + x * win.cw;
-	xw.ime.spot.y = borderpx + (y + 1) * win.ch;
-
-	XSetICValues(xw.ime.xic, XNPreeditAttributes, xw.ime.spotlist, nil);
-}
-
-void
-expose(XEvent *ev)
-{
-	redraw();
-}
-
-void
-visibility(XEvent *ev)
-{
-	XVisibilityEvent *e = &ev->xvisibility;
-
-	MODBIT(win.mode, e->state != VisibilityFullyObscured, Wvisible);
-}
-
-void
-unmap(XEvent *ev)
-{
-	win.mode &= ~Wvisible;
-}
-
-void
-xsetpointermotion(int set)
-{
-	MODBIT(xw.attrs.event_mask, set, PointerMotionMask);
-	XChangeWindowAttributes(xw.dpy, xw.win, CWEventMask, &xw.attrs);
-}
-
-void
-xsetmode(int set, uint flags)
-{
-	int mode = win.mode;
-	MODBIT(win.mode, set, flags);
-	if ((win.mode & Wreverse) != (mode & Wreverse))
-		redraw();
-}
-
-int
-xsetcursor(int cursor)
-{
-	if (!BETWEEN(cursor, 0, 7)) /* 7: st extension */
-		return 1;
-	win.cursor = cursor;
-	return 0;
-}
-
-void
-xseturgency(int add)
-{
-	XWMHints *h = XGetWMHints(xw.dpy, xw.win);
-
-	MODBIT(h->flags, add, XUrgencyHint);
-	XSetWMHints(xw.dpy, xw.win, h);
-	XFree(h);
-}
-
-void
-xbell(void)
-{
-	if (!(IS_SET(Wfocused)))
-		xseturgency(1);
-	if (bellvolume)
-		XkbBell(xw.dpy, xw.win, bellvolume, (Atom)nil);
-}
-
-void
-focus(XEvent *ev)
-{
-	XFocusChangeEvent *e = &ev->xfocus;
-
-	if (e->mode == NotifyGrab)
-		return;
-
-	if (ev->type == FocusIn) {
-		if (xw.ime.xic)
-			XSetICFocus(xw.ime.xic);
-		win.mode |= Wfocused;
-		xseturgency(0);
-		if (IS_SET(Wfocus))
-			ttywrite("\033[I", 3, 0);
-	} else {
-		if (xw.ime.xic)
-			XUnsetICFocus(xw.ime.xic);
-		win.mode &= ~Wfocused;
-		if (IS_SET(Wfocus))
-			ttywrite("\033[O", 3, 0);
-	}
-}
-
-int
-match(uint mask, uint state)
-{
-	return mask == XK_ANY_MOD || mask == (state & ~ignoremod);
-}
-
-char*
-kmap(KeySym k, uint state)
-{
-	Key *kp;
-	int i;
-
-	/* Check for mapped keys out of X11 function keys. */
-	for (i = 0; i < arrlen(mappedkeys); i++) {
-		if (mappedkeys[i] == k)
-			break;
-	}
-	if (i == arrlen(mappedkeys)) {
-		if ((k & 0xFFFF) < 0xFD00)
-			return nil;
-	}
-
-	for (kp = key; kp < key + arrlen(key); kp++) {
-		if (kp->k != k)
-			continue;
-
-		if (!match(kp->mask, state))
-			continue;
-
-		if (IS_SET(Wappkeypad) ? kp->appkey < 0 : kp->appkey > 0)
-			continue;
-		if (IS_SET(Wnumlock) && kp->appkey == 2)
-			continue;
-
-		if (IS_SET(Wappcursor) ? kp->appcursor < 0 : kp->appcursor > 0)
-			continue;
-
-		return kp->s;
-	}
-
-	return nil;
-}
-
-void
-kpress(XEvent *ev)
-{
-	XKeyEvent *e = &ev->xkey;
-	KeySym ksym;
-	char buf[64], *customkey;
-	int len;
-	rune c;
-	Status status;
-	Shortcut *bp;
-
-	if (IS_SET(Wkbdblock))
-		return;
-
-	if (xw.ime.xic)
-		len = XmbLookupString(xw.ime.xic, e, buf, sizeof buf, &ksym, &status);
-	else
-		len = XLookupString(e, buf, sizeof buf, &ksym, nil);
-	/* 1. shortcuts */
-	for (bp = shortcuts; bp < shortcuts + arrlen(shortcuts); bp++) {
-		if (ksym == bp->keysym && match(bp->mod, e->state)) {
-			bp->func(&(bp->arg));
-			return;
-		}
-	}
-
-	/* 2. custom keys from config.h */
-	if ((customkey = kmap(ksym, e->state))) {
-		ttywrite(customkey, strlen(customkey), 1);
-		return;
-	}
-
-	/* 3. composed string from input method */
-	if (len == 0)
-		return;
-	if (len == 1 && e->state & Mod1Mask) {
-		if (IS_SET(W8bit)) {
-			if (*buf < 0177) {
-				c = *buf | 0x80;
-				len = utf8·encode(&c, buf);
-			}
-		} else {
-			buf[1] = buf[0];
-			buf[0] = '\033';
-			len = 2;
-		}
-	}
-	ttywrite(buf, len, 1);
-}
-
-void
-cmessage(XEvent *e)
-{
-	/*
-	 * See xembed specs
-	 *  http://standards.freedesktop.org/xembed-spec/xembed-spec-latest.html
-	 */
-	if (e->xclient.message_type == xw.xembed && e->xclient.format == 32) {
-		if (e->xclient.data.l[1] == XEMBED_FOCUS_IN) {
-			win.mode |= Wfocused;
-			xseturgency(0);
-		} else if (e->xclient.data.l[1] == XEMBED_FOCUS_OUT) {
-			win.mode &= ~Wfocused;
-		}
-	} else if (e->xclient.data.l[0] == xw.wmdeletewin) {
-		ttyhangup();
-		exit(0);
-	}
-}
-
-void
-resize(XEvent *e)
-{
-	if (e->xconfigure.width == win.w && e->xconfigure.height == win.h)
-		return;
-
-	cresize(e->xconfigure.width, e->xconfigure.height);
-}
-
-void
-run(void)
-{
-	XEvent ev;
-	int w = win.w, h = win.h;
-	fd_set rfd;
-	int xfd = XConnectionNumber(xw.dpy), ttyfd, xev, drawing;
-	struct timespec seltv, *tv, now, lastblink, trigger;
-	double timeout;
-
-	/* Waiting for window mapping */
-	do {
-		XNextEvent(xw.dpy, &ev);
-		/*
-		 * This XFilterEvent call is required because of XOpenIM. It
-		 * does filter out the key event and some client message for
-		 * the input method too.
-		 */
-		if (XFilterEvent(&ev, None))
-			continue;
-		if (ev.type == ConfigureNotify) {
-			w = ev.xconfigure.width;
-			h = ev.xconfigure.height;
-		}
-	} while (ev.type != MapNotify);
-
-	ttyfd = ttynew(opt_line, shell, opt_io, opt_cmd);
-	cresize(w, h);
-
-	for (timeout = -1, drawing = 0, lastblink = (struct timespec){0};;) {
-		FD_ZERO(&rfd);
-		FD_SET(ttyfd, &rfd);
-		FD_SET(xfd, &rfd);
-
-		if (XPending(xw.dpy))
-			timeout = 0;  /* existing events might not set xfd */
-
-		seltv.tv_sec = timeout / 1E3;
-		seltv.tv_nsec = 1E6 * (timeout - 1E3 * seltv.tv_sec);
-		tv = timeout >= 0 ? &seltv : nil;
-
-		if (pselect(MAX(xfd, ttyfd)+1, &rfd, nil, nil, tv, nil) < 0) {
-			if (errno == EINTR)
-				continue;
-			fatal("select failed: %s\n", strerror(errno));
-		}
-		clock_gettime(CLOCK_MONOTONIC, &now);
-
-		if (FD_ISSET(ttyfd, &rfd))
-			ttyread();
-
-		xev = 0;
-		while (XPending(xw.dpy)) {
-			xev = 1;
-			XNextEvent(xw.dpy, &ev);
-			if (XFilterEvent(&ev, None))
-				continue;
-			if (handler[ev.type])
-				(handler[ev.type])(&ev);
-		}
-
-		/*
-		 * To reduce flicker and tearing, when new content or event
-		 * triggers drawing, we first wait a bit to ensure we got
-		 * everything, and if nothing new arrives - we draw.
-		 * We start with trying to wait minlatency ms. If more content
-		 * arrives sooner, we retry with shorter and shorter periods,
-		 * and eventually draw even without idle after maxlatency ms.
-		 * Typically this results in low latency while interacting,
-		 * maximum latency intervals during `cat huge.txt`, and perfect
-		 * sync with periodic updates from animations/key-repeats/etc.
-		 */
-		if (FD_ISSET(ttyfd, &rfd) || xev) {
-			if (!drawing) {
-				trigger = now;
-				drawing = 1;
-			}
-			timeout = (maxlatency - TIMEDIFF(now, trigger)) \
-			          / maxlatency * minlatency;
-			if (timeout > 0)
-				continue;  /* we have time, try to find idle */
-		}
-
-		/* idle detected or maxlatency exhausted -> draw */
-		timeout = -1;
-		if (blinktimeout && tattrset(Gblink)) {
-			timeout = blinktimeout - TIMEDIFF(now, lastblink);
-			if (timeout <= 0) {
-				if (-timeout > blinktimeout) /* start visible */
-					win.mode |= Wblink;
-				win.mode ^= Wblink;
-				tsetdirtattr(Gblink);
-				lastblink = now;
-				timeout = blinktimeout;
-			}
-		}
-
-		draw();
-		XFlush(xw.dpy);
-		drawing = 0;
-	}
-}
-
-void
-usage(void)
-{
-	fatal("usage: %s [-aiv] [-c class] [-f font] [-A alpha] [-g geometry]"
-	    " [-n name] [-o file]\n"
-	    "          [-T title] [-t title] [-w windowid]"
-	    " [[-e] command [args ...]]\n"
-	    "       %s [-aiv] [-c class] [-f font] [-g geometry]"
-	    " [-n name] [-o file]\n"
-	    "          [-T title] [-t title] [-w windowid] -l line"
-	    " [stty_args ...]\n", argv0, argv0);
-}
-
-int
-main(int argc, char *argv[])
-{
-	xw.l = xw.t = 0;
-	xw.isfixed = False;
-	xsetcursor(cursorshape);
-
-	ARGBEGIN {
-	case 'a':
-		allowaltscreen = 0;
-		break;
-	case 'A':
-        opt_alpha = EARGF(usage());
-        break;
-	case 'c':
-		opt_class = EARGF(usage());
-		break;
-	case 'e':
-		if (argc > 0)
-			--argc, ++argv;
-		goto run;
-	case 'f':
-		opt_font = EARGF(usage());
-		break;
-	case 'g':
-		xw.gm = XParseGeometry(EARGF(usage()),
-				&xw.l, &xw.t, &cols, &rows);
-		break;
-	case 'i':
-		xw.isfixed = 1;
-		break;
-	case 'o':
-		opt_io   = EARGF(usage());
-		break;
-	case 'l':
-		opt_line = EARGF(usage());
-		break;
-	case 'n':
-		opt_name = EARGF(usage());
-		break;
-	case 't':
-	case 'T':
-		opt_title = EARGF(usage());
-		break;
-	case 'w':
-		opt_embed = EARGF(usage());
-		break;
-	case 'v':
-		fatal("%s " VERSION "\n", argv0);
-		break;
-	default:
-		usage();
-	} ARGEND;
-
-run:
-	if (argc > 0) /* eat all remaining arguments */
-		opt_cmd = argv;
-
-	if (!opt_title)
-		opt_title = (opt_line || !opt_cmd) ? "term" : opt_cmd[0];
-
-	setlocale(LC_CTYPE, "");
-	XSetLocaleModifiers("");
-
-	cols = MAX(cols, 1);
-	rows = MAX(rows, 1);
-
-	tnew(cols, rows);
-	xinit(cols, rows);
-	xsetenv();
-	selinit();
-
-	run();
-
-	return 0;
-}
diff --git a/sys/cmd/walk/rules.mk b/sys/cmd/walk/rules.mk
deleted file mode 100644
index 5b9192d..0000000
--- a/sys/cmd/walk/rules.mk
+++ /dev/null
@@ -1,13 +0,0 @@
-include share/push.mk
-
-# Local sources
-SRCS_$(d) := $(d)/walk.c
-BINS_$(d) := $(d)/walk
-
-include share/paths.mk
-
-# Local rules
-$(BINS_$(d)): $(OBJS_$(d)) $(OBJ_DIR)/sys/base/base.a
-	$(COMPLINK)
-
-include share/pop.mk
diff --git a/sys/cmd/walk/walk.c b/sys/cmd/walk/walk.c
deleted file mode 100644
index c68d6e0..0000000
--- a/sys/cmd/walk/walk.c
+++ /dev/null
@@ -1,84 +0,0 @@
-#include <u.h>
-#include <base.h>
-
-static char buf[4*1024], *c = buf; /* should be greater or equal to PATH_MAX */
-
-static
-void
-flush(void)
-{
-    *c = 0;
-    puts(buf);
-    c  = buf;
-}
-
-static
-int
-print(void *data, char *rel, char *abs, io·Stat *info)
-{
-copy:
-    while (*abs && c < (arrend(buf)-2))
-        *c++ = *abs++;
-
-    if (*abs) {
-        flush();
-        goto copy;
-    }
-    *c++ = '\n';
-
-    return 0;
-}
-
-static
-void
-usage(void)
-{
-    fprintf(stderr, "usage: walk [-dlpv] file ...\n");
-    exit(1);
-}
-
-int
-main(int argc, char *argv[])
-{
-    int i, f = fs·nolinks, err, max = 0;
-    char *p;
-    static fs·Walker walker;
-
-    ARGBEGIN{
-    case 'd':
-        max = atoi(ARGF());
-        break;
-    case 'l':
-        f ^= fs·nolinks;
-        break;
-    case 'p':
-        f |= fs·preorder;
-        break;
-    case 'v':
-        f |= fs·verbose;
-        break;
-    default:
-        usage();
-    }ARGEND;
-
-    walker.flags = f;
-    walker.func  = print;
-    walker.data  = nil;
-    walker.max   = max;
-
-    if (argc == 0) {
-        fs·init(&walker, "");
-        fs·walk(&walker);
-        return(err = walker.err);
-    } else {
-        err = 0;
-        for (i=0; i<argc; i++) {
-            fs·init(&walker, argv[i]); 
-            fs·walk(&walker);
-            err += walker.err;
-        }
-    }
-    fs·fini(&walker);
-    flush();
-    exit(err);
-}
diff --git a/sys/cmd/wm/arg.c b/sys/cmd/wm/arg.c
deleted file mode 100644
index e69de29..0000000
--- a/sys/cmd/wm/arg.c
+++ /dev/null
diff --git a/sys/cmd/wm/client.c b/sys/cmd/wm/client.c
deleted file mode 100644
index 5e0927a..0000000
--- a/sys/cmd/wm/client.c
+++ /dev/null
@@ -1,274 +0,0 @@
-#include "wm.h"
-
-static char broken[] = "broken";
-
-// -----------------------------------------------------------------------
-// scripts
-
-static inline
-void
-grab_client(void)
-{
-    if(server.cursor.mode != CursorNormal)
-        return;
-    if(!(server.grab.client = client_at(server.cursor.dot->x, server.cursor.dot->y)))
-        return;
-
-    floating(server.grab.client, 1);
-}
-
-void
-move_client(Arg *arg)
-{
-    grab_client();
-    server.cursor.mode = CursorMove;
-
-    server.grab.x = server.cursor.dot->x - server.grab.client->geometry.x;
-    server.grab.y = server.cursor.dot->y - server.grab.client->geometry.y;
-    wlr_xcursor_manager_set_cursor_image(server.cursor.manager, "fleur", server.cursor.dot);
-}
-
-void
-float_client(Arg *arg)
-{
-    Client *client = selected_client();
-    wlr_log(WLR_DEBUG, "client selected = %lx", (uintptr)client);
-    if(!client)
-        return;
-
-    floating(client, client->isfloating ? 0 : 1);
-}
-
-void
-resize_client(Arg *arg)
-{
-    double x, y;
-    struct wlr_box geometry;
-
-    grab_client();
-    server.cursor.mode = CursorResize;
-
-    wlr_xdg_surface_get_geometry(server.grab.client->xdg, &geometry);
-
-    x = server.grab.client->geometry.x + geometry.x + geometry.width;
-    y = server.grab.client->geometry.y + geometry.y + geometry.height;
-
-    server.grab.x = server.cursor.dot->x - x;
-    server.grab.y = server.cursor.dot->y - y;
-
-    server.grab.box = geometry;
-    server.grab.box.x += server.grab.client->geometry.x;
-    server.grab.box.y += server.grab.client->geometry.y;
-}
-
-// -----------------------------------------------------------------------
-// core
-
-static inline
-void
-activate(struct wlr_surface *surface, int state)
-{
-}
-
-void
-focus(Client *client, int lift)
-{
-    struct wlr_xdg_surface *xdg;
-    struct wlr_surface     *old, *new;
-    struct wlr_keyboard    *keyboard;
-
-    if(!client) {
-        wlr_seat_keyboard_notify_clear_focus(server.input.seat);
-        return;
-    }
-
-    old = server.input.seat->keyboard_state.focused_surface;
-
-    if(lift) {
-        wl_list_remove(&client->stack);
-        wl_list_insert(&server.client.stack, &client->stack);
-    }
-
-    new = client->xdg->surface;
-    if(old==new)
-        return;
-
-    wl_list_remove(&client->focus);
-    wl_list_insert(&server.client.focus, &client->focus);
-    server.monitor.selected = client->monitor;
-    client->isurgent = 0;
-
-    if(old) {
-        if(wlr_surface_is_xdg_surface(old)) {
-            xdg = wlr_xdg_surface_from_wlr_surface(old);
-            wlr_xdg_toplevel_set_activated(xdg, false);
-        }
-    }
-
-    keyboard = wlr_seat_get_keyboard(server.input.seat);
-
-    wlr_seat_keyboard_notify_enter(server.input.seat, new,
-        keyboard->keycodes,
-        keyboard->num_keycodes,
-        &keyboard->modifiers
-    );
-
-    wlr_xdg_toplevel_set_activated(client->xdg, true);
-}
-
-Client*
-client_at(double x, double y)
-{
-    Client *client;
-    wl_list_for_each(client, &server.client.stack, stack)
-        if(VISIBLE_ON(client, client->monitor) && wlr_box_contains_point(&client->geometry, x, y))
-            return client;
-    return nil;
-}
-
-static
-int
-has(Client *client, double lx, double ly, struct wlr_surface **surface, double *sx, double *sy)
-{
-    double x, y, vsx = lx - client->geometry.x, vsy = ly - client->geometry.y;
-    struct wlr_surface *find = nil;
-
-    find = wlr_xdg_surface_surface_at(client->xdg, vsx, vsy, &x, &y);
-    if(find) {
-        *sx = x;
-        *sy = y;
-        *surface = find;
-        return true;
-    }
-
-    return false;
-}
-
-struct wlr_surface *
-client_surface_at(Client *client, double cx, double cy, double *sx, double *sy)
-{
-    return wlr_xdg_surface_surface_at(client->xdg, cx, cy, sx, sy);
-}
-
-
-static
-void
-constrain(Client *client, struct wlr_box *box)
-{
-    client->geometry.width  = MAX(1, client->geometry.width);
-    client->geometry.height = MAX(1, client->geometry.height);
-
-    if(client->geometry.x >= box->x + box->width)
-        client->geometry.x = box->x + box->width  - client->geometry.width;
-    if(client->geometry.y >= box->y + box->height)
-        client->geometry.y = box->y + box->height - client->geometry.height;
-    if(client->geometry.x + client->geometry.width  + 2*client->border <= box->x)
-        client->geometry.x = box->x;
-    if(client->geometry.y + client->geometry.height + 2*client->border <= box->y)
-        client->geometry.y = box->y;
-}
-
-void
-resize(Client *client, int x, int y, int w, int h, int interact)
-{
-    struct wlr_box *box = interact ? &server.monitor.geometry : &client->monitor->window;
-
-    client->geometry.x = x;
-    client->geometry.y = y;
-    client->geometry.width  = w;
-    client->geometry.height = h;
-
-    constrain(client, box);
-
-    client->resize = wlr_xdg_toplevel_set_size(client->xdg,
-            client->geometry.width  - 2*client->border,
-            client->geometry.height - 2*client->border
-    );
-}
-
-void
-attach(Client *client, Monitor *monitor, uint tags)
-{
-    Monitor *old = client->monitor;
-    if(old == monitor)
-        return;
-
-    client->monitor = monitor;
-
-    if(old) {
-        wlr_surface_send_leave(client->xdg->surface, old->output);
-        arrange(old);
-    }
-
-    if(monitor) {
-        /* make sure window actually overlaps with the monitor */
-        constrain(client, &monitor->geometry);
-        wlr_surface_send_enter(client->xdg->surface, monitor->output);
-        client->tags = tags ? tags : monitor->tag.set[monitor->tag.selected];
-        arrange(monitor);
-    }
-
-    focus(focused_client(server.monitor.selected), 1);
-}
-
-void
-rules(Client *client)
-{
-    /* rule matching */
-    Rule *rule;
-    uint i, tags;
-    char *id, *title;
-    Monitor *monitor, *it;
-
-    monitor = server.monitor.selected;
-
-    if (!(id=client->xdg->toplevel->app_id))
-        id = broken;
-    if (!(title=client->xdg->toplevel->title))
-        title = broken;
-
-    for(tags=0, rule=cfg·rule; rule != cfg·endrule; ++rule) {
-        if ((!rule->title || strstr(title, rule->title)) 
-         && (!rule->id    || strstr(id, rule->id))) {
-            client->isfloating = rule->isfloating;
-            tags |= rule->tags;
-            i = 0;
-            wl_list_for_each(it, &server.monitor.list, link)
-                if(rule->monitor == i++)
-                    monitor = it;
-        }
-    }
-
-    attach(client, monitor, tags);
-}
-
-void
-floating(Client *client, int state)
-{
-    wlr_log(WLR_DEBUG, "client %lx, floating = %d", (uintptr)client, state);
-    client->isfloating = state;
-    arrange(client->monitor);
-}
-
-Client *
-selected_client(void)
-{
-    Client *client = wl_container_of(server.client.focus.next, client, focus);
-    if(wl_list_empty(&server.client.focus) || !VISIBLE_ON(client, server.monitor.selected))
-        return nil;
-    return client;
-}
-
-void
-request_activate(struct wl_listener *l, void *data)
-{
-    struct wlr_xdg_activation_v1_request_activate_event *event = data;
-    Client *client;
-
-    if (!wlr_surface_is_xdg_surface(event->surface))
-        return;
-
-    client = wlr_xdg_surface_from_wlr_surface(event->surface)->data;
-    if(client != selected_client())
-        client->isurgent = 1;
-}
diff --git a/sys/cmd/wm/config.h b/sys/cmd/wm/config.h
deleted file mode 100644
index 1f5ba85..0000000
--- a/sys/cmd/wm/config.h
+++ /dev/null
@@ -1,70 +0,0 @@
-/* appearance */
-CONFIG(int,   sloppyfocus,    1);
-CONFIG(int,   borderpixel,    1);
-CONFIG(float, rootcolor[],   {0.3, 0.3, 0.3, 1.0});
-CONFIG(float, bordercolor[], {0.5, 0.5, 0.5, 1.0});
-CONFIG(float, focuscolor[],  {1.0, 0.0, 0.0, 1.0});
-
-/* sampling */
-CONFIG(int,   repeat_rate,   25);
-CONFIG(int,   repeat_delay,  600);
-
-/* tags */
-CONFIG(char*, tags[], { "1", "2", "3", "4", "5", "6", "7", "8", "9" });
-
-/* application specific rules */
-CONFIG(Rule, rule[], {
-    /* app_id     title       tags mask     isfloating   monitor */
-    /* examples:
-    { "Gimp",     nil,        0,            1,           -1 },
-    { "firefox",  nil,        1 << 8,       0,           -1 },
-    */
-});
-CONFIG(Rule*, endrule, arrend(cfg·rule));
-
-/* commands */
-CONFIG(char*, termcommand[], { "alacritty",  nil });
-CONFIG(char*, menucommand[], { "dmenu-wl_run",  nil });
-
-/* layouts */
-CONFIG(Layout, layouts[], {
-    /* symbol     arrange */
-    { "[]=",      tile },
-    { "><>",      nil  },    /* no layout function means floating behavior */
-});
-CONFIG(Layout*, endlayout, arrend(cfg·layouts));
-
-/* monitors
- * The order in which monitors are defined determines their position.
- * non-configured monitors are always added to the left. */
-CONFIG(MonitorRule, monitorrule[], {
-    /* name    layout,       x, y, scale,       transform             master */
-    { nil,  &cfg·layouts[0], 0, 0, 1,   WL_OUTPUT_TRANSFORM_NORMAL, {0.55, 1} },
-});
-CONFIG(MonitorRule*, endmonitorrule, arrend(cfg·monitorrule));
-
-/* keybindings */
-#define MODKEY WLR_MODIFIER_ALT
-#define MOD(a) WLR_MODIFIER_##a
-#define KEY(a) XKB_KEY_##a
-
-CONFIG(Key, binding[], {
-    /* modifier                  key               function          argument */
-    { MODKEY,                KEY(Return),           spawn,       {.v = cfg·termcommand} },
-    { MODKEY,                KEY(d),                spawn,       {.v = cfg·menucommand} },
-    { MODKEY|MOD(SHIFT),     KEY(Q),                quit,        {.v = nil} },
-});
-CONFIG(Key*, endbinding, arrend(cfg·binding));
-
-#undef MOD
-#undef KEY
-
-/* mouse buttons */
-CONFIG(Button, button[], {
-    { MODKEY, BTN_LEFT,   move_client,     {0} },
-    { MODKEY, BTN_MIDDLE, float_client,    {0} },
-    { MODKEY, BTN_RIGHT,  resize_client,   {0} },
-});
-CONFIG(Button*, endbutton, arrend(cfg·button));
-
-#undef MODKEY
diff --git a/sys/cmd/wm/input.c b/sys/cmd/wm/input.c
deleted file mode 100644
index 4c6bfd4..0000000
--- a/sys/cmd/wm/input.c
+++ /dev/null
@@ -1,316 +0,0 @@
-#include "wm.h"
-
-// -----------------------------------------------------------------------
-// keyboard
-
-static
-void
-keymodifier(struct wl_listener *l, void *data)
-{
-    Keyboard *keyboard = wl_container_of(l, keyboard, event.modify);
-
-    wlr_seat_set_keyboard(server.input.seat, keyboard->device);
-    wlr_seat_keyboard_notify_modifiers(server.input.seat, &keyboard->device->keyboard->modifiers);
-}
-
-static
-int
-keybinding(uint32 modifier, xkb_keysym_t sym)
-{
-    Key *key;
-
-    for(key=cfg·binding; key!=cfg·endbinding; ++key) {
-        if(modifier == key->modifier && sym == key->sym && key->action){
-            key->action(&key->arg);
-            return 1;
-        }
-    }
-    return 0;
-}
-
-static
-void
-keypress(struct wl_listener *l, void *data)
-{
-    int    i,h,n;
-    uint32 keycode, modifier;
-    const  xkb_keysym_t *syms;
-    struct Keyboard *keyboard = wl_container_of(l, keyboard, event.press);
-    struct wlr_event_keyboard_key *event = data;
-
-    keycode = event->keycode + 8;
-
-    h = 0;
-    n = xkb_state_key_get_syms(keyboard->device->keyboard->xkb_state, keycode, &syms);
-
-    modifier = wlr_keyboard_get_modifiers(keyboard->device->keyboard);
-    if(event->state == WL_KEYBOARD_KEY_STATE_PRESSED) {
-        for(i=0; i<n; i++)
-            h=keybinding(modifier, syms[i]);
-    }
-
-    if(!h) {
-        wlr_seat_set_keyboard(server.input.seat, keyboard->device);
-        wlr_seat_keyboard_notify_key(server.input.seat, event->time_msec, event->keycode, event->state);
-    }
-}
-
-static
-void
-free_keyboard(struct wl_listener *l, void *data)
-{
-    struct wlr_input_device *device = data;
-    Keyboard *keyboard = device->data;
-
-    /* XXX: debug
-    wl_list_remove(&keyboard->link);
-    wl_list_remove(&keyboard->event.modify.link);
-    wl_list_remove(&keyboard->event.press.link);
-    wl_list_remove(&keyboard->event.destroy.link);
-
-    free(keyboard);
-    */
-}
-
-static
-void
-make_keyboard(struct wlr_input_device *device)
-{
-    Keyboard *keyboard;
-    struct xkb_context *context;
-    struct xkb_keymap  *keymap;
-
-    keyboard = device->data = calloc(1, sizeof(*keyboard));
-    keyboard->device = device;
-
-    context = xkb_context_new(XKB_CONTEXT_NO_FLAGS);
-    keymap  = xkb_keymap_new_from_names(context, nil, XKB_KEYMAP_COMPILE_NO_FLAGS);
-
-    wlr_keyboard_set_keymap(device->keyboard, keymap);
-
-    xkb_keymap_unref(keymap);
-    xkb_context_unref(context);
-
-    wlr_keyboard_set_repeat_info(device->keyboard, cfg·repeat_rate, cfg·repeat_delay);
-
-    keyboard->event.modify.notify = keymodifier;
-    wl_signal_add(&device->keyboard->events.modifiers, &keyboard->event.modify);
-
-    keyboard->event.press.notify = keypress;
-    wl_signal_add(&device->keyboard->events.key, &keyboard->event.press);
-
-    keyboard->event.destroy.notify = free_keyboard;
-    wl_signal_add(&device->keyboard->events.destroy, &keyboard->event.destroy);
-
-    wlr_seat_set_keyboard(server.input.seat, device);
-
-    wl_list_insert(&server.input.keyboards, &keyboard->link);
-}
-
-// -----------------------------------------------------------------------
-// cursor
-
-static
-void
-focus_surface(Client *client, struct wlr_surface *surface, double sx, double sy, uint32 time)
-{
-    struct timespec now;
-    int lift = time;
-
-    if(client && !surface)
-        surface = client->xdg->surface;
-
-    if(!surface){
-        wlr_seat_pointer_notify_clear_focus(server.input.seat);
-        return;
-    }
-
-    if(!time) {
-        clock_gettime(CLOCK_MONOTONIC, &now);
-        time = now.tv_sec * 1000 + now.tv_nsec / 1000000;
-    }
-
-    if(surface == server.input.seat->pointer_state.focused_surface) {
-        wlr_seat_pointer_notify_motion(server.input.seat, time, sx, sy);
-        return;
-    }
-
-    wlr_seat_pointer_notify_enter(server.input.seat, surface, sx, sy);
-
-    if(cfg·sloppyfocus && lift)
-        focus(client, 0);
-}
-
-void
-notify_move(uint32 time)
-{
-    double sx, sy;
-    Client *client;
-    struct wlr_box box;
-    struct wlr_surface *surface;
-
-    if(time) {
-        wlr_idle_notify_activity(server.input.idle, server.input.seat);
-        if(cfg·sloppyfocus)
-            server.monitor.selected = monitor_at(server.cursor.dot->x, server.cursor.dot->y);
-    }
-
-    if(server.cursor.mode == CursorMove) {
-        resize(server.grab.client,
-            server.cursor.dot->x - server.grab.x,
-            server.cursor.dot->y - server.grab.y,
-            server.grab.client->geometry.width,
-            server.grab.client->geometry.height,
-            1
-        );
-        return;
-    }
-
-    if(server.cursor.mode == CursorResize) {
-        wlr_xdg_surface_get_geometry(server.grab.client->xdg, &box);
-        resize(server.grab.client,
-            server.grab.box.x - box.x,
-            server.grab.box.y - box.y,
-            server.cursor.dot->x - server.grab.x - server.grab.box.x,
-            server.cursor.dot->y - server.grab.y - server.grab.box.y,
-            1
-        );
-        return;
-    }
-
-    /* otherwise, find the client under the pointer and send the event along. */
-    client = client_at(server.cursor.dot->x, server.cursor.dot->y);
-    if(!client) {
-        wlr_xcursor_manager_set_cursor_image(server.cursor.manager, "left_ptr", server.cursor.dot);
-        return;
-    }
-
-    surface = client_surface_at(
-        client,
-        server.cursor.dot->x - client->geometry.x - client->border,
-        server.cursor.dot->y - client->geometry.y - client->border,
-        &sx, &sy
-    );
-
-    focus_surface(client, surface, sx, sy, time);
-}
-
-void
-cursor_move(struct wl_listener *l, void *data)
-{
-    struct wlr_event_pointer_motion *event = data;
-    wlr_cursor_move(server.cursor.dot, event->device, event->delta_x, event->delta_y);
-    notify_move(event->time_msec);
-}
-
-void
-cursor_move_abs(struct wl_listener *l, void *data)
-{
-    struct wlr_event_pointer_motion_absolute *event = data;
-    wlr_cursor_warp_absolute(server.cursor.dot, event->device, event->x, event->y);
-    notify_move(event->time_msec);
-}
-
-void
-cursor_button(struct wl_listener *l, void *data)
-{
-    Client  *client;
-    uint32 modifier;
-    Button *button;
-    struct wlr_keyboard *keyboard;
-    struct wlr_event_pointer_button *event = data;
-
-    wlr_idle_notify_activity(server.input.idle, server.input.seat);
-
-    switch(event->state) {
-    case WLR_BUTTON_PRESSED:
-        if((client=client_at(server.cursor.dot->x, server.cursor.dot->y)))
-            focus(client,1);
-
-        keyboard = wlr_seat_get_keyboard(server.input.seat);
-        modifier = wlr_keyboard_get_modifiers(keyboard);
-        for(button=cfg·button; button != cfg·endbutton; ++button) {
-            if(modifier == button->modifier && event->button == button->code && button->function) {
-                button->function(&button->arg);
-                return;
-            }
-        }
-        break;
-    case WLR_BUTTON_RELEASED:
-        if(server.cursor.mode != CursorNormal) {
-            wlr_xcursor_manager_set_cursor_image(server.cursor.manager, "left_ptr", server.cursor.dot);
-            server.cursor.mode = CursorNormal;
-            /* Drop the window off on its new monitor */
-            server.monitor.selected = monitor_at(server.cursor.dot->x, server.cursor.dot->y);
-            attach(server.grab.client, server.monitor.selected, 0);
-            return;
-        }
-    }
-
-    wlr_seat_pointer_notify_button(server.input.seat, event->time_msec, event->button, event->state);
-}
-
-void
-cursor_axis(struct wl_listener *l, void *data)
-{
-    struct wlr_event_pointer_axis *event = data;
-    /* Notify the client with pointer focus of the axis event. */
-    wlr_seat_pointer_notify_axis(server.input.seat,
-            event->time_msec, event->orientation, event->delta,
-            event->delta_discrete, event->source);
-}
-
-void
-cursor_frame(struct wl_listener *l, void *data)
-{
-    wlr_seat_pointer_notify_frame(server.input.seat);
-}
-
-void
-request_cursor(struct wl_listener *l, void *data)
-{
-    struct wlr_seat_pointer_request_set_cursor_event *event = data;
-    struct wlr_seat_client *focused = server.input.seat->pointer_state.focused_client;
-    if(focused == event->seat_client)
-        wlr_cursor_set_surface(server.cursor.dot, event->surface, event->hotspot_x, event->hotspot_y);
-}
-
-void
-request_set_selection(struct wl_listener *l, void *data)
-{
-    struct wlr_seat_request_set_selection_event *event = data;
-    wlr_seat_set_selection(server.input.seat, event->source, event->serial);
-}
-
-static
-void
-make_pointer(struct wlr_input_device *device)
-{
-    wlr_cursor_attach_input_device(server.cursor.dot, device);
-}
-
-// -----------------------------------------------------------------------
-// generic input
-
-void
-make_input(struct wl_listener *l, void *data)
-{
-    uint32 capability;
-    struct wlr_input_device *device = data;
-
-    switch(device->type) {
-    case WLR_INPUT_DEVICE_KEYBOARD:
-        make_keyboard(device);
-        break;
-    case WLR_INPUT_DEVICE_POINTER:
-        make_pointer(device);
-        /* fallthrough */
-    default:
-        break;
-    }
-
-    capability = WL_SEAT_CAPABILITY_POINTER;
-    if(!wl_list_empty(&server.input.keyboards))
-        capability |= WL_SEAT_CAPABILITY_KEYBOARD;
-    wlr_seat_set_capabilities(server.input.seat, capability);
-}
diff --git a/sys/cmd/wm/layer.c b/sys/cmd/wm/layer.c
deleted file mode 100644
index bfac744..0000000
--- a/sys/cmd/wm/layer.c
+++ /dev/null
@@ -1,107 +0,0 @@
-#include "wm.h"
-
-static
-void
-map(struct wl_listener *l, void *data)
-{
-    Layer *layer = wl_container_of(l, layer, event.map);
-    wlr_surface_send_enter(layer->surface->surface, layer->surface->output);
-    notify_move(0);
-}
-
-static
-void
-finalize(Layer *layer)
-{
-    layer->surface->mapped = 0;
-    if (layer->surface->surface == server.input.seat->keyboard_state.focused_surface)
-        focus(selected_client(), 1);
-    notify_move(0);
-}
-
-static
-void
-unmap(struct wl_listener *l, void *data)
-{
-    Layer *layer = wl_container_of(l, layer, event.unmap);
-    finalize(layer);
-}
-
-static
-void
-destroy(struct wl_listener *l, void *data)
-{
-    Monitor *monitor;
-    Layer *layer = wl_container_of(l, layer, event.destroy);
-
-    if (layer->surface->mapped)
-        finalize(layer);
-
-    wl_list_remove(&layer->link);
-    wl_list_remove(&layer->event.destroy.link);
-    wl_list_remove(&layer->event.map.link);
-    wl_list_remove(&layer->event.unmap.link);
-    wl_list_remove(&layer->event.commit.link);
-
-    if(layer->surface->output) {
-        monitor = layer->surface->output->data;
-        if(monitor)
-            stratify(monitor);
-        layer->surface->output = nil;
-    }
-    free(layer);
-}
-
-static
-void
-commit(struct wl_listener *l, void *data)
-{
-    Monitor *monitor;
-    Layer *layer = wl_container_of(l, layer, event.commit);
-    struct wlr_layer_surface_v1 *surface = layer->surface;
-    struct wlr_output *output = surface->output;
-
-    if(!output)
-        return;
-
-    monitor = output->data;
-    stratify(monitor);
-
-    if (layer->type != surface->current.layer) {
-        wl_list_remove(&layer->link);
-        wl_list_insert(&monitor->layer[surface->current.layer], &layer->link);
-        layer->type = surface->current.layer;
-    }
-}
-
-void
-make_layer_surface(struct wl_listener *l, void *data)
-{
-    Layer   *layer;
-    Monitor *monitor;
-    struct wlr_layer_surface_v1_state state;
-    struct wlr_layer_surface_v1 *surface = data;
-
-    if(!surface->output)
-        surface->output = server.monitor.selected->output;
-
-    layer = surface->data = calloc(1, sizeof(*layer));
-    layer->surface = surface;
-
-    layer->event.map.notify = map;
-    wl_signal_add(&surface->events.map, &layer->event.map);
-    layer->event.unmap.notify = unmap;
-    wl_signal_add(&surface->events.unmap, &layer->event.unmap);
-    layer->event.destroy.notify = destroy;
-    wl_signal_add(&surface->events.destroy, &layer->event.destroy);
-    layer->event.commit.notify = commit;
-    wl_signal_add(&surface->surface->events.commit, &layer->event.commit);
-
-    monitor = surface->output->data;
-    wl_list_insert(&monitor->layer[surface->client_pending.layer], &layer->link);
-
-    state = surface->current;
-    surface->current = surface->client_pending;
-    stratify(monitor);
-    surface->current = state;
-}
diff --git a/sys/cmd/wm/main.c b/sys/cmd/wm/main.c
deleted file mode 100644
index 2607801..0000000
--- a/sys/cmd/wm/main.c
+++ /dev/null
@@ -1,177 +0,0 @@
-#include "wm.h"
-
-Server server = {
-   .event = {
-       .make_input            = { .notify = make_input },
-       .make_monitor          = { .notify = make_monitor },
-       .make_xdg_surface      = { .notify = make_xdg_surface },
-       .make_layer_surface    = { .notify = make_layer_surface },
-
-       .monitor_change        = { .notify = monitor_change },
-       .monitor_test          = { .notify = monitor_test  },
-       .monitor_apply         = { .notify = monitor_apply },
-
-       .cursor_move           = { .notify = cursor_move },
-       .cursor_move_abs       = { .notify = cursor_move_abs },
-       .cursor_button         = { .notify = cursor_button },
-       .cursor_axis           = { .notify = cursor_axis },
-       .cursor_frame          = { .notify = cursor_frame },
-
-       .request_activate      = { .notify = request_activate },
-       .request_cursor        = { .notify = request_cursor },
-       .request_set_selection = { .notify = request_set_selection },
-   },
-};
-
-// -----------------------------------------------------------------------
-// helper functions
-
-static inline
-void
-init(void)
-{
-    /* compositor initialization */
-    server.display  = wl_display_create();
-    server.backend  = wlr_backend_autocreate(server.display);
-    server.renderer = wlr_backend_get_renderer(server.backend);
-    server.present  = wlr_presentation_create(server.display, server.backend);
-
-    wlr_renderer_init_wl_display(server.renderer, server.display);
-
-    wlr_compositor_create(server.display, server.renderer);
-    wlr_export_dmabuf_manager_v1_create(server.display);
-    wlr_screencopy_manager_v1_create(server.display);
-    wlr_data_control_manager_v1_create(server.display);
-    wlr_data_device_manager_create(server.display);
-    wlr_gamma_control_manager_v1_create(server.display);
-    wlr_primary_selection_v1_device_manager_create(server.display);
-    wlr_viewporter_create(server.display);
-
-    server.activate = wlr_xdg_activation_v1_create(server.display);
-    wl_signal_add(&server.activate->events.request_activate, &server.event.request_activate);
-
-    wlr_data_device_manager_create(server.display);
-
-    server.monitor.layout = wlr_output_layout_create();
-    wl_signal_add(&server.monitor.layout->events.change, &server.event.monitor_change);
-    wlr_xdg_output_manager_v1_create(server.display, server.monitor.layout);
-
-    wl_list_init(&server.monitor.list);
-    wl_signal_add(&server.backend->events.new_output, &server.event.make_monitor);
-
-    server.monitor.manager = wlr_output_manager_v1_create(server.display);
-    wl_signal_add(&server.monitor.manager->events.test,  &server.event.monitor_test);
-    wl_signal_add(&server.monitor.manager->events.apply, &server.event.monitor_apply);
-
-    /* shell initialization */
-    wl_list_init(&server.client.list);
-    wl_list_init(&server.client.stack);
-    wl_list_init(&server.client.focus);
-
-    server.shell.xdg = wlr_xdg_shell_create(server.display);
-    wl_signal_add(&server.shell.xdg->events.new_surface, &server.event.make_xdg_surface);
-
-    server.shell.layer = wlr_layer_shell_v1_create(server.display);
-    wl_signal_add(&server.shell.layer->events.new_surface, &server.event.make_layer_surface);
-
-    wlr_server_decoration_manager_set_default_mode(
-        wlr_server_decoration_manager_create(server.display),
-        WLR_SERVER_DECORATION_MANAGER_MODE_SERVER
-    );
-    wlr_xdg_decoration_manager_v1_create(server.display);
-
-    /* input initialization */
-    server.cursor.dot = wlr_cursor_create();
-    wlr_cursor_attach_output_layout(server.cursor.dot, server.monitor.layout);
-
-    server.cursor.manager = wlr_xcursor_manager_create(nil, 24);
-    wlr_xcursor_manager_load(server.cursor.manager, 1);
-
-    wl_signal_add(&server.cursor.dot->events.motion, &server.event.cursor_move);
-    wl_signal_add(&server.cursor.dot->events.motion_absolute, &server.event.cursor_move_abs);
-    wl_signal_add(&server.cursor.dot->events.button, &server.event.cursor_button);
-    wl_signal_add(&server.cursor.dot->events.axis, &server.event.cursor_axis);
-    wl_signal_add(&server.cursor.dot->events.frame, &server.event.cursor_frame);
-
-    wl_list_init(&server.input.keyboards);
-    wl_signal_add(&server.backend->events.new_input, &server.event.make_input);
-
-    server.input.idle = wlr_idle_create(server.display);
-    server.input.seat = wlr_seat_create(server.display, "seat0");
-
-    wl_signal_add(&server.input.seat->events.request_set_cursor, &server.event.request_cursor);
-    wl_signal_add(&server.input.seat->events.request_set_selection, &server.event.request_set_selection);
-}
-
-static inline
-void
-fini(void)
-{
-    wl_display_destroy_clients(server.display);
-
-    wlr_backend_destroy(server.backend);
-    wlr_xcursor_manager_destroy(server.cursor.manager);
-    wlr_output_layout_destroy(server.monitor.layout);
-    wlr_seat_destroy(server.input.seat);
-
-    wl_display_destroy(server.display);
-}
-
-// -----------------------------------------------------------------------
-// main point of entry
-
-int
-usage(void)
-{
-    fprintf(stderr, "usage: %s [-s startup command]\n", argv0);
-    return 1;
-}
-
-
-int
-main(int argc, char *argv[])
-{
-    char *socket, *cmd=nil;
-
-    ARGBEGIN{
-    case 's':
-        cmd = ARGF();
-        break;
-    default:
-        return usage();
-    } ARGEND
-
-    if(argc != 0)
-        return usage();
-
-    wlr_log_init(WLR_DEBUG, nil);
-
-    init();
-
-    if(!(socket=(char*)wl_display_add_socket_auto(server.display))) {
-        wlr_backend_destroy(server.backend);
-        return 1;
-    }
-
-    if(!(wlr_backend_start(server.backend))) {
-        wlr_backend_destroy(server.backend);
-        wl_display_destroy(server.display);
-        return 1;
-    }
-
-    setenv("WAYLAND_DISPLAY", socket, true);
-    if(cmd) {
-        if(fork()==0)
-            execl("/bin/sh", "/bin/sh", "-c", cmd, nil);
-    }
-    wlr_log(WLR_INFO, "Running Wayland compositor on WAYLAND_DISPLAY=%s", socket);
-
-    server.monitor.selected = monitor_at(server.cursor.dot->x, server.cursor.dot->y);
-    wlr_cursor_warp_closest(server.cursor.dot, nil, server.cursor.dot->x, server.cursor.dot->y);
-    wlr_xcursor_manager_set_cursor_image(server.cursor.manager, "left_ptr", server.cursor.dot);
-
-    wl_display_run(server.display); /* event loop */
-
-    fini();
-    return 0;
-}
diff --git a/sys/cmd/wm/monitor.c b/sys/cmd/wm/monitor.c
deleted file mode 100644
index 93073f3..0000000
--- a/sys/cmd/wm/monitor.c
+++ /dev/null
@@ -1,386 +0,0 @@
-#include "wm.h"
-
-/* callbacks */
-void
-monitor_change(struct wl_listener *l, void *data)
-{
-    Monitor *monitor;
-    struct wlr_output_configuration_v1 *config;
-
-    config = wlr_output_configuration_v1_create();
-    server.monitor.geometry = *wlr_output_layout_get_box(server.monitor.layout, nil);
-
-    wl_list_for_each(monitor, &server.monitor.list, link) {
-        struct wlr_output_configuration_head_v1 *head =
-               wlr_output_configuration_head_v1_create(config, monitor->output);
-
-        monitor->geometry = monitor->window = *wlr_output_layout_get_box(server.monitor.layout, monitor->output);
-
-        stratify(monitor);
-        arrange(monitor);
-
-        head->state.enabled = monitor->output->enabled;
-        head->state.mode    = monitor->output->current_mode;
-        head->state.x       = monitor->geometry.x;
-        head->state.y       = monitor->geometry.y;
-    }
-
-    wlr_output_manager_v1_set_configuration(server.monitor.manager, config);
-}
-
-static
-void
-trylayout(struct wlr_output_configuration_v1 *config, int force)
-{
-    int ok;
-    struct wlr_output_configuration_head_v1 *head;
-
-    ok = 1;
-    wl_list_for_each(head, &config->heads, link) {
-        struct wlr_output *output= head->state.output;
-            wlr_output_enable(output, head->state.enabled);
-            if (head->state.enabled) {
-                if (head->state.mode)
-                    wlr_output_set_mode(output, head->state.mode);
-                else
-                    wlr_output_set_custom_mode(
-                        output,
-                        head->state.custom_mode.width,
-                        head->state.custom_mode.height,
-                        head->state.custom_mode.refresh
-                    );
-
-                wlr_output_layout_move(server.monitor.layout, output,
-                        head->state.x, head->state.y);
-                wlr_output_set_transform(output, head->state.transform);
-            }
-
-            if(!(ok=wlr_output_test(output)))
-                break;
-    }
-
-    wl_list_for_each(head, &config->heads, link) {
-        if(ok && force)
-            wlr_output_commit(head->state.output);
-        else
-            wlr_output_rollback(head->state.output);
-    }
-
-    if(ok)
-        wlr_output_configuration_v1_send_succeeded(config);
-    else
-        wlr_output_configuration_v1_send_failed(config);
-
-    wlr_output_configuration_v1_destroy(config);
-}
-
-void
-monitor_apply(struct wl_listener *l, void *data)
-{
-    struct wlr_output_configuration_v1 *config = data;
-    trylayout(config, 1);
-}
-
-void
-monitor_test(struct wl_listener *l, void *data)
-{
-    struct wlr_output_configuration_v1 *config = data;
-    trylayout(config, 0);
-}
-
-void
-make_monitor(struct wl_listener *l, void *data)
-{
-    int i;
-    Client  *client;
-    Monitor *monitor;
-    MonitorRule *rule;
-    struct wlr_output_mode *mode;
-    struct wlr_output *output = data;
-
-    /*
-     * XXX: needed?
-    if (wl_list_empty(&output->modes))
-        return;
-     */
-
-    monitor = output->data = calloc(1, sizeof(*monitor));
-    monitor->output = output;
-
-    for(i=0; i < arrlen(monitor->layer); i++)
-        wl_list_init(&monitor->layer[i]);
-    monitor->tag.set[0] = monitor->tag.set[1] = 1;
-
-    for(rule=cfg·monitorrule; rule != cfg·endmonitorrule; ++rule) {
-        if(!rule->name || strstr(output->name, rule->name)) {
-            monitor->master.len  = rule->master.len;
-            monitor->master.frac = rule->master.frac;
-
-            wlr_output_set_scale(output, rule->scale);
-            wlr_xcursor_manager_load(server.cursor.manager, rule->scale);
-            monitor->layouts[0] = monitor->layouts[1] = monitor->layout = rule->layout;
-
-            wlr_output_set_transform(output, rule->transform);
-            break;
-        }
-    }
-
-    mode = wlr_output_preferred_mode(output);
-    wlr_output_set_mode(output, mode);
-    wlr_output_enable_adaptive_sync(output, true);
-
-    monitor->event.render.notify = render_monitor;
-    wl_signal_add(&output->events.frame, &monitor->event.render);
-    monitor->event.destroy.notify = free_monitor;
-    wl_signal_add(&output->events.destroy, &monitor->event.destroy);
-
-    wlr_output_enable(output, true);
-    if(!wlr_output_commit(output))
-        return;
-
-    wl_list_insert(&server.monitor.list, &monitor->link);
-
-    wlr_output_layout_add(server.monitor.layout, output, rule->x, rule->y);
-    server.monitor.geometry = *wlr_output_layout_get_box(server.monitor.layout, nil);
-
-    /* update the geometries of all monitors */
-    wl_list_for_each(monitor, &server.monitor.list, link) {
-        /* first monitor in the list = most recently added */
-        wl_list_for_each(client, &server.client.list, link) {
-            if(client->isfloating)
-                resize(client, client->geometry.x+monitor->window.width, client->geometry.y,
-                       client->geometry.width, client->geometry.height, 0);
-        }
-        return;
-    }
-}
-
-void
-free_monitor(struct wl_listener *l, void *data)
-{
-    int i, len;
-    Client  *client;
-    struct wlr_output *output = data;
-    Monitor *monitor = output->data;
-
-    wl_list_remove(&monitor->event.destroy.link);
-    wl_list_remove(&monitor->event.render.link);
-    wl_list_remove(&monitor->link);
-
-    wlr_output_layout_remove(server.monitor.layout, monitor->output);
-
-    for(i=0, len=wl_list_length(&server.monitor.list); i < len; i++) {
-        server.monitor.selected = wl_container_of(server.monitor.list.prev, server.monitor.selected, link);
-        if(server.monitor.selected->output->enabled)
-            break;
-    }
-
-    focus(focused_client(server.monitor.selected), 1);
-
-    /* move closed monitor's clients to newly selected one */
-    wl_list_for_each(client, &server.client.list, link) {
-        if(client->isfloating && client->geometry.x > monitor->geometry.width)
-            resize(client,
-                client->geometry.x - monitor->window.width,
-                client->geometry.y,
-                client->geometry.width,
-                client->geometry.height,
-                0
-            );
-        if(client->monitor == monitor)
-            attach(client, monitor, client->tags);
-    }
-
-    free(monitor);
-}
-
-/* methods */
-void
-arrange(Monitor *monitor)
-{
-    if(monitor->layout->arrange)
-        monitor->layout->arrange(monitor);
-}
-
-void
-stratum(Monitor *monitor, struct wl_list *list, struct wlr_box *area, int exclusive)
-{
-    Layer *layer;
-    struct wlr_box full = monitor->geometry;
-
-    wl_list_for_each(layer, list, link) {
-        struct wlr_layer_surface_v1 *surface = layer->surface;
-        struct wlr_layer_surface_v1_state *state = &surface->current;
-        struct wlr_box bounds;
-        struct wlr_box box = {
-            .width = state->desired_width,
-            .height = state->desired_height
-        };
-        const uint32 horizontal = ZWLR_LAYER_SURFACE_V1_ANCHOR_LEFT
-            | ZWLR_LAYER_SURFACE_V1_ANCHOR_RIGHT;
-        const uint32 vertical   = ZWLR_LAYER_SURFACE_V1_ANCHOR_TOP
-            | ZWLR_LAYER_SURFACE_V1_ANCHOR_BOTTOM;
-
-        if (exclusive != (state->exclusive_zone > 0))
-            continue;
-
-        bounds = state->exclusive_zone == -1 ? full : *area;
-
-        // horizontal axis
-        if((state->anchor & horizontal) && box.width == 0) {
-            box.x = bounds.x;
-            box.width = bounds.width;
-        } else if((state->anchor & ZWLR_LAYER_SURFACE_V1_ANCHOR_LEFT)) {
-            box.x = bounds.x;
-        } else if((state->anchor & ZWLR_LAYER_SURFACE_V1_ANCHOR_RIGHT)) {
-            box.x = bounds.x + (bounds.width - box.width);
-        } else {
-            box.x = bounds.x + ((bounds.width / 2) - (box.width / 2));
-        }
-
-        // vertical axis
-        if((state->anchor & vertical) && box.height == 0) {
-            box.y = bounds.y;
-            box.height = bounds.height;
-        } else if((state->anchor & ZWLR_LAYER_SURFACE_V1_ANCHOR_TOP)) {
-            box.y = bounds.y;
-        } else if((state->anchor & ZWLR_LAYER_SURFACE_V1_ANCHOR_BOTTOM)) {
-            box.y = bounds.y + (bounds.height - box.height);
-        } else {
-            box.y = bounds.y + ((bounds.height / 2) - (box.height / 2));
-        }
-
-        // margin
-        if((state->anchor & horizontal) == horizontal) {
-            box.x += state->margin.left;
-            box.width -= state->margin.left + state->margin.right;
-        } else if((state->anchor & ZWLR_LAYER_SURFACE_V1_ANCHOR_LEFT)) {
-            box.x += state->margin.left;
-        } else if((state->anchor & ZWLR_LAYER_SURFACE_V1_ANCHOR_RIGHT)) {
-            box.x -= state->margin.right;
-        }
-
-        if((state->anchor & vertical) == vertical) {
-            box.y += state->margin.top;
-            box.height -= state->margin.top + state->margin.bottom;
-        } else if((state->anchor & ZWLR_LAYER_SURFACE_V1_ANCHOR_TOP)) {
-            box.y += state->margin.top;
-        } else if((state->anchor & ZWLR_LAYER_SURFACE_V1_ANCHOR_BOTTOM)) {
-            box.y -= state->margin.bottom;
-        }
-        if(box.width < 0 || box.height < 0) {
-            wlr_layer_surface_v1_close(surface);
-            continue;
-        }
-        layer->geometry = box;
-
-        if (state->exclusive_zone > 0)
-            exclude(area,
-                    state->anchor, state->exclusive_zone,
-                    state->margin.top, state->margin.right,
-                    state->margin.bottom, state->margin.left);
-        wlr_layer_surface_v1_configure(surface, box.width, box.height);
-    }
-}
-
-void
-stratify(Monitor *monitor)
-{
-    int i;
-    Layer *layer;
-    struct wlr_box area = monitor->geometry;
-    uint32_t overlays[] = {
-        ZWLR_LAYER_SHELL_V1_LAYER_OVERLAY,
-        ZWLR_LAYER_SHELL_V1_LAYER_TOP,
-    };
-    struct wlr_keyboard *keyboard = wlr_seat_get_keyboard(server.input.seat);
-
-    // arrange exclusive surfaces from top->bottom
-    stratum(monitor, &monitor->layer[ZWLR_LAYER_SHELL_V1_LAYER_OVERLAY], &area, 1);
-    stratum(monitor, &monitor->layer[ZWLR_LAYER_SHELL_V1_LAYER_TOP], &area, 1);
-    stratum(monitor, &monitor->layer[ZWLR_LAYER_SHELL_V1_LAYER_BOTTOM], &area, 1);
-    stratum(monitor, &monitor->layer[ZWLR_LAYER_SHELL_V1_LAYER_BACKGROUND], &area, 1);
-
-    if(memcmp(&area, &monitor->window, sizeof(area))) {
-        monitor->window = area;
-        arrange(monitor);
-    }
-
-    // arrange non-exlusive surfaces from top->bottom
-    stratum(monitor, &monitor->layer[ZWLR_LAYER_SHELL_V1_LAYER_OVERLAY], &area, 0);
-    stratum(monitor, &monitor->layer[ZWLR_LAYER_SHELL_V1_LAYER_TOP], &area, 0);
-    stratum(monitor, &monitor->layer[ZWLR_LAYER_SHELL_V1_LAYER_BOTTOM], &area, 0);
-    stratum(monitor, &monitor->layer[ZWLR_LAYER_SHELL_V1_LAYER_BACKGROUND], &area, 0);
-
-    // find topmost keyboard interactive layer, if such a layer exists
-    for(i = 0; i < arrlen(overlays); i++) {
-        wl_list_for_each_reverse(layer, &monitor->layer[overlays[i]], link) {
-            if (layer->surface->current.keyboard_interactive && layer->surface->mapped) {
-                // Deactivate the focused client.
-                focus(nil, 0);
-                wlr_seat_keyboard_notify_enter(
-                        server.input.seat,
-                        layer->surface->surface,
-                        keyboard->keycodes,
-                        keyboard->num_keycodes,
-                        &keyboard->modifiers
-                );
-                return;
-            }
-        }
-    }
-}
-
-Client *
-focused_client(Monitor *monitor)
-{
-    Client *client;
-    wl_list_for_each(client, &server.client.focus, focus) {
-        if(VISIBLE_ON(client, monitor))
-            return client;
-    }
-
-    return nil;
-}
-
-void
-tile(Monitor *monitor)
-{
-    Client *client;
-    uint i, n, h, mw, my, ty;
-
-    n = 0;
-    wl_list_for_each(client, &server.client.list, link) {
-        if(VISIBLE_ON(client, monitor) && !client->isfloating)
-            n++;
-    }
-    if(!n) return;
-
-    if(n > monitor->master.len)
-        mw = monitor->master.len ? monitor->window.width * monitor->master.frac : 0;
-    else
-        mw = monitor->window.width;
-
-    i = my = ty = 0;
-    wl_list_for_each(client, &server.client.list, link) {
-        if(!VISIBLE_ON(client,monitor) || client->isfloating || client->isfullscreen)
-            continue;
-        if(i < monitor->master.len) {
-            h = (monitor->window.height - my) / (MIN(n, monitor->master.len) - i);
-            resize(client, monitor->window.x, monitor->window.y + my, mw, h, 0);
-            my += client->geometry.height;
-        } else {
-            h = (monitor->window.height - ty) / (n - i);
-            resize(client, monitor->window.x + mw, monitor->window.y + ty, monitor->window.width - mw, h, 0);
-            ty += client->geometry.height;
-        }
-        i++;
-    }
-}
-
-Monitor *
-monitor_at(double x, double y)
-{
-    struct wlr_output *output = wlr_output_layout_output_at(server.monitor.layout, x, y);
-    return output ? output->data : nil;
-}
diff --git a/sys/cmd/wm/protocol/sync b/sys/cmd/wm/protocol/sync
deleted file mode 100755
index 19a728a..0000000
--- a/sys/cmd/wm/protocol/sync
+++ /dev/null
@@ -1,6 +0,0 @@
-#!/bin/sh
-
-for base in wlr-layer-shell-unstable-v1.xml
-do
-    curl https://raw.githubusercontent.com/swaywm/wlroots/master/protocol/$base --output $base
-done
diff --git a/sys/cmd/wm/render.c b/sys/cmd/wm/render.c
deleted file mode 100644
index 1f51804..0000000
--- a/sys/cmd/wm/render.c
+++ /dev/null
@@ -1,160 +0,0 @@
-#include "wm.h"
-
-struct Payload
-{
-    Client            *client;
-    struct wlr_output *output;
-    struct timespec   *when;
-    int x, y;
-};
-
-static
-void
-render(struct wlr_surface *surface, int sx, int sy, void *data)
-{
-    float matrix[9];
-    double x, y;
-    struct Payload *payload;
-
-    struct wlr_box box;
-    struct wlr_output *output;
-    struct wlr_texture *texture;
-
-    enum wl_output_transform transform;
-
-    payload = data;
-    output  = payload->output;
-
-    texture = wlr_surface_get_texture(surface);
-    if(!texture)
-        return;
-
-    x = 0, y = 0;
-    wlr_output_layout_output_coords(server.monitor.layout, output, &x, &y);
-
-    box = (struct wlr_box) {
-        .x = x + payload->x + sx,
-        .y = y + payload->y + sy,
-        .width  = surface->current.width,
-        .height = surface->current.height,
-    };
-    scale_box(&box, output->scale);
-
-    transform = wlr_output_transform_invert(surface->current.transform);
-    wlr_matrix_project_box(matrix, &box, transform, 0, output->transform_matrix);
-
-    wlr_render_texture_with_matrix(server.renderer, texture, matrix, 1);
-    wlr_surface_send_frame_done(surface, payload->when);
-    wlr_presentation_surface_sampled_on_output(server.present, surface, output);
-}
-
-static
-void
-render_layer(struct wl_list *list, struct timespec *now)
-{
-    Layer *layer;
-    wl_list_for_each(layer, list, link) {
-        struct Payload payload= {
-            .output = layer->surface->output,
-            .x = layer->geometry.x,
-            .y = layer->geometry.y,
-            .when = now,
-        };
-
-        wlr_surface_for_each_surface(layer->surface->surface, render, &payload);
-    }
-}
-
-static
-void
-render_clients(Monitor *monitor, struct timespec *now)
-{
-    double   x, y;
-    int      i, w, h, bw;
-    float    *color;
-
-    Client  *client;
-    struct wlr_output  *output;
-    struct wlr_box     *borders;
-    struct wlr_surface *surface;
-
-    output = monitor->output;
-    wl_list_for_each_reverse(client, &server.client.stack, stack) {
-        if(!VISIBLE_ON(client, client->monitor))
-            continue;
-        if(!wlr_output_layout_intersects(server.monitor.layout, monitor->output, &client->geometry))
-            continue;
-
-        surface = client->xdg->surface;
-
-        x = client->geometry.x, y = client->geometry.y;
-        wlr_output_layout_output_coords(server.monitor.layout, output, &x, &y);
-
-        if((bw=client->border)) {
-            w = surface->current.width;
-            h = surface->current.height;
-            borders = (struct wlr_box[4]) {
-                {x,      y,      w+2*bw, bw}, /* top */
-                {x,      y+bw,   bw,     h},  /* left */
-                {x+bw+w, y+bw,   bw,     h},  /* right */
-                {x,      y+bw+h, w+2*bw, bw}, /* bottom */
-            };
-
-            color = (client == server.selected) ? cfg·focuscolor : cfg·bordercolor;
-            for(i=0; i<4; i++) {
-                scale_box(&borders[i], output->scale);
-                wlr_render_rect(server.renderer, &borders[i], color, output->transform_matrix);
-            }
-        }
-
-        struct Payload payload = {
-            .output   = output,
-            .when     = now,
-
-            .x = client->geometry.x + client->border,
-            .y = client->geometry.y + client->border,
-        };
-
-        wlr_xdg_surface_for_each_surface(client->xdg, render, &payload);
-    }
-}
-
-void
-render_monitor(struct wl_listener *l, void *data)
-{
-    int w, h;
-    Client  *client;
-    Monitor *monitor;
-    struct timespec now;
-
-    clock_gettime(CLOCK_MONOTONIC, &now);
-    monitor = wl_container_of(l, monitor, event.render);
-
-    wl_list_for_each(client, &server.client.list, link) {
-        if(client->resize) {
-            wlr_surface_send_frame_done(client->xdg->surface, &now);
-        }
-    }
-
-    if(!wlr_output_attach_render(monitor->output, nil))
-        return;
-
-    wlr_output_effective_resolution(monitor->output, &w, &h);
-
-    /* start of rendering kernel */
-    wlr_renderer_begin(server.renderer, w, h);
-    wlr_renderer_clear(server.renderer, cfg·rootcolor);
-
-    render_layer(&monitor->layer[ZWLR_LAYER_SHELL_V1_LAYER_BACKGROUND], &now);
-    render_layer(&monitor->layer[ZWLR_LAYER_SHELL_V1_LAYER_BOTTOM], &now);
-
-    render_clients(monitor, &now);
-
-    render_layer(&monitor->layer[ZWLR_LAYER_SHELL_V1_LAYER_TOP], &now);
-    render_layer(&monitor->layer[ZWLR_LAYER_SHELL_V1_LAYER_OVERLAY], &now);
-
-    wlr_output_render_software_cursors(monitor->output, nil);
-
-    wlr_renderer_end(server.renderer);
-    wlr_output_commit(monitor->output);
-}
diff --git a/sys/cmd/wm/rules.mk b/sys/cmd/wm/rules.mk
deleted file mode 100644
index 5a36b6f..0000000
--- a/sys/cmd/wm/rules.mk
+++ /dev/null
@@ -1,61 +0,0 @@
-include share/push.mk
-# Iterate through subdirectory tree
-
-# Local sources
-SRCS_$(d) := \
-	$(d)/xdg-shell-protocol.c \
-	$(d)/wlr-layer-shell-unstable-v1-protocol.c \
-	$(d)/util.c \
-	$(d)/input.c \
-	$(d)/render.c \
-	$(d)/layer.c \
-	$(d)/xdg.c \
-	$(d)/client.c \
-	$(d)/monitor.c \
-	$(d)/main.c
-BINS_$(d) := $(d)/wm
-
-include share/paths.mk
-
-# Local rules
-include share/dynamic.mk
-
-$(d)/xdg-shell-protocol.h:
-	@echo "MK	$(notdir $@)";\
-	$(WL_SCAN) server-header $(WL_PROTO)/stable/xdg-shell/xdg-shell.xml $@
-
-$(d)/xdg-shell-protocol.c: $(d)/xdg-shell-protocol.h
-	@echo "MK	$(notdir $@)";\
-	$(WL_SCAN) private-code $(WL_PROTO)/stable/xdg-shell/xdg-shell.xml $@
-
-$(d)/wlr-layer-shell-unstable-v1-protocol.h:
-	@echo "MK	$(notdir $@)";\
-	$(WL_SCAN) server-header $(dir $@)protocol/wlr-layer-shell-unstable-v1.xml $@
-
-$(d)/wlr-layer-shell-unstable-v1-protocol.c: $(d)/wlr-layer-shell-unstable-v1-protocol.h
-	@echo "MK	$(notdir $@)";\
-	$(WL_SCAN) private-code $(dir $@)protocol/wlr-layer-shell-unstable-v1.xml $@
-
-GENS += \
-$(d)/xdg-shell-protocol.h \
-$(d)/xdg-shell-protocol.c \
-$(d)/wlr-layer-shell-unstable-v1-protocol.h \
-$(d)/wlr-layer-shell-unstable-v1-protocol.c
-
-$(BINS_$(d)): TCINCS = \
-	-I sys/cmd/wm
-
-$(BINS_$(d)): TCFLAGS = \
-	`$(PKG) --cflags wlroots` \
-	`$(PKG) --cflags wayland-server` \
-	`$(PKG) --cflags xkbcommon`
-
-$(BINS_$(d)): TCLIBS = \
-	`$(PKG) --libs wlroots` \
-	`$(PKG) --libs wayland-server` \
-	`$(PKG) --libs xkbcommon` \
-
-$(BINS_$(d)): $(OBJS_$(d)) $(OBJ_DIR)/sys/base/base.a
-	$(COMPLINK)
-
-include share/pop.mk
diff --git a/sys/cmd/wm/util.c b/sys/cmd/wm/util.c
deleted file mode 100644
index 7871d15..0000000
--- a/sys/cmd/wm/util.c
+++ /dev/null
@@ -1,99 +0,0 @@
-#include "wm.h"
-
-typedef struct {
-    uint32 singular_anchor;
-    uint32 anchor_triplet;
-    int *positive_axis;
-    int *negative_axis;
-    int margin;
-} Edge;
-
-// -----------------------------------------------------------------------
-// general purpose function on rectangles
-
-void
-scale_box(struct wlr_box *box, float scale)
-{
-    box->width =  ROUND((box->x + box->width) * scale) -  ROUND(box->x * scale);
-    box->height = ROUND((box->y + box->height) * scale) - ROUND(box->y * scale);
-    box->x = ROUND(box->x * scale);
-    box->y = ROUND(box->y * scale);
-}
-
-void
-exclude(struct wlr_box *usable_area, uint32 anchor, int32 exclusive,
-        int32 margin_top, int32 margin_right, int32 margin_bottom, int32 margin_left) 
-{
-    Edge edges[] = {
-        { // Top
-            .singular_anchor = ZWLR_LAYER_SURFACE_V1_ANCHOR_TOP,
-            .anchor_triplet = ZWLR_LAYER_SURFACE_V1_ANCHOR_LEFT |
-                ZWLR_LAYER_SURFACE_V1_ANCHOR_RIGHT |
-                ZWLR_LAYER_SURFACE_V1_ANCHOR_TOP,
-            .positive_axis = &usable_area->y,
-            .negative_axis = &usable_area->height,
-            .margin = margin_top,
-        },
-        { // Bottom
-            .singular_anchor = ZWLR_LAYER_SURFACE_V1_ANCHOR_BOTTOM,
-            .anchor_triplet = ZWLR_LAYER_SURFACE_V1_ANCHOR_LEFT |
-                ZWLR_LAYER_SURFACE_V1_ANCHOR_RIGHT |
-                ZWLR_LAYER_SURFACE_V1_ANCHOR_BOTTOM,
-            .positive_axis = NULL,
-            .negative_axis = &usable_area->height,
-            .margin = margin_bottom,
-        },
-        { // Left
-            .singular_anchor = ZWLR_LAYER_SURFACE_V1_ANCHOR_LEFT,
-            .anchor_triplet = ZWLR_LAYER_SURFACE_V1_ANCHOR_LEFT |
-                ZWLR_LAYER_SURFACE_V1_ANCHOR_TOP |
-                ZWLR_LAYER_SURFACE_V1_ANCHOR_BOTTOM,
-            .positive_axis = &usable_area->x,
-            .negative_axis = &usable_area->width,
-            .margin = margin_left,
-        },
-        { // Right
-            .singular_anchor = ZWLR_LAYER_SURFACE_V1_ANCHOR_RIGHT,
-            .anchor_triplet = ZWLR_LAYER_SURFACE_V1_ANCHOR_RIGHT |
-                ZWLR_LAYER_SURFACE_V1_ANCHOR_TOP |
-                ZWLR_LAYER_SURFACE_V1_ANCHOR_BOTTOM,
-            .positive_axis = NULL,
-            .negative_axis = &usable_area->width,
-            .margin = margin_right,
-        }
-    };
-    for(size_t i = 0; i < arrlen(edges); i++) {
-        if((anchor == edges[i].singular_anchor || anchor == edges[i].anchor_triplet)
-                && exclusive + edges[i].margin > 0) {
-            if(edges[i].positive_axis)
-                *edges[i].positive_axis += exclusive + edges[i].margin;
-            if(edges[i].negative_axis)
-                *edges[i].negative_axis -= exclusive + edges[i].margin;
-            break;
-        }
-    }
-}
-
-// -----------------------------------------------------------------------
-// user facing functions
-
-void
-spawn(Arg *arg)
-{
-    wlr_log(WLR_DEBUG, "spawning %s", ((char **)arg->v)[0]);
-    if(!fork()) {
-        dup2(2, 1);
-        setsid();
-        execvp(((char **)arg->v)[0], (char **)arg->v);
-    }
-}
-
-void
-quit(Arg *arg)
-{
-    wl_display_terminate(server.display);
-}
-
-#define CONFIG(a,b,...) a cfg·##b = __VA_ARGS__
-#include "config.h"
-#undef CONFIG
diff --git a/sys/cmd/wm/wm.h b/sys/cmd/wm/wm.h
deleted file mode 100644
index a263804..0000000
--- a/sys/cmd/wm/wm.h
+++ /dev/null
@@ -1,350 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <base.h>
-#include <wayland-server-core.h>
-#include <linux/input-event-codes.h>
-
-#define WLR_USE_UNSTABLE
-#include <wlr/backend.h>
-#include <wlr/render/wlr_renderer.h>
-
-#include <wlr/types/wlr_cursor.h>
-#include <wlr/types/wlr_compositor.h>
-#include <wlr/types/wlr_data_control_v1.h>
-#include <wlr/types/wlr_data_device.h>
-#include <wlr/types/wlr_export_dmabuf_v1.h>
-#include <wlr/types/wlr_gamma_control_v1.h>
-#include <wlr/types/wlr_input_device.h>
-#include <wlr/types/wlr_idle.h>
-#include <wlr/types/wlr_layer_shell_v1.h>
-#include <wlr/types/wlr_keyboard.h>
-#include <wlr/types/wlr_matrix.h>
-#include <wlr/types/wlr_output.h>
-#include <wlr/types/wlr_output_layout.h>
-#include <wlr/types/wlr_output_damage.h>
-#include <wlr/types/wlr_output_management_v1.h>
-#include <wlr/types/wlr_primary_selection.h>
-#include <wlr/types/wlr_primary_selection_v1.h>
-#include <wlr/types/wlr_pointer.h>
-#include <wlr/types/wlr_presentation_time.h>
-#include <wlr/types/wlr_screencopy_v1.h>
-#include <wlr/types/wlr_server_decoration.h>
-#include <wlr/types/wlr_seat.h>
-#include <wlr/types/wlr_viewporter.h>
-#include <wlr/types/wlr_xcursor_manager.h>
-#include <wlr/types/wlr_xdg_activation_v1.h>
-#include <wlr/types/wlr_xdg_decoration_v1.h>
-#include <wlr/types/wlr_xdg_output_v1.h>
-#include <wlr/types/wlr_xdg_shell.h>
-
-#include <wlr/util/log.h>
-
-#include <xkbcommon/xkbcommon.h>
-
-// -----------------------------------------------------------------------
-// macros
-
-#define ROUND(x)            ((int)((x)+0.5))
-#define VISIBLE_ON(C,M)     ((C)->monitor == (M) && ((C)->tags & (M)->tag.set[(M)->tag.selected]))
-
-// -----------------------------------------------------------------------
-// types
-
-enum
-{
-    CursorNormal,
-    CursorMove,
-    CursorResize,
-};
-
-typedef union  Arg      Arg;
-typedef struct Button   Button;
-typedef struct Key      Key;
-typedef struct Keyboard Keyboard;
-typedef struct Layer    Layer;
-typedef struct Client   Client;
-typedef struct Layout   Layout;
-typedef struct Monitor  Monitor;
-typedef struct Server   Server;
-
-typedef struct Rule        Rule;
-typedef struct MonitorRule MonitorRule;
-
-struct Rectangle
-{
-    int x, y;
-    int w, h;
-};
-
-union Arg
-{
-    int   i;
-    uint  ui;
-    float f;
-    void *v;
-};
-
-struct Key
-{
-    uint           modifier;
-    xkb_keysym_t   sym;
-    void (*action)(Arg *);
-    Arg            arg;
-};
-
-struct Button
-{
-    uint modifier;
-    uint code;
-    void (*function)(Arg *);
-    Arg arg;
-};
-
-struct Keyboard
-{
-    struct wl_list link;
-    struct wlr_input_device *device;
-    struct {
-        struct wl_listener press;
-        struct wl_listener modify;
-        struct wl_listener destroy;
-    } event;
-};
-
-struct Layer
-{
-    struct wl_list link;
-    struct wlr_layer_surface_v1 *surface;
-    enum zwlr_layer_shell_v1_layer type;
-
-    struct wlr_box geometry;
-
-    struct {
-        struct wl_listener map;
-        struct wl_listener unmap;
-        struct wl_listener commit;
-        struct wl_listener destroy;
-    } event;
-};
-
-struct Client
-{
-    struct wl_list link;
-    struct wl_list stack;
-    struct wl_list focus;
-
-    struct wlr_xdg_surface *xdg;
-
-    struct {
-        struct wl_listener map;
-        struct wl_listener unmap;
-        struct wl_listener commit;
-        struct wl_listener destroy;
-        struct wl_listener request_move;
-        struct wl_listener request_title;
-        struct wl_listener request_resize;
-        struct wl_listener request_fullscreen;
-    } event;
-
-    struct wlr_box geometry, oldgeometry;
-
-    Monitor *monitor;
-
-    uint tags;
-    int  border       : 4;
-    int  ismapped     : 1;
-    int  isfloating   : 1;
-    int  isurgent     : 1;
-    int  isfullscreen : 1;
-
-    uint32 resize;
-};
-
-struct Layout
-{
-    char  *symbol;
-    void (*arrange)(Monitor *);
-};
-
-struct Monitor
-{
-    struct wl_list link;
-    struct wlr_output *output;
-    struct {
-        struct wl_listener render;
-        struct wl_listener destroy;
-    } event;
-
-    struct wlr_box geometry;
-    struct wlr_box window;
-    struct wl_list layer[4];
-
-    Layout *layout, *layouts[2];
-    struct {
-        uint set[2];
-        uint selected;
-    } tag;
-    struct {
-        double frac;
-        int    len;
-    } master;
-};
-
-struct MonitorRule
-{
-    char   *name;
-    Layout *layout;
-    int     x, y;
-    float   scale;
-    enum wl_output_transform transform;
-    struct {
-        double frac;
-        int    len;
-    } master;
-};
-
-struct Rule
-{
-    char *id;
-    char *title;
-    uint tags;
-    int  isfloating;
-    int  monitor;
-};
-
-struct Server
-{
-    struct wl_display            *display;
-    struct wlr_backend           *backend;
-    struct wlr_renderer          *renderer;
-    struct wlr_presentation      *present;
-    struct wlr_xdg_activation_v1 *activate;
-
-    struct {
-        struct wlr_xdg_shell      *xdg;
-        struct wlr_layer_shell_v1 *layer;
-    } shell;
-
-    struct {
-        struct wl_list list;
-        struct wl_list stack;
-        struct wl_list focus;
-    } client;
-    Client *selected;
-
-    struct {
-        Client *client;
-        double x, y;
-        struct wlr_box box;
-    } grab;
-    uint32 resize;
-
-    struct {
-        struct wlr_output_layout     *layout;
-        struct wl_list                list;
-        struct wlr_box                geometry;
-        struct wlr_output_manager_v1 *manager;
-        Monitor                      *selected;
-    } monitor;
-
-    struct {
-        struct wlr_cursor          *dot;
-        struct wlr_xcursor_manager *manager;
-        int                         mode;
-    } cursor;
-
-    struct {
-        struct wlr_seat *seat;
-        struct wl_list   keyboards;
-        struct wlr_idle *idle;
-    } input;
-
-    struct {
-        struct wl_listener make_input;
-        struct wl_listener make_monitor;
-        struct wl_listener make_xdg_surface;
-        struct wl_listener make_layer_surface;
-
-        struct wl_listener monitor_test;
-        struct wl_listener monitor_apply;
-        struct wl_listener monitor_change;
-
-        struct wl_listener cursor_move;
-        struct wl_listener cursor_move_abs;
-        struct wl_listener cursor_button;
-        struct wl_listener cursor_axis;
-        struct wl_listener cursor_frame;
-
-        struct wl_listener request_cursor;
-        struct wl_listener request_activate;
-        struct wl_listener request_set_selection;
-    } event;
-};
-
-extern struct Server server;
-
-// -----------------------------------------------------------------------
-// functions
-
-/* util.c */
-void    scale_box(struct wlr_box *, float);
-void    exclude(struct wlr_box *, uint32, int32, int32, int32, int32, int32 );
-
-/* render.c */
-void    render_monitor(struct wl_listener *, void *);
-
-/* xdg.c */
-void    make_xdg_surface(struct wl_listener *, void *);
-
-/* layer.c */
-void    make_layer_surface(struct wl_listener *, void *);
-
-/* input.c */
-void    make_input(struct wl_listener *, void *);
-void    notify_move(uint32 time);
-
-void    cursor_axis(struct wl_listener *, void *);
-void    cursor_frame(struct wl_listener *, void *);
-void    cursor_button(struct wl_listener *, void *);
-void    cursor_move(struct wl_listener *, void *);
-void    cursor_move_abs(struct wl_listener *, void *);
-
-void    request_cursor(struct wl_listener *, void *);
-void    request_set_selection(struct wl_listener *, void *);
-
-/* client.c */
-void    rules(Client *);
-void    focus(Client *, int lift);
-void    resize(Client *, int x, int y, int w, int h, int interact);
-void    attach(Client *, Monitor *, uint tags);
-void    floating(Client *, int);
-
-void    move_client(Arg *arg);
-void    float_client(Arg *arg);
-void    resize_client(Arg *arg);
-
-void    request_activate(struct wl_listener *, void *);
-
-Client             *selected_client(void);
-Client             *client_at(double x, double y);
-struct wlr_surface *client_surface_at(Client *, double cx, double cy, double *sx, double *sy);
-struct wlr_surface *top_surface(Client *);
-
-/* monitor.c */
-void     tile(Monitor *);
-void     arrange(Monitor *);
-void     stratify(Monitor *);
-Client  *focused_client(Monitor *);
-Monitor *monitor_at(double x, double y);
-
-void     monitor_test(struct wl_listener *, void *);
-void     monitor_apply(struct wl_listener *, void *);
-void     monitor_change(struct wl_listener *, void *);
-
-void     free_monitor(struct wl_listener *, void *);
-void     make_monitor(struct wl_listener *, void *);
-
-#define CONFIG(a,b,...) extern a cfg·##b
-#include "config.h"
-#undef CONFIG
diff --git a/sys/cmd/wm/xdg.c b/sys/cmd/wm/xdg.c
deleted file mode 100644
index 6a0c2c8..0000000
--- a/sys/cmd/wm/xdg.c
+++ /dev/null
@@ -1,118 +0,0 @@
-#include "wm.h"
-
-static
-void
-map(struct wl_listener *l, void *data)
-{
-    Client *client = wl_container_of(l, client, event.map);
-
-    wl_list_insert(&server.client.list,  &client->link);
-    wl_list_insert(&server.client.stack, &client->stack);
-    wl_list_insert(&server.client.focus, &client->focus);
-
-    wlr_xdg_surface_get_geometry(client->xdg, &client->geometry);
-    client->geometry.width  += 2 * client->border;
-    client->geometry.height += 2 * client->border;
-
-    wlr_xdg_toplevel_set_tiled(client->xdg,
-            WLR_EDGE_TOP|WLR_EDGE_BOTTOM|WLR_EDGE_LEFT|WLR_EDGE_RIGHT
-    );
-
-    rules(client);
-}
-
-static
-void
-unmap(struct wl_listener *l, void *data)
-{
-    Client *client = wl_container_of(l, client, event.unmap);
-
-    wl_list_remove(&client->link);
-    attach(client, nil, 0);
-
-    wl_list_remove(&client->stack);
-    wl_list_remove(&client->focus);
-}
-
-static
-void
-commit(struct wl_listener *l, void *data)
-{
-    Client *client = wl_container_of(l, client, event.commit);
-    if(client->resize && client->resize <= client->xdg->configure_serial)
-        client->resize = 0;
-}
-
-static
-void
-destroy(struct wl_listener *l, void *data)
-{
-    Client *client = wl_container_of(l, client, event.destroy);
-    free(client);
-}
-
-static
-void
-request_move(struct wl_listener *l, void *data)
-{
-    Client *client = wl_container_of(l, client, event.request_move);
-}
-
-static
-void
-request_resize(struct wl_listener *l, void *data)
-{
-    struct wlr_xdg_toplevel_resize_event *event = data;
-    Client *client = wl_container_of(l, client, event.request_resize);
-}
-
-
-static
-void
-request_title(struct wl_listener *l, void *data)
-{
-    Client *client = wl_container_of(l, client, event.request_title);
-}
-
-static
-void
-request_fullscreen(struct wl_listener *l, void *data)
-{
-    Client *client = wl_container_of(l, client, event.request_fullscreen);
-    client->isfullscreen = 1;
-}
-
-void
-make_xdg_surface(struct wl_listener *l, void *data)
-{
-    Client *client;
-    struct wlr_xdg_toplevel *toplevel;
-    struct wlr_xdg_surface  *xdg = data;
-
-    if(xdg->role != WLR_XDG_SURFACE_ROLE_TOPLEVEL)
-        return;
-
-    client = xdg->surface->data = calloc(1, sizeof(*client));
-    client->xdg = xdg;
-    client->border = cfg·borderpixel;
-
-    client->event.map.notify = map;
-    wl_signal_add(&xdg->events.map, &client->event.map);
-    client->event.unmap.notify = unmap;
-    wl_signal_add(&xdg->events.unmap, &client->event.unmap);
-    client->event.destroy.notify = destroy;
-    wl_signal_add(&xdg->events.destroy, &client->event.destroy);
-
-    client->event.commit.notify = commit;
-    wl_signal_add(&xdg->surface->events.commit, &client->event.commit);
-
-    toplevel = xdg->toplevel;
-    client->event.request_move.notify = request_move;
-    wl_signal_add(&toplevel->events.request_move, &client->event.request_move);
-    client->event.request_title.notify = request_title;
-    wl_signal_add(&toplevel->events.set_title, &client->event.request_title);
-    client->event.request_resize.notify = request_resize;
-    wl_signal_add(&toplevel->events.request_resize, &client->event.request_resize);
-    client->event.request_fullscreen.notify = request_fullscreen;
-    wl_signal_add(&toplevel->events.request_fullscreen, &client->event.request_fullscreen);
-}
diff --git a/sys/libbio/align.c b/sys/libbio/align.c
deleted file mode 100644
index 20a57df..0000000
--- a/sys/libbio/align.c
+++ /dev/null
@@ -1,178 +0,0 @@
-#include <u.h>
-#include <libn.h>
-#include <libn/macro/qsort.h>
-#include <libbio.h>
-
-// -----------------------------------------------------------------------
-// globals
-
-uint64 aln·shft = (2ULL * (aln·K - 1ULL));
-uint64 aln·mask = (1ULL << (2*aln·K)) - 1ULL;
-
-// -----------------------------------------------------------------------
-// static data
-
-static uint64 nuctab[256] = {
-	4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 4, 4, 4, 3, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 4, 4, 4, 3, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
-	4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
-};
-
-// -----------------------------------------------------------------------
-// hash functions
-
-enum
-{
-	MURM641 = 0xff51afd7ed558ccd,
-	MURM642 = 0xc4ceb9fe1a85ec53
-};
-
-static
-uint64
-minihash(uint64 x, uint64 mask)
-{
-	x = (~x + (x << 21)) & mask;
-	x = x ^ (x >> 24);
-	x = (x + (x << 3) + (x << 8)) & mask;
-	x = x ^ (x >> 14);
-	x = (x + (x << 2) + (x << 4)) & mask;
-	x = x ^ (x >> 28);
-	x = (x + (x << 31));
-
-	return x;
-}
-
-static
-uint64
-murmurhash(uint64 x, uint64 mask) 
-{
-	x = x ^ (x >> 33);
-	x = (x * MURM641);
-	x = x ^ (x >> 33);
-	x = (x * MURM642);
-	x = x ^ (x >> 33);
-
-	return x; 
-}
-
-// -----------------------------------------------------------------------
-// locality sensitive hashing (with spatial extent)
-
-static
-void
-sortpos(uintptr len, uint64 vals[], int locs[])
-{
-    int    tmpi;
-    uint64 tmpu64;
-
-#define LESS(i, j) (locs[i] < locs[j])
-#define SWAP(i, j) (tmpu64  = vals[i], tmpi    = locs[i], \
-                    vals[i] = vals[j], locs[i] = locs[j], \
-                    vals[j] = tmpu64 , locs[j] = tmpi)
-        QSORT(len, LESS, SWAP);
-#undef LESS
-#undef SWAP
-}
-
-/*
- * sketch
- * @param seq:  '0' terminated string
- * @param len:  number of sequential sketches to keep
- * @param vals: buffer to store hashes of sketch.
- * @param locs: buffer to store location of sketch hashes
- */
-error
-aln·sketch(byte *seq, int len, uint64 *vals[aln·N], int *locs[aln·N])
-{
-    int    i, n, l, *loc;
-    uint64 kmer, h[3], *val;
-    int    tmpi[2];
-    uint64 tmpu[2];
-
-    for(n = 0; n < aln·N; n++) {
-        for(l = 0; l < len; l++) {
-            vals[n][l] = UINT64_MAX;
-        }
-    }
-
-    kmer = UINT64_MAX;
-    for(l = 0; *seq != '\0'; seq++, l++) {
-        kmer = ((kmer << 2) | nuctab[*seq]) & aln·mask;
-
-        h[0] = minihash(kmer, aln·mask);
-        h[1] = murmurhash(kmer, aln·mask);
-
-        for(n = 0; n < aln·N; n++) {
-            val = vals[n];
-            loc = locs[n];
-
-            h[2] = (h[0] + n * h[1]) & aln·mask;
-            for (i = 0; i < len && h[2] < val[i]; i++) {
-                ;
-            }
-
-            tmpu[1] = h[2];
-            tmpi[1] = l;
-            for(i -= 1; i >= 0; i--) {
-                tmpu[0] = tmpu[1], tmpu[1] = val[i], val[i] = tmpu[0];
-                tmpi[0] = tmpi[1], tmpi[1] = loc[i], loc[i] = tmpi[0];
-            }
-        }
-    }
-
-    for(n = 0; n < aln·N; n++) {
-        sortpos(len, vals[n], locs[n]);
-    }
-    
-    return 0;
-}
-
-static
-int
-lessarrs(int len, uint64 a[], uint64 b[])
-{
-    int l;
-
-    for(l = 0; l < len; l++) {
-        if (a[l] < b[l]) return 1;
-        if (a[l] > b[l]) return 0;
-    }
-
-    return 0;
-}
-
-static
-void
-swaparrs(int len, uint64 a[], uint64 b[])
-{
-    int l;
-    uint64 tmp;
-
-    for(l = 0; l < len; l++) {
-        tmp = a[l], a[l] = b[l], b[l] = tmp;
-    }
-}
-
-error
-aln·sort(uintptr n, int len, uint64 *vals)
-{
-#define LESS(i, j) (lessarrs(len, vals+((i)*len), vals+((j)*len)))
-#define SWAP(i, j) (swaparrs(len, vals+((i)*len), vals+((j)*len)))
-    QSORT(n, LESS, SWAP);
-#undef LESS
-#undef SWAP
-    return 0;
-}
diff --git a/sys/libbio/fasta.c b/sys/libbio/fasta.c
deleted file mode 100644
index 3788544..0000000
--- a/sys/libbio/fasta.c
+++ /dev/null
@@ -1,393 +0,0 @@
-#include <u.h>
-#include <base.h>
-#include <libbio.h>
-
-#define INIT_NM_SIZE 128
-#define INIT_SQ_SIZE 4096
-
-struct SeqBuf
-{
-    mem·Allocator mem;
-    void         *heap;
-
-    int  cap, off;
-    byte *it, b[];
-};
-
-static
-void
-reset(struct SeqBuf *sb)
-{
-    sb->off = 0;
-    sb->it  = sb->b;
-}
-
-static
-error
-grow(struct SeqBuf **sb, int min)
-{
-    void* heap;
-    mem·Allocator mem;
-
-    vlong newcap;
-    struct SeqBuf *old, *new;
-
-    old  = *sb;
-    mem  = old->mem;
-    heap = old->heap;
-
-    assert((*sb)->cap <= (SIZE_MAX - 1) / 2);
-    newcap = MAX(16, MAX(1 + 2*(*sb)->cap, (*sb)->cap+min));
-    assert(newcap >= (*sb)->cap+min);
-
-    if(new = mem.alloc(heap, 1, sizeof(*new)+newcap), !new) {
-        errorf("memory: could not allocate new buffer\n");
-        return 1;
-    }
-
-    memcpy(new, old, sizeof(*new) + (*sb)->cap);
-
-    new->cap = newcap;
-    new->it  = new->b + (old->it - old->b); 
-    mem.free(heap, old);
-
-    *sb = new;
-    return 0;
-}
-
-static
-error
-put(struct SeqBuf **sb, byte c)
-{
-    int err;
-    struct SeqBuf *sq;
-
-    sq = *sb;
-    if(sq->it < (sq->b + sq->cap)) {
-        *sq->it++ = c;
-        return 0;
-    }
-
-    if(err = grow(sb, 1), err) {
-        errorf("memory fail: could not allocate more buffer\n");
-        sq->mem.free(sq->heap, sq);
-        return 1;
-    }
-
-    *((*sb)->it++) = c;
-    return 0;
-}
-
-static
-error
-push(struct SeqBuf **sb, int n, void *buf)
-{
-    int d, err;
-    struct SeqBuf *seq;
-
-    seq = *sb;
-    if(d = (seq->cap - (seq->it - seq->b)), d < n) {
-        assert(d >= 0);
-        if (err = grow(sb, n-d), err) {
-            errorf("memory fail: could not allocate more buffer\n");
-            seq->mem.free(seq->heap, seq);
-            return 1;
-        }
-    }
-    seq = *sb;
-
-    memcpy(seq->it, buf, n);
-    seq->it += n;
-
-    return 0;
-}
-
-// -----------------------------------------------------------------------
-// sequence data
-
-struct bio·SeqReader {
-    byte      eof;
-    io·Reader rdr;
-    void      *io;
-
-    struct SeqBuf *seq;
-
-    /* read buffer */
-    byte *b, *bend, buf[4*4098];
-};
-
-static
-error
-fill(bio·SeqReader *rdr)
-{
-    int n;
-    // NOTE: This could lead to an infinite loop.
-    if(rdr->eof)
-        return 0;
-
-    n = rdr->rdr.read(rdr->io, 1, arrlen(rdr->buf), rdr->buf);
-    if(n < 0) {
-        errorf("read: no data obtained from reader\n");
-        return 1;
-    }
-    rdr->b    = rdr->buf;
-    rdr->bend = rdr->b + n;
-    if(rdr->eof = (n < arrlen(rdr->buf)), rdr->eof)
-        *rdr->bend++ = '\0';
-
-    return 0;
-}
-
-bio·SeqReader*
-bio·openseq(io·Reader rdr, void *io, mem·Allocator mem, void *heap)
-{
-    error err;
-    bio·SeqReader *r;
-
-    r = mem.alloc(heap, 1, sizeof(bio·SeqReader));
-    r->rdr = rdr;
-    r->io  = io;
-    r->eof = 0;
-
-    r->seq = mem.alloc(heap, 1, sizeof(*r->seq) + INIT_NM_SIZE + INIT_SQ_SIZE);
-    r->seq->mem  = mem;
-    r->seq->heap = heap;
-    r->seq->it   = r->seq->b;
-    r->seq->cap  = INIT_NM_SIZE + INIT_SQ_SIZE;
-
-    if (err=fill(r), err) {
-        errorf("fill: could not populate buffer\n");
-        goto ERROR;
-    }
-
-    return r;
-
-ERROR:
-    mem.free(heap, r->seq);
-    mem.free(heap, r);
-    return nil;
-}
-
-error
-bio·closeseq(bio·SeqReader *rdr)
-{
-    mem·Allocator mem;
-    void         *heap;
-
-    mem  = rdr->seq->mem;
-    heap = rdr->seq->heap; 
-
-    mem.free(heap, rdr->seq);
-    mem.free(heap, rdr);
-
-    return 0;
-}
-
-
-static
-error
-readfasta(bio·SeqReader *rdr, bio·Seq *seq, byte hdr, byte stop)
-{
-    error  err;
-    byte  *beg;
-
-    if(rdr->eof && rdr->b == rdr->bend-1)
-        return EOF;
-
-    reset(rdr->seq);
-
-    // NOTE: Can this case happen?
-    assert(rdr->b != rdr->bend);
-    if(*rdr->b++ != hdr) {
-        errorf("fasta/q format: expected '%c', found '%c'\n", hdr, *rdr->b--);
-        return 1;
-    }
-
-NAME:
-    beg = rdr->b;
-    while(rdr->b != rdr->bend) {
-        if(*rdr->b++ == '\n') {
-            push(&rdr->seq, (rdr->b - 1) - beg, beg);
-            goto SEQ;
-        }
-    }
-    push(&rdr->seq, rdr->b - beg, beg);
-
-    if(err=fill(rdr), err) {
-        errorf("read: could not populate buffer\n");
-        return 1;
-    }
-    goto NAME;
-
-SEQ:
-    put(&rdr->seq, '\0');
-    rdr->seq->off = rdr->seq->it - rdr->seq->b;
-
-SEQLOOP:
-    beg = rdr->b;
-    while(rdr->b != rdr->bend) {
-        if(*rdr->b == '\n') {
-            push(&rdr->seq, rdr->b - beg, beg);
-            beg = rdr->b + 1;
-        }
-
-        if(*rdr->b == stop || *rdr->b == '\0')
-            goto SUCCESS;
-
-        rdr->b++;
-    }
-
-    push(&rdr->seq, rdr->b - beg, beg);
-
-    if(err=fill(rdr), err) {
-        errorf("read: could not populate buffer\n");
-        return 1;
-    }
-    goto SEQLOOP;
-
-SUCCESS:
-    push(&rdr->seq, rdr->b - beg, beg);
-    put(&rdr->seq, '\0');
-
-    return 0;
-}
-
-/* 
- * fasta files
- */
-
-error
-bio·readfasta(bio·SeqReader *rdr, bio·Seq *seq)
-{
-    error err;
-
-    err = readfasta(rdr, seq, '>', '>');
-    if(err && err != EOF) {
-        errorf("parse fail: could not read sequence of record\n");
-        return err;
-    }
-
-    seq->name = rdr->seq->b;
-    seq->s    = rdr->seq->b + rdr->seq->off;
-    seq->len  = rdr->seq->it - seq->s - 1; // shift by 1 as we pushed a '0' to end
-    seq->q    = nil;
-
-    return err;
-}
-
-/* 
- * fastq files
- */
-
-error
-bio·readfastq(bio·SeqReader *rdr, bio·Seq *seq)
-{
-    int   n;
-    byte *beg;
-    error err;
-
-    err = readfasta(rdr, seq, '@', '+');
-    if(err) {
-        errorf("parse fail: could not read sequence of record\n");
-        return err;
-    }
-
-    seq->len = rdr->seq->it - (rdr->seq->b + rdr->seq->off);
-
-    if(*rdr->b++ != '+') {
-        errorf("format error: no '+' character seperator found\n");
-        return -1;
-    }
-
-EATLN:
-    while(rdr->b != rdr->bend) {
-        if (*rdr->b++ == '\n') {
-            n = 0;
-            goto QUAL;
-        }
-    }
-
-    if(err = fill((bio·SeqReader*)rdr), err) {
-        errorf("read: could not populate buffer\n");
-        return 1;
-    }
-    goto EATLN;
-
-QUAL:
-    beg = rdr->b;
-    while(rdr->b != rdr->bend) {
-        if(*rdr->b == '\n') {
-            push(&rdr->seq, rdr->b - beg, beg);
-            beg = rdr->b + 1;
-        }
-
-        if(n++ == seq->len || *rdr->b == '\0') {
-            err = *rdr->b == '\0' ? EOF : 0;
-            goto SUCCESS;
-        }
-
-        rdr->b++;
-    }
-
-    push(&rdr->seq, rdr->b - beg, beg);
-
-    if(err = fill((bio·SeqReader*)rdr), err) {
-        errorf("read: could not populate buffer\n");
-        return 1;
-    }
-    goto QUAL;
-
-
-SUCCESS:
-    push(&rdr->seq, rdr->b - beg, beg);
-    put(&rdr->seq,  '\0');
-
-    seq->name = rdr->seq->b;
-    seq->s    = rdr->seq->b + rdr->seq->off - 1;
-    seq->q    = seq->s + seq->len + 1;
-
-    return err;
-}
-
-// -----------------------------------------------------------------------
-// sequence writing
-
-error 
-bio·writefasta(io·Writer io, void *wtr, bio·Seq seq)
-{
-    int i, j, d;
-    char buf[2048], *b = buf, *e = arrend(buf);
-
-    *b++ = '>';
-    while(*seq.name) {
-        *b++ = *seq.name++;
-        if(b == e) {
-            io.write(wtr, 1, arrlen(buf), buf);
-            b = buf;
-        }
-    }
-
-    for(i=0; i<seq.len; i = j) {
-        j = MIN(i+70, seq.len);
-        d = j - i;
-        if((e-b) <= d+1) {
-            io.write(wtr, 1, b-buf, buf);
-            b = buf;
-        }
-        *b++ = '\n';
-        memcpy(b, seq.s+i, d);
-        b += d;
-    }
-
-    *b++ = '\n';
-    io.write(wtr, 1, b-buf, buf);
-
-    return 0;
-}
-
-error
-bio·writefastq(io·Writer io, void *wtr, bio·Seq seq)
-{
-    panicf("need to implement");
-    return 1;
-}
diff --git a/sys/libbio/newick.c b/sys/libbio/newick.c
deleted file mode 100644
index 5e6d30a..0000000
--- a/sys/libbio/newick.c
+++ /dev/null
@@ -1,414 +0,0 @@
-#include <u.h>
-#include <base.h>
-#include <libbio.h>
-
-// -----------------------------------------------------------------------
-// Tokens
-
-enum TokenKind
-{
-    tok·nil,
-    tok·eof,
-    tok·space,
-    tok·ident,
-    tok·number,
-    tok·lparen,
-    tok·rparen,
-    tok·lbrak,
-    tok·rbrak,
-    tok·comma,
-    tok·semi,
-    tok·colon,
-
-    NUM_TOKENS,
-};
-
-
-struct Token {
-    enum TokenKind kind;
-    union 
-    {
-        byte  *s;
-        double x;
-    } lit;
-};
-
-static
-byte*
-tokstr(struct Token tok)
-{
-    static byte b[50];
-    switch (tok.kind) {
-       case tok·nil:    return ""; 
-       case tok·eof:    return nil;
-       case tok·space:  return " ";
-       case tok·ident:  return tok.lit.s;
-       case tok·lparen: return "(";
-       case tok·rparen: return ")";
-       case tok·lbrak:  return "[";
-       case tok·rbrak:  return "]";
-       case tok·comma:  return ",";
-       case tok·semi:   return ";";
-       case tok·colon:  return ":";
-       case tok·number: 
-            snprintf(b, arrlen(b), "%f", tok.lit.x);
-            return b;
-        default:
-            return nil;
-    }
-}
-
-
-// -----------------------------------------------------------------------
-// Read
-
-// TODO: Bounds checking on buffer
-static
-struct Token
-lex(io·Peeker s, void* fp)
-{
-#define isvalidchar(C) ((C) == '!')               || \
-                       ('\"' < (C) && (C) < '\'') || \
-                       (')' < (C) && (C) < '+')   || \
-                       (',' < (C) && (C) < ':')   || \
-                       (':' < (C) && (C) < '[')   || \
-                       ((C) == '\\')              || \
-                       (']' < (C) && (C) <= '~')
-    byte *c;
-    struct Token tok;
-    static byte b[1024];
-    c  = b;
-    *c = s.get(fp);
-
-    if (isspace(*c)) {
-        while (isspace(*c)) {
-            *(++c) = s.get(fp);
-        }
-
-        s.unget(fp, *c);
-        assert(c - b < 1024);
-
-        *c        = 0;
-        tok.kind  = tok·space;
-        tok.lit.s = b;
-        return tok;
-    }
-
-    switch (*c) {
-    case EOF: tok.kind = tok·eof;    return tok;
-    case '(': tok.kind = tok·lparen; return tok;
-    case ')': tok.kind = tok·rparen; return tok;
-    case '[': tok.kind = tok·lbrak;  return tok;
-    case ']': tok.kind = tok·rbrak;  return tok;
-    case ',': tok.kind = tok·comma;  return tok;
-    case ';': tok.kind = tok·semi;   return tok;
-    case ':': tok.kind = tok·colon;  return tok;
-
-    case '.':
-    case '0': case '1': case '2': case '3': case '4':
-    case '5': case '6': case '7': case '8': case '9':
-        while (isdigit(*c)) {
-    NUM:    *(++c) = s.get(fp);
-        }
-        if (*c == '.')          goto NUM;
-        if (isvalidchar(*c))    goto IDENT;
-
-        s.unget(fp, *c);
-        assert(c - b < 1024);
-
-        *c        = 0;
-        tok.kind  = tok·number;
-        tok.lit.x = atof(b);
-        return tok;
-
-    case '\"':
-        while ((*c) != '\"') { 
-            *(++c) = s.get(fp);
-        }
-        assert(c - b < 1024);
-
-        *c        = '\0';
-        tok.kind  = tok·ident;
-        tok.lit.s = b + 1;
-        return tok;
-
-    default:
-    IDENT:
-        while (isvalidchar(*c)) { 
-            *(++c) = s.get(fp);
-        }
-        s.unget(fp, *c);
-        assert(c - b < 1024);
-
-        *c        = '\0';
-        tok.kind  = tok·ident;
-        tok.lit.s = b;
-        return tok;
-    }
-#undef isvalidchar
-}
-
-static
-struct Token
-lex_nospace(io·Peeker s, void *impl)
-{
-    struct Token tok;
-    tok = lex(s, impl);
-    if (tok.kind == tok·space) {
-        tok = lex_nospace(s, impl);
-    }
-
-    return tok;
-}
-
-struct Parser
-{
-    int          lev;
-    bio·Node    *root;
-    struct Token tok;
-
-    void         *io;
-    io·Peeker     file;
-    void         *heap;
-    mem·Allocator mem;
-};
-
-static
-error
-parse(struct Parser *p)
-{
-    error err;
-    bio·Node *node;
-    bio·Node *root;
-    struct Token tok;
-
-    node = p->root;
-    for (;;) {
-        tok = lex_nospace(p->file, p->io);
-
-        switch (tok.kind) {
-        case tok·lparen:
-            if (!p->root && p->lev > 0) {
-                errorf("parse format: attempted to make root at non-zero level");
-                goto ERROR;
-            }
-
-            node = p->mem.alloc(p->heap, 1, sizeof(*node));
-            memset(node, 0, sizeof(*node));
-
-            if (p->root) {
-                phylo·addchild(p->root, node);
-                root = p->root;
-            } else {
-                root = node;
-            }
-
-            p->lev++;
-            p->root = node;
-            p->tok  = tok;
-            err     = parse(p);
-            if (err) {
-                goto ERROR;
-            }
-            if (p->tok.kind != tok·rparen) {
-                errorf("incorrect format: closing parentheses expected to proceed opening");
-                goto ERROR;
-            }
-            p->root = root;
-        // NOTE(nnoll): We don't want to override the state of p->tok here!
-        //              Jump straight to grabbing next token.
-        continue;
-
-        case tok·rparen:
-            p->lev--;
-            goto DONE;
-
-        /* Comments */
-        case tok·lbrak:
-            if (!node) {
-                errorf("incorrect format: comment found in disallowed region");
-                goto ERROR;
-            }
-            node->comment = str·make("");
-            while (tok.kind != tok·rbrak) {
-                tok = lex_nospace(p->file, p->io);
-                if (tok.kind == tok·eof || tok.kind == tok·nil) {
-                    errorf("incorrect format: unmatched comment bracket '['");
-                    goto ERROR;
-                }
-                str·append(&node->comment, tokstr(tok));
-            }
-        break;
-
-        case tok·rbrak:
-           errorf("incorrect format: end comment token found in disallowed region");
-           goto ERROR;
-        break;
-
-        case tok·colon:
-            tok = lex_nospace(p->file, p->io);
-            if (tok.kind != tok·number) {
-                errorf("incorrect format: expected number after colon");
-                goto ERROR;
-            }
-            if (node == nil) {
-                errorf("parse error: attempting to set distance of nil node");
-                goto ERROR;
-            }
-            node->dist = tok.lit.x;
-        break;
-
-        case tok·comma:
-            node = nil;
-        break;
-
-        case tok·ident:
-            if (p->tok.kind == tok·rparen) {
-                if (!node) {
-                    errorf("parse error: attempting to set name of nil node");
-                    goto ERROR;
-                }
-                node->name = str·make(tok.lit.s);
-            } else {
-                if (p->tok.kind != tok·lparen && p->tok.kind != tok·comma) {
-                    errorf("format error: misplaced identifier for leaf found");
-                    goto ERROR;
-                }
-
-                if (!p->root) {
-                    errorf("parse error: attempting to create child for no parent");
-                    goto ERROR;
-                }
-
-                node = p->mem.alloc(p->heap, 1, sizeof(*node));
-                memset(node, 0, sizeof(*node));
-
-                node->name = str·make(tok.lit.s);
-
-                phylo·addchild(p->root, node);
-            }
-        break;
-
-        case tok·number:
-            if (p->tok.kind == tok·rparen) {
-                if (p->lev == 0) {
-                    errorf("format error: support value on root not supported");
-                    goto ERROR;
-                }
-                node->support = tok.lit.x;
-            } else {
-                errorf("format error: found number in unexpected location");
-                goto ERROR;
-            }
-        break;
-
-        case tok·semi:
-            p->file.unget(p->io, ';');
-            if (p->lev) {
-                errorf("format error: uneven number of parentheses found at ';'");
-                goto ERROR;
-            }
-            goto DONE;
-
-        case tok·eof:
-            goto DONE;
-
-        default: 
-            errorf("parse error: unrecognized token");
-            goto ERROR;
-        }
-
-        p->tok = tok;
-    }
-
-DONE:
-    p->tok = tok;
-    return 0;
-ERROR:
-    // TODO(nnoll): cleanup
-    return 1;
-}
-
-int
-bio·readnewick(io·Peeker stream, void *s, bio·Tree *tree)
-{
-    error err;
-    struct Parser p;
-
-    if (!tree) {
-        errorf("tree pointer nil");
-        return 0;
-    }
-
-    p = (struct Parser){ 
-        .lev   = 0,
-        .root  = nil,
-        .tok   = (struct Token){ 0 },
-        .io    = s,
-        .file  = stream,
-        .mem   = tree->mem,
-        .heap  = tree->heap,
-    };
-    err = parse(&p);
-    if (err) {
-        errorf("parsing failed\n");
-        return 0;
-    }
-
-    tree->root  = p.root;
-    tree->nleaf = 0;
-    tree->root->nnode = 0;
-
-    phylo·countleafs(tree->root, &tree->nleaf);
-    phylo·countnodes(tree->root, &tree->root->nnode);
-
-    return 1;
-}
-
-// -----------------------------------------------------------------------
-// Write
-
-static
-error
-dump(bio·Node *node, void *impl, io·Putter out)
-{
-    byte b[24];
-
-    if (!node) {
-        return 1;
-    }
-
-    bio·Node *child;
-    if (node->nchild) {
-        out.put(impl, '(');
-
-        dump(node->child, impl, out);
-        for (child = node->child->sibling; child != nil; child = child->sibling) {
-            out.put(impl, ',');
-            dump(child, impl, out);
-        }
-
-        out.put(impl, ')');
-    }
-    if (node->name) {
-        out.puts(impl, node->name);
-    }
-
-    if (node->parent) {
-        out.put(impl, ':');
-        snprintf(b, arrlen(b), "%f", node->dist);
-        out.puts(impl, b);
-    }
-
-    return 0;
-}
-
-error
-bio·writenewick(bio·Tree tree, io·Putter out, void* impl)
-{
-    dump(tree.root, impl, out);
-    out.put(impl, ';');
-    out.put(impl, '\n');
-
-    return 0;
-}
diff --git a/sys/libbio/phylo.c b/sys/libbio/phylo.c
deleted file mode 100644
index d50934f..0000000
--- a/sys/libbio/phylo.c
+++ /dev/null
@@ -1,427 +0,0 @@
-#include <u.h>
-#include <base.h>
-#include <base/macro/qsort.h>
-#include <libbio.h>
-
-// -----------------------------------------------------------------------
-// subtree manipulation methods
-// NOTE: As of now these don't update nnode & nleaf stats.
-//       It is the caller's responsibility to refresh counts.
-
-error
-phylo·addchild(bio·Node* parent, bio·Node* child)
-{
-    bio·Node *it, *sibling;
-    if (!parent->nchild) {
-        parent->child = child;
-        goto SUCCESS;
-    }
-
-    for (it = parent->child, sibling = it; it != nil; it = it->sibling) {
-        sibling = it;
-    }
-    sibling->sibling = child;
-
-SUCCESS:
-    child->parent = parent;
-    parent->nchild++;
-    return 0;
-}
-
-error
-phylo·rmchild(bio·Node *parent, bio·Node *child)
-{
-    bio·Node *it, *prev;
-    enum {
-        error·nil,
-        error·notfound,
-        error·nochildren,
-    };
-
-    prev = nil;
-    for (it = parent->child; it != nil; it = it->sibling) {
-        if (it == child) goto FOUND;
-        prev = it;
-    }
-    return error·notfound;
-
-FOUND:
-    if (prev == nil) {
-        parent->child = child->sibling;
-    } else {
-        prev->sibling = child->sibling;
-    }
-
-    parent->nchild--;
-    return error·nil;
-}
-
-// -----------------------------------------------------------------------
-// subtree statistics
-
-error
-phylo·countnodes(bio·Node *node, int *n)
-{
-    int       m;
-    error     err;
-    bio·Node *child;
-    
-    m = *n;
-    for (child = node->child; child != nil; child = child->sibling) {
-        if (err = phylo·countnodes(child, n), err) {
-            errorf("node count: failure at '%s'", child->name);
-            return 1;
-        }
-    }
-    node->nnode = *n - m;
-    *n += 1;
-
-    return 0;
-}
-
-error
-phylo·countleafs(bio·Node *node, int *n)
-{
-    error     err;
-    bio·Node *child;
-
-    if (!node->nchild) {
-        *n += 1;
-    }
-
-    for (child = node->child; child != nil; child = child->sibling) {
-        if (err = phylo·countleafs(child, n), err) {
-            errorf("leaf count: failure at '%s'", child->name);
-            return 1;
-        }
-    }
-
-    return 0;
-}
-
-// -----------------------------------------------------------------------
-// generic operations on tree
-
-void*
-phylo·postorder(bio·Node *clade, void *(*op)(bio·Node*, void*), void *ctx)
-{
-    bio·Node *it;
-
-    for(it = clade->child; it != nil; it = it->sibling) {
-        ctx = phylo·postorder(it, op, ctx);
-    }
-
-    return op(clade, ctx);
-}
-
-void*
-phylo·preorder(bio·Node *clade, void *(*op)(bio·Node*, void*), void *ctx)
-{
-    bio·Node *it;
-
-    ctx = op(clade, ctx);
-    for(it = clade->child; it != nil; it = it->sibling) {
-        ctx = phylo·preorder(it, op, ctx);
-    }
-
-    return ctx;
-}
-
-int
-phylo·collectpostorder(bio·Node *clade, bio·Node **list)
-{
-    bio·Node *it;
-    int n;
-
-    for(n = 0, it = clade->child; it != nil; it = it->sibling) {
-        n += phylo·collectpostorder(it, list+n);
-    }
-
-    return n;
-}
-
-static
-inline
-void*
-appendleaf(bio·Node *node, void* list)
-{
-    bio·Node **leafs;
-
-    leafs = list;
-    if (!node->nchild) {
-        *leafs++ = node;
-    }
-
-    return leafs;
-}
-
-void
-phylo·getleafs(bio·Tree tree, bio·Node **leafs)
-{
-    phylo·postorder(tree.root, &appendleaf, leafs);
-}
-
-// -----------------------------------------------------------------------
-// tree editing
-
-static
-void
-sortnodelist(bio·Node **head, bio·Node *next)
-{
-    bio·Node tmp, *it;
-
-    it          = &tmp;
-    tmp.sibling = *head;
-
-    while (it->sibling != nil && it->sibling->nnode < next->nnode) {
-        it = it->sibling;
-    }
-
-    next->sibling = it->sibling;
-    it->sibling = next;
-    *head = tmp.sibling;
-}
-
-error
-phylo·ladderize(bio·Node *root)
-{
-    int       i;
-    error     err;
-    bio·Node *child, *sorted, *sibling;
-
-    if (!root->nchild) return 0;
-
-    // ladderize below 
-    for (child = root->child; child != nil; child = child->sibling) {
-        if (err = phylo·ladderize(child), err) {
-            errorf("ladderize: failure at '%s'", child->name);
-            return 1;
-        }
-    }
-
-    // ladderize yourself
-    sorted = nil;
-    child  = root->child;
-    while (child != nil) {
-        sibling = child->sibling;
-        sortnodelist(&sorted, child);
-        child   = sibling;
-    }
-    root->child = sorted;
-
-    return 0;
-}
-
-/*
- * compute all distances from a given node
- * must provide a working buffer
- */
-
-struct Tuple 
-{
-    double   *d;
-    bio·Node **n;
-};
-
-static
-struct Tuple
-getdistsfrom(bio·Node *node, bio·Node *prev, double curr, double *dist, bio·Node **list)
-{
-    bio·Node     *it;
-    struct Tuple ret;
-
-    *dist++ = curr;
-    *list++ = node;
-
-    ret.d = dist;
-    ret.n = list;
-
-    if (node->parent && node->parent != prev) {
-        ret = getdistsfrom(node->parent, node, curr + node->dist, dist, list);
-
-        dist = ret.d;
-        list = ret.n;
-    }
-
-    for (it = node->child; it != nil; it = it->sibling) {
-        if (it != prev) {
-            ret = getdistsfrom(it, node, curr + it->dist, dist, list);
-
-            dist = ret.d;
-            list = ret.n;
-        }
-    }
-
-    return ret;
-}
-
-int
-phylo·getdistsfrom(bio·Node *node, int len, double *dist, bio·Node **list)
-{
-    struct Tuple ret;
-    // TODO: Better bounds checking.
-
-    ret = getdistsfrom(node, nil, 0.0, dist, list);
-
-    assert(ret.n - list == len);
-    assert(ret.d - dist == len);
-
-    return len;
-}
-
-/*
-static
-void
-disttoroot(bio·Node *clade, double anc, double *dists)
-{
-    double    d;
-    bio·Node *it;
-
-    *dists++ = anc + clade->dist; 
-    d = dists[-1];
-    for (it = clade->child; it != nil; it = it->sibling) {
-        disttoroot(it, d, ++dists);
-    }
-}
-
-void
-phylo·disttoroot(bio·Tree tree, double *dists)
-{
-    disttoroot(tree.root, 0.0, dists);
-}
-*/
-
-/*
- * compute the path constituting the tree diameter
- * returns the number of edges in the path
- */
-
-static
-void
-sort·nodedists(uintptr len, double fs[], bio·Node* ns[])
-{
-    double    f;
-    bio·Node *n;
-#define LESS(i, j) (fs[i] < fs[j])
-#define SWAP(i, j) (n     = ns[i], f     = fs[i], \
-                    fs[i] = fs[j], ns[i] = ns[j], \
-                    fs[j] = f,     ns[j] = n)
-        QSORT(len, LESS, SWAP);
-#undef LESS
-#undef SWAP
-}
-
-#define BUFLEN 4096
-double
-phylo·diameter(bio·Tree tree, int *len, bio·Node **path)
-{
-    // TODO: deal with large tree > BUFLEN gracefully
-    int       n;
-    double    fbuf[BUFLEN];
-    bio·Node *nbuf[BUFLEN];
-
-    n = tree.root->nnode;
-
-    assert(n < BUFLEN);
-
-    n = phylo·getdistsfrom(tree.root, tree.root->nnode, fbuf, nbuf);
-    sort·nodedists(n, fbuf, nbuf);
-
-    path[0] = nbuf[n-1];
-    printf("first end '%s'\n", path[0]->name);
-
-    n = phylo·getdistsfrom(path[0], n, fbuf, nbuf);
-    sort·nodedists(n, fbuf, nbuf);
-    printf("second end '%s'\n", nbuf[n-1]->name);
-
-    *len = 0;
-
-    // TODO: Traverse up the tree from each node
-    //       Find MRCA by intersection of nodes hit
-
-    return 0.0;
-}
-#undef BUFLEN
-
-/*
- * reroot a tree on a new node
- */
-static
-error
-rotateparent(bio·Node *node, bio·Node *to)
-{
-    error err;
-
-    // NOTE: will this ever be taken?
-    if (node->parent == to) {
-        return 0;
-    }
-
-    if (!node->parent) {
-        goto RMCHILD;
-    }
-
-    err = rotateparent(node->parent, node);
-    if (err) {
-        errorf("failure: broken tree");
-        return err;
-    }
-
-    err = phylo·addchild(node, node->parent);
-    if (err) {
-        errorf("inconsistent topology: could not add parent '%s' as child of '%s'", node->parent->name, node->name);
-        return err;
-    }
-
-RMCHILD:
-    err = phylo·rmchild(node, to);
-    if (err) {
-        errorf("inconsistent topology: could not remove child '%s' from '%s'", to->name, node->name);
-        return err;
-    }
-    
-    node->parent = to;
-    return 0;
-}
-
-#define PREC .00000001
-error
-phylo·reroot(bio·Tree *tree, bio·Node *node, double d)
-{
-    bio·Node *new;
-
-    // TODO: should check that node is part of this tree?
-    // TODO: should we check if node->parent != nil?
-
-    if (fabs(d) < PREC) {
-        new = node;
-        rotateparent(node->parent, node);
-    } else if (fabs(d-node->dist) < PREC) {
-        new = node->parent;
-        if (new->parent->parent) {
-            rotateparent(new->parent->parent, new->parent);
-        }
-    } else {
-        new = tree->mem.alloc(tree->heap, 1, sizeof(*new));
-        memset(new, 0, sizeof(*new));
-
-        phylo·addchild(new, node);
-        node->parent = new;
-
-        phylo·addchild(new, node->parent);
-        if (node->parent->parent) {
-            rotateparent(node->parent->parent, node->parent);
-        }
-        node->parent->parent = new;
-    }
-
-    printf("number of children on old root: %d\n", tree->root->nchild);
-    tree->root  = new;
-    tree->nleaf = 0;
-
-    phylo·countleafs(new, &tree->nleaf);
-    phylo·countnodes(new, &new->nnode);
-
-    return 0;
-}
-#undef PREC
diff --git a/sys/libbio/rules.mk b/sys/libbio/rules.mk
deleted file mode 100644
index cbc6887..0000000
--- a/sys/libbio/rules.mk
+++ /dev/null
@@ -1,28 +0,0 @@
-include share/push.mk
-
-# Local sources
-SRCS_$(d) := \
-	$(d)/fasta.c \
-	$(d)/newick.c \
-	$(d)/phylo.c 
-LIBS_$(d) := $(d)/libbio.a
-BINS_$(d) := 
-# TSTS_$(d) := \
-# 	$(d)/test.c \
-# 	$(d)/simulate.c
-
-include share/paths.mk
-
-# Local rules
-# $(LIBS_$(d)) = TCFLAGS :=
-# $(LIBS_$(d)) = TCINCS  :=
-# $(LIBS_$(d)) = TCLIBS  :=
-
-$(LIBS_$(d)): $(OBJS_$(d)) $(OBJS_$(d)/io)
-	$(ARCHIVE)
-
-$(UNTS_$(d)): TCLIBS := $(LIBS_$(d)) $(OBJ_DIR)/libn/libn.a
-$(UNTS_$(d)): $(TOBJS_$(d)) $(LIBS_$(d)) $(OBJ_DIR)/libn/libn.a
-	$(LINK)
-
-include share/pop.mk
diff --git a/sys/libbio/simulate.c b/sys/libbio/simulate.c
deleted file mode 100644
index 0f5a97e..0000000
--- a/sys/libbio/simulate.c
+++ /dev/null
@@ -1,120 +0,0 @@
-#include <u.h>
-#include <libn.h>
-#include <libbio.h>
-
-#define SEQLEN 2560
-static byte *SEQ =
-"GGCGGCTTCGGTGCGCTGTGTGCATTGCCGCAAAAATATCGTGAACCCGTGCTGGTTTCCGGCACTGACGGCGTAGGTAC"
-"CAAGCTGCGTCTGGCAATGGACTTAAAACGTCACGACACCATTGGTATTGATCTGGTCGCCATGTGCGTTAATGACCTGG"
-"TGGTGCAAGGTGCGGAACCGCTGTTTTTCCTCGACTATTACGCAACCGGAAAACTGGATGTTGATACCGCTTCAGCGGTG"
-"ATCAGCGGCATTGCGGAAGGTTGTCTGCAATCGGGCTGTTCTCTGGTGGGTGGCGAAACGGCAGAAATGCCGGGGATGTA"
-"TCACGGTGAAGATTACGATGTCGCGGGTTTCTGCGTGGGCGTGGTAGAAAAATCAGAAATCATCGACGGCTCTAAAGTCA"
-"GCGACGGCGATGTGCTGATTGCACTCGGTTCCAGCGGTCCGCACTCGAACGGTTATTCGCTGGTGCGCAAAATTCTTGAA"
-"GTCAGCGGTTGTGATCCGCAAACCACCGAACTTGATGGTAAGCCATTAGCCGATCATCTGCTGGCACCGACCCGCATTTA"
-"CGTGAAGTCAGTGCTGGAGTTGATTGAAAAGGTCGATGTGCATGCCATTGCGCACCTGACCGGCGGCGGCTTCTGGGAAA"
-"ACATTCCGCGCGTATTGCCAGATAATACCCAGGCAGTGATTGATGAATCTTCCTGGCAGTGGCCGGAAGTGTTCAACTGG"
-"CTGCAAACGGCAGGTAACGTTGAGCGCCATGAAATGTATCGCACCTTCAACTGCGGCGTCGGGATGATTATCGCCCTGCC"
-"TGCTCCGGAAGTGGACAAAGCCCTCGCCCTGCTCAATGCCAACGGTGAAAACGCGTGGAAAATCGGTATCATCAAAGCCT"
-"CTGATTCCGAACAACGCGTGGTTATCGAATAATGAATATTGTGGTGCTTATTTCCGGCAACGGAAGTAATTTACAGGCAA"
-"TTATTGACGCCTGTAAAACCAACAAAATTAAAGGCACCGTACGGGCAGTTTTCAGCAATAAGGCCGACGCGTTCGGCCTT"
-"GAACGCGCCCGCCAGGCGGGTATTGCAACGCATACGCTCATCGCCAGCGCGTTTGACAGTCGTGAAGCCTATGACCGGGA"
-"GTTGATTCATGAAATCGACATGTACGCACCCGATGTGGTCGTGCTGGCTGGTTTTATGCGCATTCTCAGCCCGGCGTTTG"
-"TCTCCCACTATGCCGGGCGTTTGCTGAACATTCACCCTTCTCTGCTGCCGAAATATCCCGGATTACACACCCATCGTCAA"
-"GCGCTGGAAAATGGCGATGAAGAGCACGGTACATCGGTGCATTTCGTCACCGATGAACTGGACGGTGGCCCGGTTATTTT"
-"ACAGGCGAAAGTCCCGGTATTTGCTGGTGATACGGAAGATGACGTCACCGCCCGCGTGCAAACCCAGGAACACGCCATTT"
-"ATCCACTGGTGATTAGCTGGTTTGCCGATGGTCGTCTGAAAATGCACGAAAACGCCGCGTGGCTGGATGGTCAACGTCTG"
-"CCGCCGCAGGGCTACGCTGCCGACGAGTAATGCCCCCGTAGTTAAAGCGCCAGCTCTGCCGCTGGCGTTTTTCAATTCAC"
-"CTGTAAATCGCAAGCTCCAGCAGTTTTTTTCCCCCTTTTCTGGCATAGTTGGACATCTGCCAATATTGCTCGCCATAATA"
-"TCCAGGCAGTGTCCCGTGAATAAAACGGAGTAAAAGTGGTAATGGGTCAGGAAAAGCTATACATCGAAAAAGAGCTCAGT"
-"TGGTTATCGTTCAATGAACGCGTGCTTCAGGAAGCGGCGGACAAATCTAACCCGCTGATTGAAAGGATGCGTTTCCTGGG"
-"GATCTATTCCAATAACCTTGATGAGTTCTATAAAGTCCGCTTCGCTGAACTGAAGCGACGCATCATTATTAGCGAAGAAC"
-"AAGGCTCCAACTCTCATTCCCGCCATTTACTGGGCAAAATTCAGTCCCGGGTGCTGAAAGCCGATCAGGAATTCGACGGC"
-"CTCTACAACGAGCTATTGCTGGAGATGGCGCGCAACCAGATCTTCCTGATTAATGAACGCCAGCTCTCCGTCAATCAACA"
-"AAACTGGCTGCGTCATTATTTTAAGCAGTATCTGCGTCAGCACATTACGCCGATTTTAATCAATCCTGACACTGACTTAG"
-"TGCAGTTCCTGAAAGATGATTACACCTATCTGGCGGTGGAAATTATCCGTGGCGATACCATCCGTTACGCGCTTCTGGAG"
-"ATCCCATCAGATAAAGTGCCGCGCTTTGTGAATTTACCGCCAGAAGCGCCGCGTCGACGCAAGCCGATGATTCTTCTGGA"
-"TAACATTCTGCGTTACTGCCTTGATGATATTTTCAAAGGCTTCTTTGATTATGACGCGCTGAATGCCTATTCAATGAAGA"
-"TGACCCGCGATGCCGAATACGATTTAGTGCATGAGATGGAAGCCAGCCTGATGGAGTTGATGTCTTCCAGTCTCAAGCAG"
-"CGTTTAACTGCTGAGCCGGTGCGTTTTGTTTATCAGCGCGATATGCCCAATGCGCTGGTTGAAGTTTTACGCGAAAAACT";
-
-byte*
-modify(byte *seq, int *len, double p)
-{
-    byte *head, *new;
-
-    head = calloc(SEQLEN+1, sizeof(byte));
-    new  = head;
-    for (; *seq != '\0'; seq++) {
-        if (rng·bernoulli(p)) {
-            switch (rng·randi(5)) {
-            case 0: *new++ = 'A'; break;
-            case 1: *new++ = 'C'; break;
-            case 2: *new++ = 'G'; break;
-            case 3: *new++ = 'T'; break;
-            case 4: continue;
-            }
-        } else {
-            *new++ = *seq;
-        }
-    }
-    *new = '\0';
-    *len = new - head;
-    return head;
-}
-
-#define NSEQS 20
-int
-main()
-{
-    int n, i, l, lens[NSEQS];
-    byte     *seqs[NSEQS];
-
-    int    locs[aln·N][NSEQS][aln·L];
-    int    *loc[aln·N];
-    uint64 vals[aln·N][NSEQS][aln·L];
-    uint64 *val[aln·N];
-
-    rng·init(0);
-
-    seqs[0] = SEQ;
-    lens[0] = SEQLEN;
-
-    for (n = 0; n < aln·N; n++) {
-        for (i = 0; i < NSEQS; i++) {
-            for (l = 0; l < aln·L; l++) {
-                vals[n][i][l] = 0;
-            }
-        }
-    }
-
-    for (i = 1; i < NSEQS; i++) {
-        seqs[i] = modify(SEQ, lens + i, .01*i);
-    }
-
-    for (i = 0; i < NSEQS; i++) {
-        for (n = 0; n < aln·N; n++) {
-            val[n] = vals[n][i];
-            loc[n] = locs[n][i];
-        }
-        aln·sketch(seqs[i], aln·L, val, loc);
-    }
-
-    // for (n = 0; n < aln·N; n++) {
-    //     printf("iteration %d\n", n);
-    //     printf("[\n");
-    //     for (i = 0; i < NSEQS; i++) {
-    //         printf("  [");
-    //         for (l = 0; l < aln·L; l++) {
-    //             printf("%lu,", vals[n][i][l]);
-    //         }
-    //         printf("],\n");
-    //     }
-    //     printf("]\n");
-    // }
-
-    for (n = 0; n < aln·N; n++) {
-        aln·sort(NSEQS, aln·L, (uint64*)vals[n]);
-    }
-
-    return 0;
-}
diff --git a/sys/libbio/test.c b/sys/libbio/test.c
deleted file mode 100644
index 9926764..0000000
--- a/sys/libbio/test.c
+++ /dev/null
@@ -1,283 +0,0 @@
-#include <u.h>
-#include <libn.h>
-#include <libbio.h>
-
-#include <time.h>
-
-// -----------------------------------------------------------------------
-// Global data
-
-static byte *SEQ[] = {
-"GGCGGCTTCGGTGCGCTGTGTGCATTGCCGCAAAAATATCGTGAACCCGTGCTGGTTTCCGGCACTGACGGCGTAGGTAC"
-"CAAGCTGCGTCTGGCAATGGACTTAAAACGTCACGACACCATTGGTATTGATCTGGTCGCCATGTGCGTTAATGACCTGG"
-"TGGTGCAAGGTGCGGAACCGCTGTTTTTCCTCGACTATTACGCAACCGGAAAACTGGATGTTGATACCGCTTCAGCGGTG"
-"ATCAGCGGCATTGCGGAAGGTTGTCTGCAATCGGGCTGTTCTCTGGTGGGTGGCGAAACGGCAGAAATGCCGGGGATGTA"
-"TCACGGTGAAGATTACGATGTCGCGGGTTTCTGCGTGGGCGTGGTAGAAAAATCAGAAATCATCGACGGCTCTAAAGTCA"
-"GCGACGGCGATGTGCTGATTGCACTCGGTTCCAGCGGTCCGCACTCGAACGGTTATTCGCTGGTGCGCAAAATTCTTGAA"
-"GTCAGCGGTTGTGATCCGCAAACCACCGAACTTGATGGTAAGCCATTAGCCGATCATCTGCTGGCACCGACCCGCATTTA"
-"CGTGAAGTCAGTGCTGGAGTTGATTGAAAAGGTCGATGTGCATGCCATTGCGCACCTGACCGGCGGCGGCTTCTGGGAAA"
-"ACATTCCGCGCGTATTGCCAGATAATACCCAGGCAGTGATTGATGAATCTTCCTGGCAGTGGCCGGAAGTGTTCAACTGG"
-"CTGCAAACGGCAGGTAACGTTGAGCGCCATGAAATGTATCGCACCTTCAACTGCGGCGTCGGGATGATTATCGCCCTGCC"
-"TGCTCCGGAAGTGGACAAAGCCCTCGCCCTGCTCAATGCCAACGGTGAAAACGCGTGGAAAATCGGTATCATCAAAGCCT"
-"CTGATTCCGAACAACGCGTGGTTATCGAATAATGAATATTGTGGTGCTTATTTCCGGCAACGGAAGTAATTTACAGGCAA"
-"TTATTGACGCCTGTAAAACCAACAAAATTAAAGGCACCGTACGGGCAGTTTTCAGCAATAAGGCCGACGCGTTCGGCCTT"
-"GAACGCGCCCGCCAGGCGGGTATTGCAACGCATACGCTCATCGCCAGCGCGTTTGACAGTCGTGAAGCCTATGACCGGGA"
-"GTTGATTCATGAAATCGACATGTACGCACCCGATGTGGTCGTGCTGGCTGGTTTTATGCGCATTCTCAGCCCGGCGTTTG"
-"TCTCCCACTATGCCGGGCGTTTGCTGAACATTCACCCTTCTCTGCTGCCGAAATATCCCGGATTACACACCCATCGTCAA"
-"GCGCTGGAAAATGGCGATGAAGAGCACGGTACATCGGTGCATTTCGTCACCGATGAACTGGACGGTGGCCCGGTTATTTT"
-"ACAGGCGAAAGTCCCGGTATTTGCTGGTGATACGGAAGATGACGTCACCGCCCGCGTGCAAACCCAGGAACACGCCATTT"
-"ATCCACTGGTGATTAGCTGGTTTGCCGATGGTCGTCTGAAAATGCACGAAAACGCCGCGTGGCTGGATGGTCAACGTCTG"
-"CCGCCGCAGGGCTACGCTGCCGACGAGTAATGCCCCCGTAGTTAAAGCGCCAGCTCTGCCGCTGGCGTTTTTCAATTCAC"
-"CTGTAAATCGCAAGCTCCAGCAGTTTTTTTCCCCCTTTTCTGGCATAGTTGGACATCTGCCAATATTGCTCGCCATAATA"
-"TCCAGGCAGTGTCCCGTGAATAAAACGGAGTAAAAGTGGTAATGGGTCAGGAAAAGCTATACATCGAAAAAGAGCTCAGT"
-"TGGTTATCGTTCAATGAACGCGTGCTTCAGGAAGCGGCGGACAAATCTAACCCGCTGATTGAAAGGATGCGTTTCCTGGG"
-"GATCTATTCCAATAACCTTGATGAGTTCTATAAAGTCCGCTTCGCTGAACTGAAGCGACGCATCATTATTAGCGAAGAAC"
-"AAGGCTCCAACTCTCATTCCCGCCATTTACTGGGCAAAATTCAGTCCCGGGTGCTGAAAGCCGATCAGGAATTCGACGGC"
-"CTCTACAACGAGCTATTGCTGGAGATGGCGCGCAACCAGATCTTCCTGATTAATGAACGCCAGCTCTCCGTCAATCAACA"
-"AAACTGGCTGCGTCATTATTTTAAGCAGTATCTGCGTCAGCACATTACGCCGATTTTAATCAATCCTGACACTGACTTAG"
-"TGCAGTTCCTGAAAGATGATTACACCTATCTGGCGGTGGAAATTATCCGTGGCGATACCATCCGTTACGCGCTTCTGGAG"
-"ATCCCATCAGATAAAGTGCCGCGCTTTGTGAATTTACCGCCAGAAGCGCCGCGTCGACGCAAGCCGATGATTCTTCTGGA"
-"TAACATTCTGCGTTACTGCCTTGATGATATTTTCAAAGGCTTCTTTGATTATGACGCGCTGAATGCCTATTCAATGAAGA"
-"TGACCCGCGATGCCGAATACGATTTAGTGCATGAGATGGAAGCCAGCCTGATGGAGTTGATGTCTTCCAGTCTCAAGCAG"
-"CGTTTAACTGCTGAGCCGGTGCGTTTTGTTTATCAGCGCGATATGCCCAATGCGCTGGTTGAAGTTTTACGCGAAAAACT",
-
-"GGCGGCTTCGGTGCGCTGTGTGCATTGCCGCAAAAATATCGTGAACCCGTGCTGGTTTCCGGCACTGACGGCGTAAATAC"
-"CAAGCTGCGTCTGGCAATGGACTTAAAACGTCACGACACCATTGGTATTGATCTGGTCGCCATGTGCGTTAATGACCTGG"
-"TGGTGCAAGGTGCGGAACCGCTGTTTTTCCTCGACTATTACGCACCGGAAAACTGGATGTTGATACCGCTTCAGCGGTG"
-"ATCAGCGGCATTGCGGAAGGTTGTCTGCAATCGGGCTGTTCTCTGGTGGGTGGCGAAACGGCAGAAATGCCGGGGATGTA"
-"TCACGGTGAAGATTACGATGTCGCGGGTTTCTGCGTGGGCGTGGTAGAAAAATCAGAAATCATCGACGGCAAAGTCA"
-"GCGACGGCGATGTGCTGATTGCACTCGGTTCCAGCGGTCCGCACTCGAACGGTTATTCGCTGGTGCGCAAAATTCTTGAA"
-"GTCAGCGGTTGTGATCCGCAAACCACCGAACTTGATGGTAAGCCATTAGCCGATCATCTGCTGGCACCGACCCGCATTTA"
-"ACATTCCGCGCGTATTGCCAGATAATACCCAGGCAGTGATTGATGAATCTTCCTGGCAGTGGCCGGAAGTGTTCAACTGG"
-"CTGCAAACGGCAGGTAACGTTGAGCGCCATGAAATGTATCGCACCTTCAACTGCGGCGTCGGGATGATTATCCCCTGCC"
-"TGCTCCGGAAGTGGACAAAGCCCTCGCCCTGCTCAATGCCAACGGTGAAAACGCGTGGAAAATCGGTATCATCAAAGCCT"
-"CTGATTCCGAACAACGCGTGGTTATCGAATAATGAATATTGTGTGCTTATTTCCGGCAACGGAAGTAATTTACAGGCAA"
-"TTATTGACGCCTGTAAAACCAACAAAATTAAAGGCACCGTACGGGCAGTTTTCAGCAATAAGGCCGACGCGCGGCCTT"
-"GAACGCGCCCGCCAGGCGGGTATTGCAACGCATACGCTCATCGCCAGCGCGTTTGACAGTCGTGAAGCCTATGACCGGGA"
-"GTTGATTCATGAAATCGACATGTACGCACCCGATGTGGTCGTGCTGGCTGGTTTTATGCGCATTCTCAGCCCGGCGTTTG"
-"TCTCCCACTATGCCGGGCGTTTGCTGAACATTCACCCTTCTCTGCTGCCGAAATATCCCGGATTACACACCCATCGTCAA"
-"GCGCTGGAAAATGGCGATGAAGAGCACGGTACATCGGGCATTTCGTCACCGATGAACTGGACGGTGGCCCGGTTATTTT"
-"ACAGTCGAAAGTCCCGGTATTTGCTGGTGATACGGAAGATGACGTCACCGCCCGCGTGCAAACCCAGGAACACGCCATTT"
-"ATCCTCTGGTGATTAGCTGGTTTGCCGATGGTCGTCTGAAAATGCACGAAAACGCCGCGTGGCTGGATGGTCAACGTCTG"
-"CCGCTGCAGGGCTACGCTGCCGACGAGTAATGCCCCCGTAGTTAAAGCGCCAGCTCTGCCGCTGGCGTTTTTCAATTCAC"
-"CTGTTAATCGCAAGCTCCAGCAGCCCCCCCCCCCCTTTTCTGCATAGTTGGACATCTGCCAATATTGCTCGCCATAATA"
-"TCCATGCAGTGTCCCGTGAATAAAACGGAGTAAAAGTGGTAATGGGTCAGGAAAAGCTATACATAAAAAGAGCTCAGT"
-"TGGTTATCGTTCAATGAACGCGTGCTTCAGGAAGCGGCGGACAAATCTAACCCGCTGATTGAAAGGATGCGTTTCCTGGG"
-"GATCTATTCCAATAACCTTGATGAGTTCTATAAAGTCCGCTTCGCTGAACTGAAGCGACGCATTATTAGCGAAGAAC"
-"AAGGTTCCAACTCTCATTCCCGCCATTTACTGGGAAAATTCAGTCCCGGGTGCTGAAAGCCGATCAGGAATTCGACGGC"
-"CTCTTCAACGAGCTATTGCTGGAGATGGCGCGCAACCAGATCTTCCTGATTAATGAACGCCAGCTCTCCGTCAATCAACA"
-"AAACTGGCTGCGTCATTATTTTAAGCAGTATCTGCGTCAGCACATTACGCCGATTTTAATCAATCCTGACACTGACTTAG"
-"TGCATTTCCTGAAAGATGATTACACCTATCTGGCGGTGGAAATTATCCGTGGCGATACCATCCGTTACGCGCTTCTGGAG"
-"ATCCCATCAGATAAAGTGCCGCGCTTTGTGAATTTACCGCAGAAGCGCCGCGTCGACGCAAGCCGATGATTCTTCTGGA"
-"TAACATTCTGCGTTACTGCCTTGATGATATTTTCAAAGGCTTCTTTGATTATGACGCGCTGAATGCCTATTCAATGAAGA"
-"TGACCCGCGATGCCGAATACGATTTAGTGCATGAGATGGAAGCCAGCCTGATGGAGTTGATGTCTTCCAGTCTCAAGCAG"
-"CGTTTAACTGCTGAGCCGGTGCGTTTTGTTTATCGCGCGATATGCCCAATGCGCTGGTTGAAGTTTTACGCGAAAAACT",
-};
-
-
-static
-int
-my_read(Stream *s, void *buf, int n)
-{
-    return io·read(s, 1, n, buf);
-}
-
-// -----------------------------------------------------------------------
-// Point of entry for testing
-
-error
-test·newick()
-{
-    error err;
-    bio·Tree t;
-    mem·Arena *heap;
-    Stream    *fd[2];
-
-    io·Peeker     rdr;
-    io·Putter     wtr;
-
-    bio·Node **end, **it, **list;
-
-    heap = mem·makearena(mem·sys, nil);
-    rdr  = (io·Peeker){.get = (byte (*)(void *))io·getbyte, .unget  = (error (*)(void *, byte))io·ungetbyte};
-    wtr  = (io·Putter){.put = (error (*)(void *, byte))io·putbyte, .putstr = (int (*)(void *, string))io·putstring};
-
-    fd[0] = io·open("/home/nolln/root/data/test/zika.nwk", "r");
-    fd[1] = io·open("/home/nolln/root/data/test/zika.proc.nwk", "w");
-
-    t.h    = heap;
-    t.heap = (mem·Allocator){ .alloc = (void *(*)(void *, uint, ulong))mem·arenaalloc, .free = nil, };
-
-    if (err = bio·readnewick(rdr, fd[0], &t), err) {
-        errorf("failed to read newick");
-        return 1;
-    }
-    printf("number of children: %d\n", t.root->nchild);
-
-    phylo·ladderize(t.root);
-    
-    list = mem·arenaalloc(heap, t.nleaf, sizeof(**list));
-    phylo·getleafs(t, list);
-    for (it = list, end = list + t.nleaf; it != end; ++it) {
-        printf("Leaf '%s'\n", (*it)->name);
-    }
-
-    bio·Node *path[100];
-    // phylo·diameter(t, path);
-
-    printf("Loaded tree with %d leafs and %d nodes\n", t.nleaf, t.root->nnode);
-    err = bio·writenewick(t, wtr, fd[1]);
-
-    io·flush(fd[1]);
-
-    io·close(fd[0]); 
-    io·close(fd[1]);
-
-    mem·freearena(heap);
-    return 0;
-}
-
-error
-test·fasta()
-{
-    error err;
-    Stream           *fd;
-
-    bio·Seq          seq;
-    bio·FastaReader *rdr;
-
-    clock_t t;
-
-    fd  = io·open("/home/nolln/root/data/test/zika.fa", "r");
-
-    /* Benchmark against Heng */
-#if 0
-    int  n, slen;
-    kseq_t *kseq;
-
-    t    = clock();
-	kseq = kseq_init(fd);
-	while (kseq_read(kseq) >= 0) {
-		++n, slen += kseq->seq.l;
-    }
-    t = clock() - t;
-    printf("heng's code took %f ms to execute\n", 1000.*t/CLOCKS_PER_SEC);
-
-	kseq_destroy(kseq);
-
-    io·seek(fd, 0, seek·set);
-#endif
-
-    rdr = bio·openfasta((io·Reader){.read = (int (*)(void *, int, int, void *))io·read}, fd, mem·sys, nil);
-
-    t = clock();
-    err = 0;
-    while (!err) {
-        err = bio·readfasta(rdr, &seq);
-    }
-    t = clock() - t;
-    printf("nick's code took %f ms to execute\n", 1000.*t/CLOCKS_PER_SEC);
-    bio·closefasta(rdr);
-
-
-    io·close(fd); 
-    return err <= 0 ? 0 : 1;
-}
-
-#define asrdr(x) (int (*)(void *, int, int, void *))(x)
-error
-test·fastq()
-{
-    error err;
-    Stream           *fd;
-
-    bio·Seq          seq;
-    bio·FastqReader *rdr;
-
-    clock_t t;
-
-    fd  = io·open("/home/nolln/root/data/test/eg.fq", "r");
-
-    rdr = bio·openfastq((io·Reader){.read = asrdr(io·read)}, fd, mem·sys, nil);
-
-    t = clock();
-    err = 0;
-    while (!err) {
-        err = bio·readfastq(rdr, &seq);
-    }
-    t = clock() - t;
-    printf("nick's fastq code took %f ms to execute\n", 1000.*t/CLOCKS_PER_SEC);
-    bio·closefastq(rdr);
-
-
-    io·close(fd); 
-    return err <= 0 ? 0 : 1;
-}
-
-error
-test·align()
-{
-    double  f;
-    error   err;
-    int     i, l, n;
-
-    uint64  mem[aln·N][arrlen(SEQ)][aln·L];
-    uint64 *phi[aln·N];
-    int     loc[aln·N][arrlen(SEQ)][aln·L];
-    int    *pos[aln·N];
-
-    for (i = 0; i < arrlen(SEQ); i++) {
-        for (n = 0; n < aln·N; n++) {
-            phi[n] = mem[n][i];
-            pos[n] = loc[n][i];
-        }
-
-        err = aln·sketch(SEQ[i], aln·L, phi, pos);
-    }
-
-    f = 0;
-    for (n = 0; n < aln·N; n++) {
-        aln·sort(arrlen(SEQ), aln·L, (uint64*)mem[n]);
-
-        if (!memcmp(mem[n][0], mem[n][1], sizeof(uint64)*aln·L)) {
-            f += 1.;
-            printf("True : ");
-        } else {
-            printf("False: ");
-        }
-        for (i = 0; i < arrlen(SEQ); i++) {
-            printf("[");
-            for (l = 0; l < aln·L; l++) {
-                printf("%lu,", mem[n][i][l]);
-            }
-            printf("]");
-            if (i == 0) printf(" ~ ");
-        }
-        printf("\n");
-    }
-
-    printf("Fraction hits %f\n", f/aln·N);
-    return err;
-
-}
-
-error
-main()
-{
-    error err;
-
-    if (err = test·newick(), err) {
-        errorf("test fail: newick");
-    }
-
-#if 0
-    if (err = test·fasta(), err) {
-        errorf("test fail: fasta");
-    }
-
-    if (err = test·fastq(), err) {
-        errorf("test fail: fastq");
-    }
-#endif
-}
-
diff --git a/sys/libc/rules.mk b/sys/libc/rules.mk
deleted file mode 100644
index 96d4202..0000000
--- a/sys/libc/rules.mk
+++ /dev/null
@@ -1,23 +0,0 @@
-include share/push.mk
-
-# Iterate through subdirectory tree
-
-# Local sources
-SRCS_$(d) := $(wildcard $(d)/*.c)
-LIBS_$(d) := $(d)/libc_n.a
-BINS_$(d) :=
-
-include share/paths.mk
-
-# Local rules
-# $(LIBS_$(d)) = TGTINCS  :=
-# $(LIBS_$(d)) = TGTLIBS  :=
-
-$(LIBS_$(d)): TCFLAGS := -ffreestanding -fno-builtin -nostdlib
-$(LIBS_$(d)): $(OBJS_$(d))
-	$(ARCHIVE)
-
-$(BINS_$(d)): $(OBJ_DIR)/libn/test.o
-	$(LINK)
-
-include share/pop.mk
diff --git a/sys/libc/stdio.c b/sys/libc/stdio.c
deleted file mode 100644
index 8bbbe9a..0000000
--- a/sys/libc/stdio.c
+++ /dev/null
@@ -1,59 +0,0 @@
-#include <u.h>
-#include <libc.h>
-
-int
-printf(byte* fmt, ...)
-{
-    va_list args;
-    va_start(args, fmt);
-
-    int nw, rem, peek, len;
-    byte *str, c;
-
-    while (*fmt) {
-        rem = INT_MAX - nw;
-
-        if (fmt[0] != '%' || fmt[1] == '%') {
-            if (fmt[0] == '%') fmt++;
-
-            for (peek = 1; fmt[peek] && fmt[peek] != '%'; peek++) {
-                ;
-            }
-            if (rem < peek) return -1;
-            // TODO: Print here.
-            fmt += peek;
-            nw  += peek;
-            continue;
-        }
-
-        str = fmt++;
-
-        switch (*fmt++) {
-        case 'c':
-            c = va_arg(args, int);
-            if (rem < 0) return -1;
-            // TODO: Print here
-            nw++;
-            break;
-
-        case 's':
-            str = va_arg(args, byte*);
-            len = strlen(str);
-            if (rem < len) return -1;
-            // TODO: Print here
-            nw += len;
-            break;
-        default:
-            fmt = str;
-            len = strlen(fmt);
-            if (rem < len) return -1;
-            // TODO: Print here
-            nw += len;
-            fmt += len;
-            break;
-        }
-    }
-
-    va_end(args);
-    return nw;
-}
diff --git a/sys/libc/string.c b/sys/libc/string.c
deleted file mode 100644
index 0e41efa..0000000
--- a/sys/libc/string.c
+++ /dev/null
@@ -1,80 +0,0 @@
-#include <u.h>
-#include <libc.h>
-
-void*
-memcopy(void *dst, void *src, intptr n)
-{
-    byte *e, *s, *d; 
-
-    d = dst;
-    e = d + n;
-    for (s = src ; d != e; ++s, ++d) {
-        *d = *s;
-    }
-
-    return dst;
-}
-
-void*
-memmove(void *dst, void *src, intptr n)
-{
-    byte *e, *s, *d;
-    s = src;
-    d = dst;
-
-    if (d < s) {
-        e = d + n;
-        for (; d != e; ++s, ++d) 
-            *d = *s;
-
-    } else {
-        e = d;
-        d += n;
-        s += n;
-        for (; d != e; --s, --d)
-            d[-1] = s[-1];
-    }
-
-    return dst;
-}
-
-void*
-memset(void *buf, int val, intptr n)
-{
-    byte *b, *e;
-    b = buf;
-    e = b + n;
-    for (; b != e; b++) {
-        *b = (byte)val;
-    }
-
-    return buf;
-}
-
-int
-memcmp(void *lhs, void *rhs, intptr n)
-{
-    byte *bl, *br, *e;
-
-    br = rhs;
-    e  = br + n;
-    for (bl = lhs; br != e; ++bl, ++br) {
-        if (*bl < *br)
-            return -1;
-        else if (*bl > *br) 
-            return 1;
-    }
-
-    return 0;
-}
-
-int
-strlen(byte* s)
-{
-    byte* b;
-    for (b = s; *b; b++) {
-        ;
-    }
-
-    return b - s;
-}
diff --git a/sys/libfmt/buffer.c b/sys/libfmt/buffer.c
deleted file mode 100644
index 0099e72..0000000
--- a/sys/libfmt/buffer.c
+++ /dev/null
@@ -1,60 +0,0 @@
-#include "internal.h"
-
-static int
-flush(fmt·State *io)
-{
-    int  n;
-    char *s;
-
-    void *heap = io->heap;
-    mem·Reallocator mem = io->mem;
-
-    if(!io->buffer.beg)
-        return 0;
-
-    n = 2*(uintptr)io->file;
-    s = io->buffer.beg;
-
-    io->buffer.beg = mem.realloc(heap, io->buffer.beg, n, 1);
-    if(!io->buffer.beg){
-        io->file = io->buffer.cur = io->buffer.end = nil;
-        mem.free(heap, s);
-        return 0;
-    }
-    io->file = (void*)(uintptr)n;
-    io->buffer.cur = io->buffer.beg + (io->buffer.cur - s);
-    io->buffer.end = io->buffer.beg + n - 1;
-
-    return 1;
-}
-
-int
-fmt·make(mem·Reallocator mem, void *heap, fmt·State *io)
-{
-    int n;
-
-    memset(io, 0, sizeof(*io));
-
-    n = 32;
-    io->buffer.beg = io->buffer.cur = mem.alloc(heap, n, 1);
-    if(!io->buffer.beg)
-        return -1;
-    io->buffer.end = io->buffer.beg + n - 1;
-
-    io->flush = flush;
-    io->file  = (void*)(uintptr)n;
-    io->n     = 0;
-
-    fmt·setlocale(io, nil, nil, nil);
-    return 0;
-}
-
-void
-fmt·free(fmt·State *io)
-{
-    void *heap = io->heap;
-    mem·Reallocator mem = io->mem;
-
-    mem.free(heap, io->buffer.beg);
-    io->buffer.beg = io->buffer.cur = io->buffer.end = nil;
-}
diff --git a/sys/libfmt/do.c b/sys/libfmt/do.c
deleted file mode 100644
index eaac0a3..0000000
--- a/sys/libfmt/do.c
+++ /dev/null
@@ -1,730 +0,0 @@
-#include "internal.h"
-#include <stdatomic.h>
-
-#define atomic _Atomic
-#define MaxFmt 128
-#define atomic·load  atomic_load
-#define atomic·store atomic_store
-
-// -----------------------------------------------------------------------
-// globals
-
-/* built in verbs */
-static int fmtflag(fmt·State *);
-static int fmtpercent(fmt·State *);
-static int fmtrune(fmt·State *);
-static int fmtfloat(fmt·State *);
-static int fmtutf8(fmt·State *);
-static int fmtint(fmt·State *);
-static int fmtchar(fmt·State *);
-static int fmtcount(fmt·State *);
-static int fmtstring(fmt·State *);
-static int fmterror(fmt·State *);
-
-static int badfmt(fmt·State *);
-
-static struct
-{
-    atomic int len;
-    Verb verb[MaxFmt];
-} formatter =
-{
-    ATOMIC_VAR_INIT(30),
-    {
-        {' ', fmtflag},
-        {'#', fmtflag},
-        {'%', fmtpercent},
-        {'\'',fmtflag},
-        {'+', fmtflag},
-        {',', fmtflag},
-        {'-', fmtflag},
-        {'C', fmtrune},
-        {'E', fmtfloat},
-        {'F', fmtfloat},
-        {'G', fmtfloat},
-        {'L', fmtflag},
-        {'S', fmtutf8},
-        {'X', fmtint},
-        {'b', fmtint},
-        {'c', fmtchar},
-        {'d', fmtint},
-        {'e', fmtfloat},
-        {'f', fmtfloat},
-        {'g', fmtfloat},
-        {'h', fmtflag},
-        {'i', fmtint},
-        {'l', fmtflag},
-        {'n', fmtcount},
-        {'o', fmtint},
-        {'p', fmtint},
-        {'r', fmterror},
-        {'s', fmtstring},
-        {'U', fmtflag},
-        {'u', fmtint},
-        {'x', fmtint},
-    }
-};
-
-// -----------------------------------------------------------------------
-// internal functions
-
-static Formatter
-format(int c)
-{
-    Verb *v, *e;
-    e = &formatter.verb[atomic·load(&formatter.len)];
-    for(v=e; v > formatter.verb; --v){
-        if(v->c == c)
-            return v->fmt;
-    }
-
-    return badfmt;
-}
-
-static char *
-dispatch(fmt·State *io, char *fmt)
-{
-    rune r;
-    int i, n;
-
-    io->flag  = 0;
-    io->width = io->prec = 0;
-
-    /*
-     * the form of each print verb:
-     * % [flags] verb
-     *   + the verb is a single character
-     *   + each flag is either
-     *      - a single character
-     *      - a decimal numeric string
-     *      - up to 2 decimal strings can be used
-     *      - [width|*].[prec|*]
-     *      - if missing, set to 0
-     *      - if *, grab from varargs
-     */
-    for(;;){
-        fmt += utf8·decode(fmt, &r);
-        io->verb = r;
-        switch(r){
-        case 0:
-            return nil;
-        case '.':
-            io->flag |= fmt·Width|fmt·Prec;
-            continue;
-        case '0':
-            if(!(io->flag & fmt·Width)){
-                io->flag |= fmt·Zero;
-                continue;
-            }
-            /* fallthrough */
-        case '1': case '2': case '3': case '4':
-        case '5': case '6': case '7': case '8': case '9':
-            i = 0;
-            while('0' <= r && r <= '9'){
-                i = 10*i + (r-'0');
-                r = *fmt++;
-            }
-            fmt--;
-        number:
-            if(io->flag & fmt·Width){
-                io->flag |= fmt·Prec;
-                io->prec = i;
-            }else{
-                io->flag |= fmt·Width;
-                io->width = i;
-            }
-            continue;
-        case '*':
-            i = va_arg(io->args, int);
-            if(i < 0){
-                if(io->flag&fmt·Prec){
-                    io->flag &= ~fmt·Prec;
-                    io->prec = 0;
-                    continue;
-                }
-                i = -i;
-                io->flag |= fmt·Left;
-            }
-            goto number;
-        }
-        n = format(r)(io);
-        if(n < 0)
-            return nil;
-        if(!n)
-            return fmt;
-    }
-}
-
-static char *
-flush(fmt·State *io, char *b, int len)
-{
-    io->n += b - io->buffer.cur;
-    io->buffer.cur = b;
-    if(!io->flush || !(*io->flush)(io) || io->buffer.cur + len >= io->buffer.end) {
-        io->buffer.end = io->buffer.cur;
-        return nil;
-    }
-    return io->buffer.cur;
-}
-
-static int
-pad(fmt·State *io, int n)
-{
-    int i;
-    char *b=io->buffer.cur, *e=io->buffer.end;
-
-    for(i=0; i<n; i++){
-        if(b>=e){
-            if(!(b=flush(io, b, 1)))
-                return -1;
-            e = io->buffer.end;
-        }
-        *b++ = ' ';
-    }
-
-    io->n += b - io->buffer.cur;
-    io->buffer.cur = b;
-    return 0;
-}
-
-static int
-copy(fmt·State *io, char *m, int sz, int n)
-{
-    ulong f;
-    rune r;
-    int nc, w, nb;
-    char *b, *e, *me;
-
-    w  = 0;
-    f  = io->flag;
-    me = m + sz;
-
-    if(f&fmt·Width)
-        w = io->width;
-    if(f&fmt·Prec && n > io->prec)
-        n = io->prec;
-    if(!(f&fmt·Left) && pad(io, w-n)<0)
-        return -1;
-
-    b = io->buffer.cur;
-    e = io->buffer.end;
-
-    for(nc=n; nc>0; nc--){
-        r = *(uchar *)m;
-        if(utf8·onebyte(r)){
-            nb=1;
-            m++;
-        }else if((me-m) >= UTFmax || utf8·canfit(m, me-m)){
-            nb=utf8·decode(m, &r);
-            m+=n;
-        }else
-            break;
-
-        if(b+n>e){
-            if(!(b=flush(io, b, nb)))
-                return -1;
-            e = io->buffer.end;
-        }
-        b += utf8·encode(&r, b);
-    }
-
-    io->n += b - io->buffer.cur;
-    io->buffer.cur = b;
-    if(f&fmt·Left && pad(io, w-n)<0)
-        return -1;
-
-    return 0;
-}
-
-static int
-copyrune(fmt·State *io, rune *m, int n)
-{
-    ulong f;
-    rune r, *me;
-    int w, nb;
-    char *b, *e;
-
-    w  = 0;
-    f  = io->flag;
-
-    if(f&fmt·Width)
-        w = io->width;
-    if(f&fmt·Prec && n > io->prec)
-        n = io->prec;
-
-    if(!(f&fmt·Left) && pad(io, w-n)<0)
-        return -1;
-
-    b = io->buffer.cur;
-    e = io->buffer.end;
-
-    for(me=m+n; m < me; m++){
-        r  = *m;
-        nb = utf8·runelen(r);
-        if(b + nb > e){
-            if(!(b=flush(io, b, nb)))
-                return -1;
-            e = io->buffer.end;
-        }
-        b += utf8·encode(&r, b);
-    }
-
-    io->n += b - io->buffer.cur;
-    io->buffer.cur = b;
-    if(f&fmt·Left && pad(io, w-n)<0)
-        return -1;
-
-    return 0;
-}
-
-static int
-copystring(fmt·State *io, char *s)
-{
-    rune r;
-    int i,j;
-
-    if(!s)
-        return copy(io, "<nil>", 5, 5);
-
-    if(io->flag&fmt·Prec){
-        i = 0;
-        for(j=0; j < io->prec && s[i]; j++)
-            i += utf8·decode(s+i, &r);
-
-        return copy(io, s, i, j);
-    }
-    return copy(io, s, strlen(s), utf8·len(s));
-}
-
-static int
-copyutf8(fmt·State *io, rune *s)
-{
-    rune *e;
-    int n,p;
-
-    if(!s)
-        return copy(io, "<nil>", 5, 5);
-
-    if(io->flag & fmt·Prec){
-        p = io->prec;
-        for(n=0; n<p; n++)
-            if(!s[n])
-                break;
-    }else{
-        for(e=s; *e; e++)
-            ;
-        n = e - s;
-    }
-
-    return copyrune(io, s, n);
-}
-
-// -----------------------------------------------------------------------
-// format helpers
-
-static int
-needseperate(int *digits, char **groups)
-{
-    int group;
-
-    (*digits)++;
-    group = *(uchar *)*groups;
-
-    if(group == 0xFF || group == 0x7f || group == 0x00)
-        return 0;
-    if(*digits > group){
-        if((*groups)[1] != 0)
-            (*groups)++;
-        *digits = 1;
-        return 1;
-    }
-    return 0;
-}
-
-// -----------------------------------------------------------------------
-// formatters
-
-static int
-fmtchar(fmt·State *io)
-{
-    char x[1];
-    x[0] = va_arg(io->args, int);
-    io->prec = 1;
-
-    return copy(io, x, 1, 1);
-}
-
-static int
-fmtstring(fmt·State *io)
-{
-    char *s;
-    s = va_arg(io->args, char *);
-    return copystring(io, s);
-}
-
-static int
-fmterror(fmt·State *io)
-{
-    char *s;
-    s = strerror(errno);
-    return copystring(io, s);
-}
-
-static int
-fmtrune(fmt·State *io)
-{
-    rune x[1];
-
-    x[0] = va_arg(io->args, int);
-    return copyrune(io, x, 1);
-}
-
-static int
-fmtutf8(fmt·State *io)
-{
-    rune *s;
-
-    s = va_arg(io->args, rune *);
-    return copyutf8(io, s);
-}
-
-static int
-fmtpercent(fmt·State *io)
-{
-    rune x[1];
-
-    x[0] = io->verb;
-    io->prec = 1;
-    return copyrune(io, x, 1);
-}
-
-static int
-fmtint(fmt·State *io)
-{
-    union{
-        ulong  u;
-        uvlong v;
-    } val;
-    int neg, base, i, n, f, w, isv;
-    int digits, bytes, runes, excess;
-    char *groups, *thousands;
-    char *p, *conv, buf[140];
-
-    f = io->flag;
-    neg   = 0;
-    isv   = 0;
-    val.u = 0;
-
-    switch(io->verb){
-    case 'o': case 'p': case 'u': case 'x': case 'X':
-        f |= fmt·Unsigned;
-        f &= ~(fmt·Sign|fmt·Space);
-    }
-
-    /* set flags */
-    if(io->verb=='p'){
-        val.u = (ulong)va_arg(io->args, void*);
-        io->verb = 'x';
-        f |= fmt·Unsigned;
-    }else if(f&fmt·Vlong){
-        isv=1;
-        if(f&fmt·Unsigned)
-            val.v = va_arg(io->args, uvlong);
-        else
-            val.v = va_arg(io->args, vlong);
-    }else if(f&fmt·Long){
-        if(f&fmt·Unsigned)
-            val.u = va_arg(io->args, ulong);
-        else
-            val.u = va_arg(io->args, long);
-    }else if(f&fmt·Byte){
-        if(f&fmt·Unsigned)
-            val.u = (uchar)va_arg(io->args, int);
-        else
-            val.u = (char)va_arg(io->args, int);
-    }else if(f&fmt·Short){
-        if(f&fmt·Unsigned)
-            val.u = (ushort)va_arg(io->args, int);
-        else
-            val.u = (short)va_arg(io->args, int);
-    }else{
-        if(f&fmt·Unsigned)
-            val.u = va_arg(io->args, uint);
-        else
-            val.u = va_arg(io->args, int);
-    }
-
-    conv = "0123456789abcdef";
-    groups = "\4";
-    thousands = io->thousands;
-    /* get base */
-    switch(io->verb){
-    case 'd': case 'i': case 'u':
-        base = 10;
-        groups = io->groups;
-        break;
-    case 'X':
-        conv = "0123456789ABCDEF";
-        /*fallthrough*/
-    case 'x':
-        base = 16;
-        thousands = ":";
-        break;
-    case 'b':
-        base = 2;
-        thousands = ":";
-        break;
-    case 'o':
-        base = 8;
-        break;
-    default:
-        return -1;
-    }
-
-    /* check for negativity */
-    if(!(f&fmt·Unsigned)){
-        if(isv && (vlong)val.v < 0){
-            val.v = -(vlong)val.v;
-            neg = 1;
-        }else if(!isv && (long)val.u < 0){
-            val.u = -(long)val.u;
-            neg = 1;
-        }
-    }
-
-    p = buf + sizeof(buf) - 1;
-    n = 0;
-    digits = 0;
-    excess = 0;
-    runes = utf8·len(thousands);
-    bytes = strlen(thousands);
-
-#define PARSE(VALUE)                                          \
-    while((VALUE)){                                           \
-        i = (VALUE) % base;                                   \
-        (VALUE) /= base;                                      \
-        if((f&fmt·Comma) && n%4 == 3){                        \
-            *p-- = ',';                                       \
-            n++;                                              \
-        }                                                     \
-        if((f&fmt·Apost) && needseperate(&digits, &groups)){  \
-            n += runes;                                       \
-            excess += bytes - runes;                          \
-            p -= bytes;                                       \
-            memmove(p+1, thousands, bytes);                   \
-        }                                                     \
-        *p-- = conv[i];                                       \
-        n++;                                                  \
-    }
-    if(isv)
-        PARSE(val.v)
-    else
-        PARSE(val.u)
-#undef PARSE
-
-    if(!n){
-        if(!(f&fmt·Prec) || io->prec != 0 || (io->verb == 'o' && (f&fmt·Sharp))){
-            *p-- = '0';
-            n = 1;
-            if(f&fmt·Apost)
-                needseperate(&digits,&groups);
-        }
-
-        if(io->verb == 'x' || io->verb == 'X')
-            f &= ~fmt·Sharp;
-    }
-
-    for(w = io->prec; n < w && p > buf+3; n++){
-        if((f&fmt·Apost) && needseperate(&digits, &groups)){
-            n += runes;
-            excess += bytes - runes;
-            p -= bytes;
-            memmove(p+1, thousands, bytes);
-        }
-        *p-- = '0';
-    }
-
-    if(neg || (f&(fmt·Sign|fmt·Space)))
-        n++;
-
-    if(f&fmt·Sharp){
-        if(base==16)
-            n += 2;
-        else if(base == 8){
-            if(p[1] == '0')
-                f &= ~fmt·Sharp;
-            else
-                n++;
-        }
-    }
-
-    if(f&fmt·Zero && !(f & (fmt·Left|fmt·Prec))){
-        w = 0;
-        if(f & fmt·Width)
-            w = io->width;
-        for(; n < w && p > buf+3; n++){
-            if((f & fmt·Apost) && needseperate(&digits, &groups)){
-                n += runes;
-                excess += bytes - runes;
-                p -= bytes;
-                memmove(p+1, thousands, bytes);
-            }
-            *p-- = '0';
-        }
-        io->flag &= ~fmt·Width;
-    }
-
-    if(f&fmt·Sharp){
-        if(base==16)
-            *p-- = io->verb;
-        if(base==16 || base == 8)
-            *p-- = '0';
-    }
-
-    if(neg)
-        *p-- = '-';
-    else if(f & fmt·Sign)
-        *p-- = '+';
-    else if (f & fmt·Space)
-        *p-- = ' ';
-
-    io->flag &= ~fmt·Prec;
-    return copy(io, p+1, n+excess, n);
-}
-
-static int
-fmtcount(fmt·State *io)
-{
-    void *p;
-    ulong f;
-
-    f = io->flag;
-    p = va_arg(io->args, void*);
-
-    if(f&fmt·Vlong)
-        *(vlong*)p = io->n;
-    else if(f&fmt·Long)
-        *(long*)p = io->n;
-    else if(f&fmt·Byte)
-        *(char*)p = io->n;
-    else if(f&fmt·Short)
-        *(short*)p = io->n;
-    else
-        *(int*)p = io->n;
-
-    return 0;
-}
-
-static int
-fmtflag(fmt·State *io)
-{
-    switch(io->verb){
-    case ',':  io->flag |= fmt·Comma;    break;
-    case '-':  io->flag |= fmt·Left;     break;
-    case '+':  io->flag |= fmt·Sign;     break;
-    case '#':  io->flag |= fmt·Sharp;    break;
-    case '\'': io->flag |= fmt·Apost;    break;
-    case ' ':  io->flag |= fmt·Space;    break;
-    case 'u':  io->flag |= fmt·Unsigned; break;
-    case 'L':  io->flag |= fmt·Ldouble;  break;
-    case 'h':
-        if(io->flag&fmt·Short)
-            io->flag |= fmt·Byte;
-        io->flag |= fmt·Short;
-        break;
-    case 'l':
-        if(io->flag&fmt·Long)
-            io->flag |= fmt·Vlong;
-        io->flag |= fmt·Long;
-        break;
-    }
-    return 1;
-}
-
-static int
-badfmt(fmt·State *io)
-{
-    int n;
-    char x[UTFmax+2];
-
-    x[0] = '%';
-    n = 1 + utf8·encode(&io->verb, x+1);
-    x[n++] = '%';
-    io->prec = n;
-    copy(io, x, n, n);
-
-    return 0;
-}
-
-#include "float.c"
-
-// -----------------------------------------------------------------------
-// exports
-
-int
-fmt·do(fmt·State *io, char *fmt)
-{
-    rune r;
-    int  c, n;
-    char *b, *e;
-
-    for(;;){
-        b = io->buffer.cur;
-        e = io->buffer.end;
-        while((c = *(uchar *)fmt) && c != '%'){
-            if(utf8·onebyte(c)){
-                if(b >= e){
-                    if(!(b=flush(io, b, 1)))
-                        return -1;
-                    e = io->buffer.end;
-                }
-                *b++ = *fmt++;
-            }else{
-                n = utf8·decode(fmt, &r);
-                if(b + n > e){
-                    if(!(b=flush(io, b, n)))
-                        return -1;
-                    e = io->buffer.end;
-                }
-                while(n--)
-                    *b++ = *fmt++;
-            }
-        }
-        fmt++;
-        io->n += b - io->buffer.cur;
-        io->buffer.cur = b;
-        if(!c) /* we hit our nul terminator */
-            return io->n - n;
-        io->buffer.end = e;
-
-        if(!(fmt=dispatch(io, fmt)))
-            return -1;
-    }
-}
-
-int
-fmt·install(int verb, Formatter func)
-{
-    Verb *v;
-    int i, ret;
-
-lock:
-    if(verb <= 0 || verb >= 65536){
-        ret = -1;
-        goto unlock;
-    }
-    if(!func)
-        func = badfmt;
-
-    if((i = atomic·load(&formatter.len))==MaxFmt)
-        return -1;
-
-    v = &formatter.verb[i];
-    v->c   = verb;
-    v->fmt = func;
-
-    atomic·store(&formatter.len, i+1);
-    ret = 0;
-unlock:
-    return ret;
-}
diff --git a/sys/libfmt/esprint.c b/sys/libfmt/esprint.c
deleted file mode 100644
index 6d97340..0000000
--- a/sys/libfmt/esprint.c
+++ /dev/null
@@ -1,14 +0,0 @@
-#include "internal.h"
-
-char *
-fmt·esprint(char *buf, char *end, char *fmt, ...)
-{
-    char *p;
-    va_list args;
-
-    va_start(args, fmt);
-    p = fmt·vesprint(buf, end, fmt, args);
-    va_end(args);
-
-    return p;
-}
diff --git a/sys/libfmt/float.c b/sys/libfmt/float.c
deleted file mode 100644
index 63ea80f..0000000
--- a/sys/libfmt/float.c
+++ /dev/null
@@ -1,1077 +0,0 @@
-#define FDIGIT  30
-#define FDEFLT  6
-#define NSIGNIF 17
-
-static uvlong uvnan    = ((uvlong)0x7FF00000<<32)|0x00000001;
-static uvlong uvinf    = ((uvlong)0x7FF00000<<32)|0x00000000;
-static uvlong uvneginf = ((uvlong)0xFFF00000<<32)|0x00000000;
-
-static char *special[] = { "NaN", "NaN", "+Inf", "+Inf", "-Inf", "-Inf" };
-
-static int
-isNaN(double val)
-{
-    union{
-        uvlong i;
-        double f;
-    }x;
-
-    x.f = val;
-    return (x.i&uvinf) == uvinf && (x.i&~uvneginf) != 0;
-}
-
-static double
-NaN(void)
-{
-    union{
-        uvlong i;
-        double f;
-    }x;
-    x.i = uvnan;
-    return x.f;
-}
-
-static int
-isInf(double val, int sign)
-{
-    union{
-        uvlong i;
-        double f;
-    }x;
-
-    x.f = val;
-    if(sign == 0)
-        return x.i == uvinf || x.i == uvneginf;
-    else if(sign == 1)
-        return x.i == uvinf;
-    else
-        return x.i == uvneginf;
-}
-
-static double pows10[] =
-{
-      1e0,   1e1,   1e2,   1e3,   1e4,   1e5,   1e6,   1e7,   1e8,   1e9,
-     1e10,  1e11,  1e12,  1e13,  1e14,  1e15,  1e16,  1e17,  1e18,  1e19,
-     1e20,  1e21,  1e22,  1e23,  1e24,  1e25,  1e26,  1e27,  1e28,  1e29,
-     1e30,  1e31,  1e32,  1e33,  1e34,  1e35,  1e36,  1e37,  1e38,  1e39,
-     1e40,  1e41,  1e42,  1e43,  1e44,  1e45,  1e46,  1e47,  1e48,  1e49,
-     1e50,  1e51,  1e52,  1e53,  1e54,  1e55,  1e56,  1e57,  1e58,  1e59,
-     1e60,  1e61,  1e62,  1e63,  1e64,  1e65,  1e66,  1e67,  1e68,  1e69,
-     1e70,  1e71,  1e72,  1e73,  1e74,  1e75,  1e76,  1e77,  1e78,  1e79,
-     1e80,  1e81,  1e82,  1e83,  1e84,  1e85,  1e86,  1e87,  1e88,  1e89,
-     1e90,  1e91,  1e92,  1e93,  1e94,  1e95,  1e96,  1e97,  1e98,  1e99,
-    1e100, 1e101, 1e102, 1e103, 1e104, 1e105, 1e106, 1e107, 1e108, 1e109,
-    1e110, 1e111, 1e112, 1e113, 1e114, 1e115, 1e116, 1e117, 1e118, 1e119,
-    1e120, 1e121, 1e122, 1e123, 1e124, 1e125, 1e126, 1e127, 1e128, 1e129,
-    1e130, 1e131, 1e132, 1e133, 1e134, 1e135, 1e136, 1e137, 1e138, 1e139,
-    1e140, 1e141, 1e142, 1e143, 1e144, 1e145, 1e146, 1e147, 1e148, 1e149,
-    1e150, 1e151, 1e152, 1e153, 1e154, 1e155, 1e156, 1e157, 1e158, 1e159,
-};
-
-static double
-fpow10(int n)
-{
-    double d;
-    int neg;
-
-    neg = 0;
-    if(n < 0){
-        neg = 1;
-        n = -n;
-    }
-
-    if(n<arrlen(pows10))
-        d = pows10[n];
-    else{
-        d = pows10[arrlen(pows10)-1];
-        for(;;){
-            n -= arrlen(pows10)- 1;
-            if(n < arrlen(pows10)){
-                d *= pows10[n];
-                break;
-            }
-            d *= pows10[arrlen(pows10)- 1];
-        }
-    }
-    if(neg)
-        return 1./d;
-    return d;
-}
-
-static int
-add1(char *a, int n)
-{
-    int c;
-    char *b;
-
-    if(n < 0 || n > NSIGNIF)
-        return 0;
-
-    for(b = a+n-1; b >= a; b--){
-        c = *b + 1;
-        if(c <= '9'){
-            *b = c;
-            return 0;
-        }
-        *b = '0';
-    }
-    /*
-     * need to overflow adding digit.
-     * shift number down and insert 1 at beginning.
-     * decimal is known to be 0s or we wouldn't
-     * have gotten this far.  (e.g., 99999+1 => 00000)
-     */
-    a[0] = '1';
-    return 1;
-}
-
-static int
-sub1(char *a, int n)
-{
-    int c;
-    char *b;
-
-    if(n < 0 || n > NSIGNIF)
-        return 0;
-    for(b = a+n-1; b >= a; b--){
-        c = *b - 1;
-        if(c >= '0'){
-            if(c == '0' && b == a){
-                /*
-                 * just zeroed the top digit; shift everyone up.
-                 * decimal is known to be 9s or we wouldn't
-                 * have gotten this far.  (e.g., 10000-1 => 09999)
-                 */
-                *b = '9';
-                return 1;
-            }
-            *b = c;
-            return 0;
-        }
-        *b = '9';
-    }
-    /*
-     * can't get here.  the number a is always normalized
-     * so that it has a nonzero first digit.
-     */
-    abort();
-}
-
-// -----------------------------------------------------------------------
-// strtod
-
-#define Nbits 28
-#define Nmant 53
-#define Prec ((Nmant+Nbits+1)/Nbits)
-
-#define Sigbit (1<<(Prec*Nbits-Nmant)) /* first significant bit of Prec-th word */
-#define Ndig 1500
-#define One  (ulong)(1<<Nbits)
-#define Half (ulong)(One>>1)
-#define Maxe 310
-
-#define Fsign   (1<<0)  /* found -  */
-#define Fesign  (1<<1)  /* found e- */
-#define Fdpoint (1<<2)  /* found .  */
-
-#define S0  0 /* _  _S0 +S1 #S2 .S3 */
-#define S1  1 /* _+  #S2 .S3 */
-#define S2  2 /* _+#  #S2 .S4 eS5 */
-#define S3  3 /* _+.  #S4 */
-#define S4  4 /* _+#.# #S4 eS5 */
-#define S5  5 /* _+#.#e +S6 #S7 */
-#define S6  6 /* _+#.#e+ #S7 */
-#define S7  7 /* _+#.#e+# #S7 */
-
-typedef struct Tab Tab;
-struct Tab
-{
-    int bp;
-    int siz;
-    char *cmp;
-};
-
-static ulong
-umuldiv(ulong a, ulong b, ulong c)
-{
-    double d;
-
-    d = ((double)a * (double)b) / (double)c;
-    if(d >= 4294967295.)
-        d = 4294967295.;
-    return (ulong)d;
-}
-
-static void
-frnorm(ulong *f)
-{
-    int i, c;
-
-    c = 0;
-    for(i=Prec-1; i>0; i--) {
-        f[i] += c;
-        c = f[i] >> Nbits;
-        f[i] &= One-1;
-    }
-    f[0] += c;
-}
-
-static int
-fpcmp(char *a, ulong* f)
-{
-    ulong tf[Prec];
-    int i, d, c;
-
-    for(i=0; i<Prec; i++)
-        tf[i] = f[i];
-
-    for(;;) {
-        /* tf *= 10 */
-        for(i=0; i<Prec; i++)
-            tf[i] = tf[i]*10;
-        frnorm(tf);
-        d = (tf[0] >> Nbits) + '0';
-        tf[0] &= One-1;
-
-        /* compare next digit */
-        c = *a;
-        if(c == 0) {
-            if('0' < d)
-                return -1;
-            if(tf[0] != 0)
-                goto cont;
-            for(i=1; i<Prec; i++)
-                if(tf[i] != 0)
-                    goto cont;
-            return 0;
-        }
-        if(c > d)
-            return +1;
-        if(c < d)
-            return -1;
-        a++;
-    cont:;
-}
-}
-
-static void
-divby(char *a, int *na, int b)
-{
-    int n, c;
-    char *p;
-
-    p = a;
-    n = 0;
-    while(n>>b == 0){
-        c = *a++;
-        if(c == 0) {
-            while(n) {
-                c = n*10;
-                if(c>>b)
-                    break;
-                n = c;
-            }
-            goto xx;
-        }
-        n = n*10 + c-'0';
-        (*na)--;
-    }
-    for(;;){
-        c = n>>b;
-        n -= c<<b;
-        *p++ = c + '0';
-        c = *a++;
-        if(c == 0)
-            break;
-        n = n*10 + c-'0';
-    }
-    (*na)++;
-    xx:
-    while(n){
-        n = n*10;
-        c = n>>b;
-        n -= c<<b;
-        *p++ = c + '0';
-        (*na)++;
-    }
-    *p = 0;
-}
-
-static Tab tab1[] =
-{
-     1,  0, "",
-     3,  1, "7",
-     6,  2, "63",
-     9,  3, "511",
-    13,  4, "8191",
-    16,  5, "65535",
-    19,  6, "524287",
-    23,  7, "8388607",
-    26,  8, "67108863",
-    27,  9, "134217727",
-};
-
-static void
-divascii(char *a, int *na, int *dp, int *bp)
-{
-    int b, d;
-    Tab *t;
-
-    d = *dp;
-    if(d >= (int)(arrlen(tab1)))
-        d = (int)(arrlen(tab1))-1;
-    t = tab1 + d;
-    b = t->bp;
-    if(memcmp(a, t->cmp, t->siz) > 0)
-        d--;
-    *dp -= d;
-    *bp += b;
-    divby(a, na, b);
-}
-
-static void
-mulby(char *a, char *p, char *q, int b)
-{
-    int n, c;
-
-    n = 0;
-    *p = 0;
-    for(;;) {
-        q--;
-        if(q < a)
-            break;
-        c = *q - '0';
-        c = (c<<b) + n;
-        n = c/10;
-        c -= n*10;
-        p--;
-        *p = c + '0';
-    }
-    while(n) {
-        c = n;
-        n = c/10;
-        c -= n*10;
-        p--;
-        *p = c + '0';
-    }
-}
-
-static Tab tab2[] =
-{
-     1,  1, "",				/* dp = 0-0 */
-     3,  3, "125",
-     6,  5, "15625",
-     9,  7, "1953125",
-    13, 10, "1220703125",
-    16, 12, "152587890625",
-    19, 14, "19073486328125",
-    23, 17, "11920928955078125",
-    26, 19, "1490116119384765625",
-    27, 19, "7450580596923828125",		/* dp 8-9 */
-};
-
-static void
-mulascii(char *a, int *na, int *dp, int *bp)
-{
-    char *p;
-    int d, b;
-    Tab *t;
-
-    d = -*dp;
-    if(d >= (int)(arrlen(tab2)))
-        d = (int)(arrlen(tab2))-1;
-    t = tab2 + d;
-    b = t->bp;
-    if(memcmp(a, t->cmp, t->siz) < 0)
-        d--;
-    p = a + *na;
-    *bp -= b;
-    *dp += d;
-    *na += d;
-    mulby(a, p+d, p, b);
-}
-
-static int
-cmp(char *a, char *b)
-{
-    int c1, c2;
-
-    while((c1 = *b++) != '\0') {
-        c2 = *a++;
-        if(isupper(c2))
-            c2 = tolower(c2);
-        if(c1 != c2)
-            return 1;
-    }
-    return 0;
-}
-
-double
-fmtstrtod(char *as, char **aas)
-{
-    int na, ex, dp, bp, c, i, flag, state;
-    ulong low[Prec], hig[Prec], mid[Prec];
-    double d;
-    char *s, a[Ndig];
-
-    flag = 0;      /* Fsign, Fesign, Fdpoint */
-    na = 0;        /* number of digits of a[] */
-    dp = 0;        /* na of decimal point */
-    ex = 0;        /* exonent */
-
-    state = S0;
-    for(s=as;;s++){
-        c = *s;
-        if('0' <= c && c <= '9'){
-            switch(state){
-            case S0: case S1: case S2:
-                state = S2;
-                break;
-            case S3: case S4:
-                state = S4;
-                break;
-            case S5: case S6: case S7:
-                state = S7;
-                ex = ex*10 + (c-'0');
-                continue;
-            }
-
-            if(na == 0 && c == '0'){
-                dp--;
-                continue;
-            }
-            if(na < Ndig-50)
-                a[na++] = c;
-            continue;
-        }
-        switch(c){
-        case '\t': case '\n': case '\v': case '\f': case '\r': case ' ':
-            if(state == S0)
-                continue;
-            break;
-        case '-':
-            if(state == S0)
-                flag |= Fsign;
-            else
-                flag |= Fesign;
-        case '+':
-            if(state == S0)
-                state = S1;
-            else
-            if(state == S5)
-                state = S6;
-            else
-                break;    /* syntax */
-            continue;
-        case '.':
-            flag |= Fdpoint;
-            dp = na;
-            if(state == S0 || state == S1){
-                state = S3;
-                continue;
-            }
-            if(state == S2){
-                state = S4;
-                continue;
-            }
-            break;
-        case 'e': case 'E':
-            if(state == S2 || state == S4){
-                state = S5;
-                continue;
-            }
-            break;
-        }
-        break;
-    }
-
-    /* clean up return char-pointer */
-    switch(state) {
-    case S0:
-        if(cmp(s, "nan") == 0){
-            if(aas != nil)
-                *aas = s+3;
-            goto retnan;
-        }
-    case S1:
-        if(cmp(s, "infinity") == 0){
-            if(aas != nil)
-                *aas = s+8;
-            goto retinf;
-        }
-        if(cmp(s, "inf") == 0){
-            if(aas != nil)
-                *aas = s+3;
-            goto retinf;
-        }
-    case S3:
-        if(aas != nil)
-            *aas = as;
-        goto ret0;   /* no digits found */
-    case S6:
-        s--;        /* back over +- */
-    case S5:
-        s--;        /* back over e */
-        break;
-    }
-    if(aas != nil)
-        *aas = s;
-
-    if(flag & Fdpoint)
-    while(na > 0 && a[na-1] == '0')
-        na--;
-    if(na == 0)
-        goto ret0;    /* zero */
-    a[na] = 0;
-    if(!(flag & Fdpoint))
-        dp = na;
-    if(flag & Fesign)
-        ex = -ex;
-    dp += ex;
-    if(dp < -Maxe){
-        errno = ERANGE;
-        goto ret0;      /* underflow by exp */
-    } else
-    if(dp > +Maxe)
-        goto retinf;    /* overflow by exp */
-
-    /*
-     * normalize the decimal ascii number
-     * to range .[5-9][0-9]* e0
-     */
-    bp = 0;        /* binary exponent */
-    while(dp > 0)
-        divascii(a, &na, &dp, &bp);
-    while(dp < 0 || a[0] < '5')
-        mulascii(a, &na, &dp, &bp);
-
-    /* close approx by naive conversion */
-    mid[0] = 0;
-    mid[1] = 1;
-    for(i=0; (c=a[i]) != '\0'; i++) {
-        mid[0] = mid[0]*10 + (c-'0');
-        mid[1] = mid[1]*10;
-        if(i >= 8)
-            break;
-    }
-    low[0] = umuldiv(mid[0], One, mid[1]);
-    hig[0] = umuldiv(mid[0]+1, One, mid[1]);
-    for(i=1; i<Prec; i++) {
-        low[i] = 0;
-        hig[i] = One-1;
-    }
-
-    /* binary search for closest mantissa */
-    for(;;) {
-        /* mid = (hig + low) / 2 */
-        c = 0;
-        for(i=0; i<Prec; i++) {
-            mid[i] = hig[i] + low[i];
-            if(c)
-                mid[i] += One;
-            c = mid[i] & 1;
-            mid[i] >>= 1;
-        }
-        frnorm(mid);
-
-        /* compare */
-        c = fpcmp(a, mid);
-        if(c > 0) {
-            c = 1;
-            for(i=0; i<Prec; i++)
-                if(low[i] != mid[i]) {
-                    c = 0;
-                    low[i] = mid[i];
-                }
-            if(c)
-                break;    /* between mid and hig */
-            continue;
-        }
-        if(c < 0) {
-            for(i=0; i<Prec; i++)
-                hig[i] = mid[i];
-            continue;
-        }
-
-        /* only hard part is if even/odd roundings wants to go up */
-        c = mid[Prec-1] & (Sigbit-1);
-        if(c == Sigbit/2 && (mid[Prec-1]&Sigbit) == 0)
-            mid[Prec-1] -= c;
-        break;    /* exactly mid */
-    }
-
-    /* normal rounding applies */
-    c = mid[Prec-1] & (Sigbit-1);
-    mid[Prec-1] -= c;
-    if(c >= Sigbit/2) {
-        mid[Prec-1] += Sigbit;
-        frnorm(mid);
-    }
-    goto out;
-
-ret0:
-    return 0;
-
-retnan:
-    return NaN();
-
-retinf:
-    /* Unix strtod requires these.  Plan 9 would return Inf(0) or Inf(-1). */
-    errno = ERANGE;
-    if(flag & Fsign)
-        return -HUGE_VAL;
-    return HUGE_VAL;
-
-out:
-    d = 0;
-    for(i=0; i<Prec; i++)
-        d = d*One + mid[i];
-    if(flag & Fsign)
-        d = -d;
-    d = ldexp(d, bp - Prec*Nbits);
-    if(d == 0)  /* underflow */
-        errno = ERANGE;
-
-    return d;
-}
-
-#undef Nbits
-#undef Nmant
-#undef Prec
-
-#undef Sigbit
-#undef Ndig
-#undef One
-#undef Half
-#undef Maxe
-
-#undef Fsign
-#undef Fesign
-#undef Fdpoint
-
-#undef S0
-#undef S1
-#undef S2
-#undef S3
-#undef S4
-#undef S5
-#undef S6
-#undef S7
-
-static void
-fmtexp(char *p, int e, int ucase)
-{
-    int i;
-    char se[9];
-
-    *p++ = ucase ? 'E' : 'e';
-    if(e < 0){
-        *p++ = '-';
-        e = -e;
-    }else
-        *p++ = '+';
-
-    i = 0;
-    while(e){
-        se[i++] = e % 10 + '0';
-        e /= 10;
-    }
-
-    while(i < 2)
-        se[i++] = '0';
-    while(i > 0)
-        *p++ = se[--i];
-
-    *p++ = '\0';
-}
-
-/*
- * compute decimal integer m, exp such that:
- * f = m*10^exp
- * m is as short as possible with losing exactness
- * assumes special cases (NaN, +Inf, -Inf) have been handled.
- */
-static void
-dtoa(double f, char *s, int *exp, int *neg, int *len)
-{
-    int c, d, e2, e, ee, i, ndigit, oerrno;
-    char buf[NSIGNIF+10];
-    double g;
-
-    oerrno = errno;
-
-    *neg = 0;
-    if(f < 0){
-        f = -f;
-        *neg = 1;
-    }
-
-    if(f == 0){
-        *exp = 0;
-        s[0] = '0';
-        s[1] = 0;
-        *len = 1;
-        return;
-    }
-
-    frexp(f, &e2);
-    e = (int)(e2 * .301029995664);
-    g = f * fpow10(-e);
-    while(g < 1) {
-        e--;
-        g = f * fpow10(-e);
-    }
-    while(g >= 10){
-        e++;
-        g = f * fpow10(-e);
-    }
-
-    /* convert nsignif digits as a first approximation */
-    for(i=0; i<NSIGNIF; i++){
-        d = (int)g;
-        s[i] = d+'0';
-        g = (g-d)*10;
-    }
-    s[i] = 0;
-
-    e -= NSIGNIF-1;
-    fmtexp(s+NSIGNIF, e, 0);
-
-    for(i=0; i<10; i++) {
-        g=fmtstrtod(s, nil);
-        if(f > g) {
-            if(add1(s, NSIGNIF)){
-                /* gained a digit */
-                e--;
-                fmtexp(s+NSIGNIF, e, 0);
-            }
-            continue;
-        }
-        if(f < g){
-            if(sub1(s, NSIGNIF)){
-                /* lost a digit */
-                e++;
-                fmtexp(s+NSIGNIF, e, 0);
-            }
-            continue;
-        }
-        break;
-    }
-
-    /*
-     * bump last few digits down to 0 as we can.
-     */
-    for(i=NSIGNIF-1; i>=NSIGNIF-3; i--){
-        c = s[i];
-        if(c != '0'){
-            s[i] = '0';
-            g=fmtstrtod(s, nil);
-            if(g != f){
-                s[i] = c;
-                break;
-            }
-        }
-    }
-
-    /*
-     * remove trailing zeros.
-     */
-    ndigit = NSIGNIF;
-    while(ndigit > 1 && s[ndigit-1] == '0'){
-        e++;
-        --ndigit;
-    }
-    s[ndigit] = 0;
-    *exp = e;
-    *len = ndigit;
-
-    errno = oerrno;
-}
-
-
-static int
-fmtfloat(fmt·State *io)
-{
-    char buf[NSIGNIF+10], *dot, *digits, *p, *end, suf[10], *cur;
-    double val;
-    int c, verb, ndot, e, exp, f, ndigits, neg, newndigits;
-    int npad, pt, prec, realverb, sign, nsuf, ucase, n, z1, z2;
-
-    if(io->flag&fmt·Long)
-        val = va_arg(io->args, long double);
-    else
-        val = va_arg(io->args, double);
-
-    /* extract formatting flags */
-    f = io->flag;
-    io->flag = 0;
-    prec = FDEFLT;
-    if(f & fmt·Prec)
-        prec = io->prec;
-
-    verb = io->verb;
-    ucase = 0;
-    switch(verb) {
-    case 'A':
-    case 'E':
-    case 'F':
-    case 'G':
-        verb += 'a'-'A';
-        ucase = 1;
-        break;
-    }
-
-    /* pick off special numbers. */
-    if(isNaN(val)) {
-        end = special[0+ucase];
-    special:
-        io->flag = f & (fmt·Width|fmt·Left);
-        return copy(io, end, strlen(end), strlen(end));
-    }
-    if(isInf(val, 1)) {
-        end = special[2+ucase];
-        goto special;
-    }
-    if(isInf(val, -1)) {
-        end = special[4+ucase];
-        goto special;
-    }
-
-    /* get exact representation. */
-    digits = buf;
-    dtoa(val, digits, &exp, &neg, &ndigits);
-
-    /* get locale's decimal point. */
-    dot = io->decimal;
-    if(dot == nil)
-        dot = ".";
-    ndot = utf8·len(dot);
-
-    /*
-     * now the formatting fun begins.
-     * compute parameters for actual fmt:
-     *
-     *    pad: number of spaces to insert before/after field.
-     *    z1: number of zeros to insert before digits
-     *    z2: number of zeros to insert after digits
-     *    point: number of digits to print before decimal point
-     *    ndigits: number of digits to use from digits[]
-     *    suf: trailing suffix, like "e-5"
-     */
-    realverb = verb;
-    switch(verb){
-    case 'g':
-        /* convert to at most prec significant digits. (prec=0 means 1) */
-        if(prec == 0)
-            prec = 1;
-        if(ndigits > prec) {
-            if(digits[prec] >= '5' && add1(digits, prec))
-                exp++;
-            exp += ndigits-prec;
-            ndigits = prec;
-        }
-
-        /*
-         * extra rules for %g (implemented below):
-         *    trailing zeros removed after decimal unless FmtSharp.
-         *    decimal point only if digit follows.
-         */
-
-        /* fall through to %e */
-    default:
-    case 'e':
-        /* one significant digit before decimal, no leading zeros. */
-        pt = 1;
-        z1 = 0;
-
-        /*
-         * decimal point is after ndigits digits right now.
-         * slide to be after first.
-         */
-        e  = exp + (ndigits-1);
-
-        /* if this is %g, check exponent and convert prec */
-        if(realverb == 'g') {
-            if(-4 <= e && e < prec)
-                goto casef;
-            prec--;    /* one digit before decimal; rest after */
-        }
-
-        /* compute trailing zero padding or truncate digits. */
-        if(1+prec >= ndigits)
-            z2 = 1+prec - ndigits;
-        else {
-            /* truncate digits */
-            assert(realverb != 'g');
-            newndigits = 1+prec;
-            if(digits[newndigits] >= '5' && add1(digits, newndigits)) {
-                /* had 999e4, now have 100e5 */
-                e++;
-            }
-            ndigits = newndigits;
-            z2 = 0;
-        }
-        fmtexp(suf, e, ucase);
-        nsuf = strlen(suf);
-        break;
-
-    casef:
-    case 'f':
-        /* determine where digits go with respect to decimal point */
-        if(ndigits+exp > 0) {
-            pt = ndigits+exp;
-            z1 = 0;
-        } else {
-            pt = 1;
-            z1 = 1 + -(ndigits+exp);
-        }
-
-        /*
-         * %g specifies prec = number of significant digits
-         * convert to number of digits after decimal point
-         */
-        if(realverb == 'g')
-            prec += z1 - pt;
-
-        /* compute trailing zero padding or truncate digits. */
-        if(pt+prec >= z1+ndigits)
-            z2 = pt+prec - (z1+ndigits);
-        else{
-            /* truncate digits */
-            assert(realverb != 'g');
-            newndigits = pt+prec - z1;
-            if(newndigits < 0){
-                z1 += newndigits;
-                newndigits = 0;
-            }else if(newndigits == 0){
-                /* perhaps round up */
-                if(digits[0] >= '5'){
-                    digits[0] = '1';
-                    newndigits = 1;
-                    goto newdigit;
-                }
-            }else if(digits[newndigits] >= '5' && add1(digits, newndigits)){
-                /* digits was 999, is now 100; make it 1000 */
-                digits[newndigits++] = '0';
-            newdigit:
-                /* account for new digit */
-                if(z1)   /* 0.099 => 0.100 or 0.99 => 1.00*/
-                    z1--;
-                else    /* 9.99 => 10.00 */
-                    pt++;
-            }
-            z2 = 0;
-            ndigits = newndigits;
-        }
-        nsuf = 0;
-        break;
-    }
-
-    /*
-     * if %g is given without FmtSharp, remove trailing zeros.
-     * must do after truncation, so that e.g. print %.3g 1.001
-     * produces 1, not 1.00.  sorry, but them's the rules.
-     */
-    if(realverb == 'g' && !(f & fmt·Sharp)) {
-        if(z1+ndigits+z2 >= pt) {
-            if(z1+ndigits < pt)
-                z2 = pt - (z1+ndigits);
-            else{
-                z2 = 0;
-                while(z1+ndigits > pt && digits[ndigits-1] == '0')
-                    ndigits--;
-            }
-        }
-    }
-
-    /*
-     * compute width of all digits and decimal point and suffix if any
-     */
-    n = z1+ndigits+z2;
-    if(n > pt)
-        n += ndot;
-    else if(n == pt){
-        if(f & fmt·Sharp)
-            n += ndot;
-        else
-            pt++;    /* do not print any decimal point */
-    }
-    n += nsuf;
-
-    /*
-     * determine sign
-     */
-    sign = 0;
-    if(neg)
-        sign = '-';
-    else if(f & fmt·Sign)
-        sign = '+';
-    else if(f & fmt·Space)
-        sign = ' ';
-    if(sign)
-        n++;
-
-    /* compute padding */
-    npad = 0;
-    if((f & fmt·Width) && io->width > n)
-        npad = io->width - n;
-    if(npad && !(f & fmt·Left) && (f & fmt·Zero)){
-        z1 += npad;
-        pt += npad;
-        npad = 0;
-    }
-
-    /* format the actual field.  too bad about doing this twice. */
-    if(npad && !(f & fmt·Left) && pad(io, npad < 0))
-        return -1;
-
-    cur = io->buffer.cur;
-    end = io->buffer.end;
-
-    if(sign){
-        if(cur+1 > end){
-            if(!(cur=flush(io,cur,1)))
-                return -1;
-            end = io->buffer.end;
-        }
-        *cur++ = sign;
-    }
-
-    while(z1>0 || ndigits>0 || z2>0){
-        if(z1 > 0){
-            z1--;
-            c = '0';
-        }else if(ndigits > 0){
-            ndigits--;
-            c = *digits++;
-        }else{
-            z2--;
-            c = '0';
-        }
-
-        if(cur+1 > end){
-            if(!(cur=flush(io,cur,1)))
-                return -1;
-            end = io->buffer.end;
-        }
-        *cur++ = c;
-
-        if(--pt == 0)
-            for(p=dot; *p; p++){
-                if(cur+1 > end){
-                    if(!(cur=flush(io,cur,1)))
-                        return -1;
-                    end = io->buffer.end;
-                }
-                *cur++ = *p;
-            }
-    }
-    io->n += cur - (char*)io->buffer.cur;
-    io->buffer.cur = cur;
-    if(nsuf && copy(io, suf, nsuf, nsuf) < 0)
-        return -1;
-    if(npad && (f & fmt·Left) && pad(io, npad < 0))
-        return -1;
-
-    return 0;
-}
diff --git a/sys/libfmt/fprint.c b/sys/libfmt/fprint.c
deleted file mode 100644
index 26343f7..0000000
--- a/sys/libfmt/fprint.c
+++ /dev/null
@@ -1,14 +0,0 @@
-#include "internal.h"
-
-int
-fprint(int fd, char *fmt, ...)
-{
-    int n;
-    va_list args;
-
-    va_start(args, fmt);
-    n = fmt·vfprint(fd, fmt, args);
-    va_end(args);
-
-    return n;
-}
diff --git a/sys/libfmt/internal.h b/sys/libfmt/internal.h
deleted file mode 100644
index 725cfff..0000000
--- a/sys/libfmt/internal.h
+++ /dev/null
@@ -1,17 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <base.h>
-#include <libutf.h>
-#include <libfmt.h>
-
-typedef int (*Formatter)(fmt·State *io);
-typedef struct Verb Verb;
-
-struct Verb
-{
-    int c;
-    Formatter fmt;
-};
-
-void fmt·setlocale(fmt·State *io, char *decimal, char *thousands, char *groups);
diff --git a/sys/libfmt/locale.c b/sys/libfmt/locale.c
deleted file mode 100644
index 437c61e..0000000
--- a/sys/libfmt/locale.c
+++ /dev/null
@@ -1,16 +0,0 @@
-#include "internal.h"
-
-void
-fmt·setlocale(fmt·State *io, char *decimal, char *thousands, char *groups)
-{
-    if(decimal == nil || decimal[0] == '\0')
-        decimal = ".";
-    if(thousands == nil)
-        thousands = ",";
-    if(groups == nil)
-        groups = "\3";
-
-    io->groups    = groups;
-    io->decimal   = decimal;
-    io->thousands = thousands;
-}
diff --git a/sys/libfmt/nsprint.c b/sys/libfmt/nsprint.c
deleted file mode 100644
index 90489e0..0000000
--- a/sys/libfmt/nsprint.c
+++ /dev/null
@@ -1,14 +0,0 @@
-#include "internal.h"
-
-int
-fmt·nsprint(int len, char *buf, char *fmt, ...)
-{
-    int n;
-    va_list args;
-
-    va_start(args, fmt);
-    n = fmt·vnsprint(len, buf, fmt, args);
-    va_end(args);
-
-    return n;
-}
diff --git a/sys/libfmt/open.c b/sys/libfmt/open.c
deleted file mode 100644
index 8aadef5..0000000
--- a/sys/libfmt/open.c
+++ /dev/null
@@ -1,34 +0,0 @@
-#include "internal.h"
-
-static int
-flush(fmt·State *io)
-{
-    int n, fd;
-
-    fd = (uintptr)io->file;
-    n  = io->buffer.cur - io->buffer.beg;
-    if(n && write(fd, io->buffer.beg, n) != n)
-        return -1;
-
-    io->buffer.cur  = io->buffer.beg;
-    return io->n;
-}
-
-int
-fmt·open(int fd, int len, char *buf, fmt·State *io)
-{
-    io->buffer.beg = buf;
-    io->buffer.cur = buf;
-    io->buffer.end = buf+len;
-    io->flush = flush;
-    io->file  = (void*)(uintptr)fd;
-    io->flag  = 0;
-    io->n     = 0;
-    /* no heap needed */
-    io->heap = nil;
-    io->mem  = (mem·Reallocator){ 0 };
-
-    fmt·setlocale(io, nil, nil, nil);
-
-    return 0;
-}
diff --git a/sys/libfmt/print.c b/sys/libfmt/print.c
deleted file mode 100644
index 20b8e00..0000000
--- a/sys/libfmt/print.c
+++ /dev/null
@@ -1,13 +0,0 @@
-#include "internal.h"
-
-int
-fmt·print(char *fmt, ...)
-{
-    int n;
-    va_list args;
-
-    va_start(args, fmt);
-    n = fmt·vfprint(1, fmt, args);
-    va_end(args);
-    return n;
-}
diff --git a/sys/libfmt/rules.mk b/sys/libfmt/rules.mk
deleted file mode 100644
index 2b1b431..0000000
--- a/sys/libfmt/rules.mk
+++ /dev/null
@@ -1,36 +0,0 @@
-include share/push.mk
-
-# Iterate through subdirectory tree
-
-# Local sources
-SRCS_$(d) :=\
-	$(d)/buffer.c\
-	$(d)/do.c\
-	$(d)/esprint.c\
-	$(d)/fprint.c\
-	$(d)/locale.c\
-	$(d)/nsprint.c\
-	$(d)/open.c\
-	$(d)/print.c\
-	$(d)/sprint.c\
-	$(d)/vesprint.c\
-	$(d)/vfprint.c\
-	$(d)/vnsprint.c\
-	$(d)/vprint.c\
-	$(d)/vwrite.c\
-	$(d)/write.c
-
-LIBS_$(d) := $(d)/libfmt.a
-
-TSTS_$(d) := \
-	$(d)/test.c
-
-include share/paths.mk
-
-$(LIBS_$(d)): $(OBJS_$(d))
-	$(ARCHIVE)
-
-$(UNTS_$(d)): $(TOBJS_$(d)) $(LIBS_$(d)) $(OBJ_DIR)/sys/libutf/libutf.a $(OBJ_DIR)/sys/base/base.a
-	$(COMPLINK)
-
-include share/pop.mk
diff --git a/sys/libfmt/sprint.c b/sys/libfmt/sprint.c
deleted file mode 100644
index f1be6dd..0000000
--- a/sys/libfmt/sprint.c
+++ /dev/null
@@ -1,19 +0,0 @@
-#include "internal.h"
-
-int
-fmt·sprint(char *buf, char *fmt, ...)
-{
-    int n;
-    uint len;
-    va_list args;
-
-    len = 1 << 30;
-    if(buf+len < buf)
-        len = -(uintptr)buf-1;
-
-    va_start(args, fmt);
-    n = fmt·vnsprint(len, buf, fmt, args);
-    va_end(args);
-
-    return n;
-}
diff --git a/sys/libfmt/test.c b/sys/libfmt/test.c
deleted file mode 100644
index d81a62e..0000000
--- a/sys/libfmt/test.c
+++ /dev/null
@@ -1,72 +0,0 @@
-#include <u.h>
-#include <base.h>
-#include <libutf.h>
-#include <libfmt.h>
-
-typedef struct Complex
-{
-    double r, i;
-} Complex;
-
-int
-Xfmt(fmt·State *io)
-{
-    Complex c;
-    c = va_arg(io->args, Complex);
-
-    return fmt·write(io, "(real=%g,imag=%g)", c.r, c.i);
-}
-
-int
-main(int argc, char *argv[])
-{
-    fmt·print("basic tests\n");
-    fmt·print("\tx: %x\n", 0x87654321);
-    fmt·print("\tu: %u\n", 0x87654321);
-    fmt·print("\td: %d\n", 0x87654321);
-    fmt·print("\ts: %s\n", "hi there");
-    fmt·print("\tc: %c\n", '!');
-    fmt·print("\tg: %g %g %g\n", 3.14159, 3.14159e10, 3.14159e-10);
-    fmt·print("\te: %e %e %e\n", 3.14159, 3.14159e10, 3.14159e-10);
-    fmt·print("\tf: %f %f %f\n", 3.14159, 3.14159e10, 3.14159e-10);
-    fmt·print("\tsmiley: %C\n", (rune)0x263a);
-    fmt·print("\t%g %.18g\n", 2e25, 2e25);
-    fmt·print("\t%2.18g\n", 1.0);
-    fmt·print("\t%2.18f\n", 1.0);
-    fmt·print("\t%f\n", 3.1415927/4);
-    fmt·print("\t%d\n", 23);
-    fmt·print("\t%i\n", 23);
-    fmt·print("\t%0.10d\n", 12345);
-
-    fmt·print("%%4%%d tests\n");
-    fmt·print("\t%3$d %4$06d %2$d %1$d\n", 444, 333, 111, 222);
-    fmt·print("\t%3$d %4$06d %2$d %1$d\n", 444, 333, 111, 222);
-    fmt·print("\t%3$d %4$*5$06d %2$d %1$d\n", 444, 333, 111, 222, 20);
-    fmt·print("\t%3$hd %4$*5$06d %2$d %1$d\n", 444, 333, (short)111, 222, 20);
-    fmt·print("\t%3$lld %4$*5$06d %2$d %1$d\n", 444, 333, 111LL, 222, 20);
-
-    /* test %'d formats */
-    fmt·print("%%'%%d tests\n");
-    fmt·print("\t%'d %'d %'d\n", 1, 2222, 33333333);
-    fmt·print("\t%'019d\n", 0);
-    fmt·print("\t%08d %08d %08d\n", 1, 2222, 33333333);
-    fmt·print("\t%'08d %'08d %'08d\n", 1, 2222, 33333333);
-    fmt·print("\t%'x %'X %'b\n", 0x11111111, 0xabcd1234, 12345);
-    fmt·print("\t%'lld %'lld %'lld\n", 1LL, 222222222LL, 3333333333333LL);
-    fmt·print("\t%019lld %019lld %019lld\n", 1LL, 222222222LL, 3333333333333LL);
-    fmt·print("\t%'019lld %'019lld %'019lld\n", 1LL, 222222222LL, 3333333333333LL);
-    fmt·print("\t%'020lld %'020lld %'020lld\n", 1LL, 222222222LL, 3333333333333LL);
-    fmt·print("\t%'llx %'llX %'llb\n", 0x111111111111LL, 0xabcd12345678LL, 112342345LL);
-
-    /* test precision */
-    fmt·print("precision tests\n");
-    fmt·print("%020.10d\n", 100);
-
-    /* test install */
-    fmt·install('X', Xfmt);
-    Complex c = { 1.5, -2.3 };
-    fmt·print("x = %X\n", c);
-
-    return 0;
-
-}
diff --git a/sys/libfmt/vesprint.c b/sys/libfmt/vesprint.c
deleted file mode 100644
index 18f4dd2..0000000
--- a/sys/libfmt/vesprint.c
+++ /dev/null
@@ -1,26 +0,0 @@
-#include "internal.h"
-
-char*
-fmt·vesprint(char *buf, char *end, char *fmt, va_list args)
-{
-    fmt·State io;
-
-    if(end <= buf)
-        return nil;
-
-    io.n = 0;
-    io.buffer.beg = io.buffer.cur = buf;
-    io.buffer.end = end-1;
-    io.flush = nil;
-    io.file  = nil;
-
-    va_copy(io.args, args);
-
-    fmt·setlocale(&io, nil, nil, nil);
-    fmt·do(&io, fmt);
-
-    va_end(io.args);
-
-    *(io.buffer.cur) = 0;
-    return io.buffer.cur;
-}
diff --git a/sys/libfmt/vfprint.c b/sys/libfmt/vfprint.c
deleted file mode 100644
index 4306ea7..0000000
--- a/sys/libfmt/vfprint.c
+++ /dev/null
@@ -1,19 +0,0 @@
-#include "internal.h"
-
-int
-fmt·vfprint(int fd, char *fmt, va_list args)
-{
-    int  n;
-    fmt·State io;
-    char buf[256];
-
-    fmt·open(fd, sizeof(buf), buf, &io);
-
-    va_copy(io.args, args);
-    n = fmt·do(&io, fmt);
-    va_end(io.args);
-
-    if(n > 0 && io.flush(&io) < 0)
-        return -1;
-    return n;
-}
diff --git a/sys/libfmt/vnsprint.c b/sys/libfmt/vnsprint.c
deleted file mode 100644
index 7ded908..0000000
--- a/sys/libfmt/vnsprint.c
+++ /dev/null
@@ -1,26 +0,0 @@
-#include "internal.h"
-
-int
-fmt·vnsprint(int len, char *buf, char *fmt, va_list args)
-{
-    fmt·State io;
-
-    if(len <= 0)
-        return -1;
-
-    io.n = 0;
-    io.buffer.beg = io.buffer.cur = buf;
-    io.buffer.end = buf+len-1;
-    io.flush = nil;
-    io.file  = nil;
-
-    va_copy(io.args, args);
-
-    fmt·setlocale(&io, nil, nil, nil);
-    fmt·do(&io, fmt);
-
-    va_end(io.args);
-
-    *(io.buffer.cur) = 0;
-    return io.buffer.cur - io.buffer.beg;
-}
diff --git a/sys/libfmt/vprint.c b/sys/libfmt/vprint.c
deleted file mode 100644
index bb3076b..0000000
--- a/sys/libfmt/vprint.c
+++ /dev/null
@@ -1,19 +0,0 @@
-#include "internal.h"
-
-int
-fmt·vprint(char *fmt, va_list args)
-{
-    fmt·State io;
-    int  n;
-    char buf[256];
-
-    fmt·open(1, sizeof(buf), buf, &io);
-
-    va_copy(io.args, args);
-    n = fmt·do(&io, fmt);
-    va_end(io.args);
-
-    if(n > 0 && io.flush(&io) < 0)
-        return -1;
-    return n;
-}
diff --git a/sys/libfmt/vwrite.c b/sys/libfmt/vwrite.c
deleted file mode 100644
index cacdef2..0000000
--- a/sys/libfmt/vwrite.c
+++ /dev/null
@@ -1,26 +0,0 @@
-#include "internal.h"
-
-int
-fmt·vwrite(fmt·State *io, char *fmt, va_list args)
-{
-    int n;
-    va_list tmp;
-
-    io->flag = io->width = io->prec = 0;
-
-    va_copy(tmp, io->args);
-    va_end(io->args);
-
-    va_copy(io->args,args);
-    n = fmt·do(io, fmt);
-    va_end(io->args);
-
-    va_copy(io->args, tmp);
-    va_end(tmp);
-
-    io->flag = io->width = io->prec = 0;
-
-    if(n >= 0)
-        return 0;
-    return n;
-}
diff --git a/sys/libfmt/write.c b/sys/libfmt/write.c
deleted file mode 100644
index 9a77223..0000000
--- a/sys/libfmt/write.c
+++ /dev/null
@@ -1,22 +0,0 @@
-#include "internal.h"
-
-int
-fmt·write(fmt·State *io, char *fmt, ...)
-{
-    int n;
-    va_list args;
-
-    io->flag = io->width = io->prec = 0;
-
-    va_copy(args, io->args);
-    va_end(io->args);
-
-    va_start(io->args, fmt);
-    n = fmt·do(io, fmt);
-    va_end(io->args);
-
-    io->flag = io->width = io->prec = 0;
-    if(n >= 0)
-        return 0;
-    return n;
-}
diff --git a/sys/libmath/basic.c b/sys/libmath/basic.c
deleted file mode 100644
index 1341f7b..0000000
--- a/sys/libmath/basic.c
+++ /dev/null
@@ -1,531 +0,0 @@
-#include <u.h>
-#include <base.h>
-#include <libmath.h>
-
-#include <math.h>
-
-// TODO(nnoll): Replace implementations with your own.
-
-double
-math·acos(double x)
-{
-    return acos(x);
-}
-
-float
-math·acosf(float x)
-{
-    return acosf(x);
-}
-
-
-double
-math·acosh(double x)
-{
-    return acosh(x);
-}
-
-float
-math·acoshf(float x)
-{
-    return acoshf(x);
-}
-
-
-double
-math·asin(double x)
-{
-    return asin(x);
-}
-
-float
-math·asinf(float x)
-{
-    return asinf(x);
-}
-
-
-double
-math·asinh(double x)
-{
-    return asinh(x);
-}
-
-float
-math·asinhf(float x)
-{
-    return asinhf(x);
-}
-
-
-double
-math·atan(double x)
-{
-    return atan(x);
-}
-
-float
-math·atanf(float x)
-{
-    return atanf(x);
-}
-
-
-double
-math·atan2(double x, double y)
-{
-    return atan2(x, y);
-}
-
-float
-math·atan2f(float x, float y)
-{
-    return atan2f(x, y);
-}
-
-double
-math·atanh(double x)
-{
-    return atanh(x);
-}
-
-float
-math·atanhf(float x)
-{
-    return atanhf(x);
-}
-
-
-double
-math·cbrt(double x)
-{
-    return cbrt(x);
-}
-
-float
-math·cbrtf(float x)
-{
-    return cbrtf(x);
-}
-
-
-double
-math·ceil(double x)
-{
-    return ceil(x);
-}
-
-float
-math·ceilf(float x)
-{
-    return ceilf(x);
-}
-
-double
-math·cos(double x)
-{
-    return cos(x);
-}
-
-float
-math·cosf(float x)
-{
-    return cosf(x);
-}
-
-
-double
-math·cosh(double x)
-{
-    return cosh(x);
-}
-
-float
-math·coshf(float x)
-{
-    return coshf(x);
-}
-
-
-double
-math·erf(double x)
-{
-    return erf(x);
-}
-
-float
-math·erff(float x)
-{
-    return erff(x);
-}
-
-
-double
-math·erfc(double x)
-{
-    return erfc(x);
-}
-
-float
-math·erfcf(float x)
-{
-    return erfcf(x);
-}
-
-
-double
-math·exp(double x)
-{
-    return exp(x);
-}
-
-float
-math·expf(float x)
-{
-    return expf(x);
-}
-
-
-double
-math·exp2(double x)
-{
-    return exp2(x);
-}
-
-float
-math·exp2f(float x)
-{
-    return exp2f(x);
-}
-
-
-double
-math·expm1(double x)
-{
-    return expm1(x);
-}
-
-float
-math·expm1f(float x)
-{
-    return expm1f(x);
-}
-
-
-double
-math·floor(double x)
-{
-    return floor(x);
-}
-
-float
-math·floorf(float x)
-{
-    return floorf(x);
-}
-
-
-int
-math·ilogb(double x)
-{
-    return ilogb(x);
-}
-
-int
-math·ilogbf(float x)
-{
-    return ilogbf(x);
-}
-
-double
-math·lgamma(double x)
-{
-    return lgamma(x);
-}
-
-float
-math·lgammaf(float x)
-{
-    return lgammaf(x);
-}
-
-
-vlong   
-math·llrint(double x)
-{
-      return math·llrint(x);
-}
-
-vlong
-math·llrintf(float x)
-{
-      return math·llrintf(x);
-}
-
-
-vlong
-math·llround(double x)
-{
-    return llround(x);
-}
-
-vlong
-math·llroundf(float x)
-{
-    return llroundf(x);
-}
-
-
-double
-math·log(double x)
-{
-    return log(x);
-}
-
-float
-math·logf(float x)
-{
-    return logf(x);
-}
-
-
-double
-math·log10(double x)
-{
-    return log10(x);
-}
-
-float
-math·log10f(float x)
-{
-    return log10f(x);
-}
-
-
-double
-math·log1p(double x)
-{
-    return log1p(x);
-}
-
-float
-math·log1pf(float x)
-{
-    return log1pf(x);
-}
-
-
-double
-math·log2(double x)
-{
-    return log2(x);
-}
-
-float
-math·log2f(float x)
-{
-    return log2f(x);
-}
-
-
-double
-math·logb(double x)
-{
-    return logb(x);
-}
-
-float
-math·logbf(float x)
-{
-    return logbf(x);
-}
-
-
-long
-math·lrint(double x)
-{
-    return lrint(x);
-}
-
-long
-math·lrintf(float x)
-{
-    return lrintf(x);
-}
-
-
-long
-math·lround(double x)
-{
-    return lround(x);
-}
-
-long
-math·lroundf(float x)
-{
-    return lroundf(x);
-}
-
-
-double      math·modf(double, double *);
-float       math·modff(float, float *);
-
-double
-math·nan(const char * x)
-{
-    return nan(x);
-}
-
-float
-math·nanf(const char * x)
-{
-    return nanf(x);
-}
-
-
-double
-math·nearbyint(double x)
-{
-    return nearbyint(x);
-}
-
-float
-math·nearbyintf(float x)
-{
-    return nearbyintf(x);
-}
-
-
-double
-math·pow(double x, double exp)
-{
-    return pow(x, exp);
-}
-
-float       
-math·powf(float x, float exp)
-{
-    return powf(x, exp);
-}
-
-double
-math·rint(double x)
-{
-    return rint(x);
-}
-
-float
-math·rintf(float x)
-{
-    return rintf(x);
-}
-
-
-double
-math·round(double x)
-{
-    return round(x);
-}
-
-float
-math·roundf(float x)
-{
-    return roundf(x);
-}
-
-
-double      math·scalbln(double, long);
-float       math·scalblnf(float, long);
-
-double      math·scalbn(double, int);
-float       math·scalbnf(float, int);
-
-double
-math·sin(double x)
-{
-    return sin(x);
-}
-
-float
-math·sinf(float x)
-{
-    return sinf(x);
-}
-
-
-double
-math·sinh(double x)
-{
-    return sinh(x);
-}
-
-float
-math·sinhf(float x)
-{
-    return sinhf(x);
-}
-
-
-double
-math·sqrt(double x)
-{
-    return sqrt(x);
-}
-
-float
-math·sqrtf(float x)
-{
-    return sqrtf(x);
-}
-
-
-double
-math·tan(double x)
-{
-    return tan(x);
-}
-
-float
-math·tanf(float x)
-{
-    return tanf(x);
-}
-
-
-double
-math·tanh(double x)
-{
-    return tanh(x);
-}
-
-float
-math·tanhf(float x)
-{
-    return tanhf(x);
-}
-
-
-double
-math·tgamma(double x)
-{
-    return tgamma(x);
-}
-
-float
-math·tgammaf(float x)
-{
-    return tgammaf(x);
-}
-
-
-double
-math·trunc(double x)
-{
-    return trunc(x);
-}
-
-float
-math·truncf(float x)
-{
-    return truncf(x);
-}
diff --git a/sys/libmath/blas.c b/sys/libmath/blas.c
deleted file mode 100644
index 18f9760..0000000
--- a/sys/libmath/blas.c
+++ /dev/null
@@ -1,63 +0,0 @@
-#include <u.h>
-#include <base.h>
-#include <libmath.h>
-#include <libmath/blas.h>
-#include <time.h>
-
-/* #include <vendor/blas/cblas.h> */
-
-#define NCOL 2*512
-#define NROW 2*512
-#define NSUM 2*512
-#define NIT  10
-#define INC  1
-error
-main()
-{
-    int i, j, nit;
-    double *x, *y, *z, *w, res[2];
-
-    clock_t t;
-    double tprof[2] = { 0 };
-
-    rng·init(0);
-
-    x = malloc(sizeof(*x)*NROW*NCOL);
-    y = malloc(sizeof(*x)*NROW*NCOL);
-    z = malloc(sizeof(*x)*NROW*NCOL);
-    w = malloc(sizeof(*x)*NROW*NCOL);
-
-#define DO_0  t = clock();                                  \
-              blas·dgemm(0,0,NROW,NCOL,NSUM,10.1,x,NROW,y,NROW,1.2,z,NROW);\
-              t = clock() - t;                              \
-              res[0] += blas·dasum(NROW*NCOL,z,INC);        \
-              tprof[0] += 1000.*t/CLOCKS_PER_SEC;           \
-
-#define DO_1 t = clock();                                   \
-             cblas_dgemm(CblasRowMajor,CblasNoTrans,CblasNoTrans,NROW,NCOL,NSUM,10.1,x,NROW,y,NROW,1.2,w,NROW);\
-             t = clock() - t;                               \
-             res[1] += cblas_dasum(NROW*NCOL,w,INC);        \
-             tprof[1] += 1000.*t/CLOCKS_PER_SEC;      
-
-    for (nit = 0; nit < NIT; nit++) {
-        for (i = 0; i < NROW; i++) {
-            for (j = 0; j < NCOL; j++) {
-                x[j + NROW*i] = rng·random();
-                y[j + NROW*i] = rng·random();
-                z[j + NROW*i] = rng·random();
-                w[j + NROW*i] = z[j + NROW*i];
-            }
-        }
-
-        switch (nit % 2) {
-            case 0: DO_0; DO_1; break;
-            case 1: DO_1; DO_0; break;
-        }
-    }
-    printf("mean time/iteration (mine): %fms\n", tprof[0]/NIT);
-    printf("--> result (mine): %f\n", res[0]);
-    printf("mean time/iteration (openblas): %fms\n", tprof[1]/NIT);
-    printf("--> result (openblas): %f\n", res[1]);
-
-    return 0;
-}
diff --git a/sys/libmath/blas1.c b/sys/libmath/blas1.c
deleted file mode 100644
index a8ca085..0000000
--- a/sys/libmath/blas1.c
+++ /dev/null
@@ -1,58 +0,0 @@
-#include <u.h>
-#include <libmath.h>
-
-// -----------------------------------------------------------------------
-// Templates
-
-#include "loop.h"
-#define BODY_XY()                           \
-    LOOP(UNROLL, 0, INIT);                  \
-    n = ROUNDBY(len, UNROLL);               \
-    if (incx == 1 && incy == 1) {           \
-        for (i = 0; i < n; i+=UNROLL) {     \
-            LOOP(UNROLL,0,KERNEL,1,1);      \
-        }                                   \
-    } else {                                \
-        for (i = 0; i < n; i+=UNROLL) {     \
-            LOOP(UNROLL,0,KERNEL,incx,incy);\
-        }                                   \
-    }                                       \
-                                            \
-    for (; i < len; i++) {                  \
-        LOOP(1,0,KERNEL,incx,incy);         \
-    }
-
-#define BODY_X()                            \
-    LOOP(UNROLL, 0, INIT);                  \
-    n = ROUNDBY(len, UNROLL);               \
-    if (incx == 1) {                        \
-        for (i = 0; i < n; i+=UNROLL) {     \
-            LOOP(UNROLL,0,KERNEL,1);        \
-        }                                   \
-    } else {                                \
-        for (i = 0; i < n; i+=UNROLL) {     \
-            LOOP(UNROLL,0,KERNEL,incx);     \
-        }                                   \
-    }                                       \
-                                            \
-    for (; i < len; i++) {                  \
-        LOOP(1,0,KERNEL,incx);              \
-    }
-
-// -----------------------------------------------------------------------
-// Implementation
-
-#define UNROLL 8
-#define INT int
-
-#define FLOAT double
-#define func(name) blas·d##name
-#include "blas1body"
-
-#undef FLOAT
-#undef func
-
-#define FLOAT float
-#define func(name) blas·f##name
-#include "blas1body"
-#undef FLOAT
diff --git a/sys/libmath/blas1body b/sys/libmath/blas1body
deleted file mode 100644
index de4b637..0000000
--- a/sys/libmath/blas1body
+++ /dev/null
@@ -1,215 +0,0 @@
-/* vim: set ft=c */
-// -----------------------------------------------------------------------
-// Function implementations
-
-FLOAT
-func(dot)(INT len, FLOAT *x, INT incx, FLOAT *y, INT incy)
-{
-#define INIT(I,...)           reg[I] = 0;
-#define KERNEL(I, INCX, INCY) reg[I] += x[(INCX)*(i + I)] * y[(INCY)*(i + I)];
-    INT   i, n;
-    FLOAT reg[UNROLL];
-
-    BODY_XY()
-
-    for (i = 1; i < UNROLL; i++) 
-        reg[0] += reg[i];
-
-    return reg[0];
-#undef INIT
-#undef KERNEL
-}
-
-void
-func(copy)(INT len, FLOAT *x, INT incx, FLOAT *y, INT incy)
-{
-#define INIT(I,...)
-#define KERNEL(I, INCX, INCY)  y[(INCY)*(i + I)] = x[(INCX)*(i + I)];
-    INT i, n;
-
-    BODY_XY();
-
-#undef INIT
-#undef KERNEL
-}
-
-void
-func(swap)(INT len, FLOAT *x, INT incx, FLOAT *y, INT incy)
-{
-#define INIT(I,...)
-#define KERNEL(I, INCX, INCY)  tmp[I] = x[(INCX)*(i + I)], x[(INCX)*(i + I)] = y[(INCY)*(i + I)], y[(INCY)*(i + I)] = tmp[I];
-    INT   i, n;
-    FLOAT tmp[UNROLL];
-
-    BODY_XY();
-
-#undef INIT
-#undef KERNEL
-}
-
-void
-func(axpy)(INT len, FLOAT a, FLOAT *x, INT incx, FLOAT *y, INT incy)
-{
-#define INIT(I,...)
-#define KERNEL(I, INCX, INCY) y[(INCY)*(i + I)] += a*x[(INCX)*(i + I)];
-    INT   i, n;
-
-    BODY_XY();
-
-#undef INIT
-#undef KERNEL
-}
-
-void
-func(axpby)(INT len, FLOAT a, FLOAT *x, INT incx, FLOAT b, FLOAT *y, INT incy)
-{
-#define INIT(I,...)
-#define KERNEL(I, INCX, INCY) y[(INCY)*(i + I)] = a*x[(INCX)*(i + I)] + b*y[(INCY)*(i + I)];
-    INT   i, n;
-
-    BODY_XY();
-
-#undef INIT
-#undef KERNEL
-}
-
-INT
-func(argmax)(INT len, FLOAT *x, INT incx)
-{
-#define INIT(I,...) max[I] = x[I], idx[I] = I;
-#define KERNEL(I, INCX) if (x[(INCX)*(i+I)] > max[I]) {max[i] = x[INCX*(i+I)]; idx[I] = i+I;}
-    INT   i, n;
-    FLOAT max[UNROLL];
-    INT   idx[UNROLL];
-
-    BODY_X();
-
-    for (i = 1; i < UNROLL; i++)
-        if (max[i] > max[0])
-            idx[0] = idx[i];
-
-    return idx[0];
-#undef INIT
-#undef KERNEL
-}
-
-INT
-func(argmin)(INT len, FLOAT *x, INT incx)
-{
-#define INIT(I,...) min[I] = x[I], idx[I] = I;
-#define KERNEL(I, INCX) if (x[INCX*(i+I)] < min[I]) {min[i] = x[INCX*(i+I)]; idx[I] = i+I;}
-    INT   i, n;
-    FLOAT min[UNROLL];
-    INT   idx[UNROLL];
-
-    BODY_X();
-
-    for (i = 1; i < UNROLL; i++)
-        if (min[i] < min[0])
-            idx[0] = idx[i];
-
-    return idx[0];
-#undef INIT
-#undef KERNEL
-}
-
-FLOAT
-func(asum)(INT len, FLOAT *x, INT incx)
-{
-#define INIT(I,...) sum[I] = 0;
-#define KERNEL(I, INCX) sum[I] += x[INCX*(i+I)] > 0 ? x[INCX*(i+I)] : -x[INCX*(i+I)];
-    INT   i, n;
-    FLOAT sum[UNROLL];
-
-    BODY_X();
-
-    for (i = 1; i < UNROLL; i++) 
-        sum[0] += sum[i];
-
-    return sum[0];
-
-#undef INIT
-#undef KERNEL
-}
-
-void
-func(scale)(INT len, FLOAT a, FLOAT *x, INT incx)
-{
-#define INIT(I, ...)
-#define KERNEL(I, INCX) x[INCX*(i+I)] *= a;
-    INT   i, n;
-
-    BODY_X();
-
-#undef INIT
-#undef KERNEL
-}
-
-FLOAT
-func(norm)(INT len, FLOAT *x, INT incx)
-{
-#define INIT(I, ...)
-#define KERNEL(I, INCX) norm[I] += x[INCX*(i+I)] * x[INCX*(i+I)];
-    INT   i, n;
-    FLOAT norm[UNROLL];
-
-    BODY_X();
-
-    for (i = 1; i < UNROLL; i++)
-        norm[0] += norm[i];
-
-    return math·sqrt(norm[0]);
-
-#undef INIT
-#undef KERNEL
-}
-
-void
-func(drot)(INT len, FLOAT *x, INT incx, FLOAT *y, INT incy, FLOAT cos, FLOAT sin)
-{
-#define INIT(I, ...)
-#define KERNEL(I, INCX, INCY) tmp[I] = x[INCX*(i+I)], x[INCX*(i+I)] = cos*x[INCX*(i+I)] + sin*y[INCY*(i+I)], y[INCY*(i+I)] = cos*y[INCY*(i+I)] - sin*tmp[I];
-    INT   i, n;
-    FLOAT tmp[UNROLL];
-
-    BODY_XY();
-
-#undef INIT
-#undef KERNEL
-}
-
-void
-func(rotm)(INT len, FLOAT *x, INT incx, FLOAT *y, INT incy, FLOAT H[5])
-{
-#define INIT(I, ...)
-#define KERNEL(I, INCX, INCY) tmp[I] = x[INCX*(i+I)], x[INCX*(i+I)] = H[1]*x[INCX*(i+I)] + H[2]*y[INCY*(i+I)], y[INCY*(i+I)] = H[3]*tmp[I] + H[4]*y[INCY*(i+I)];
-    INT   i, n, f;
-    FLOAT tmp[UNROLL];
-
-    f = (INT)H[0];
-    switch (f) {
-    case -2:
-        H[1] = +1;
-        H[2] = +0;
-        H[3] = +0;
-        H[4] = +1;
-        break;
-    case -1:
-        break;
-    case +0:
-        H[1] = +1;
-        H[4] = +1;
-        break;
-    case +1:
-        H[2] = +1;
-        H[3] = -1;
-        break;
-    default:
-        return;
-    }
-
-    BODY_XY();
-
-#undef INIT
-#undef KERNEL
-}
diff --git a/sys/libmath/blas2.c b/sys/libmath/blas2.c
deleted file mode 100644
index 7e4b08e..0000000
--- a/sys/libmath/blas2.c
+++ /dev/null
@@ -1,222 +0,0 @@
-#include <u.h>
-#include <libmath/blas.h>
-#include "loop.h"
-
-// -----------------------------------------------------------------------
-// Templates
-
-#define BODY_RECT()                                      \
-    nr = ROUNDBY(nrow, UNROW);                           \
-    nc = ROUNDBY(ncol, UNCOL);                           \
-    if (incx == 1 && incy == 1) {                        \
-        for (r = 0; r < nr; r += UNROW) {                \
-            LOOP(UNROW,0,INIT,1,1);                      \
-            for (c = 0; c < nc; c += UNCOL) {            \
-                LOOP(UNROW,0,KERN,1,1,UNCOL);            \
-            }                                            \
-            for (; c < ncol; c++) {                      \
-                LOOP(UNROW,0,KERN,1,1,1);                \
-            }                                            \
-            LOOP(UNROW,0,FINI,1,1);                      \
-        }                                                \
-    } else {                                             \
-        for (r = 0; r < nr; r += UNROW) {                \
-            LOOP(UNROW,0,INIT,incx,incy);                \
-            for (c = 0; c < nc; c += UNCOL) {            \
-                LOOP(UNROW,0,KERN,incx,incy,UNCOL);      \
-            }                                            \
-            for (; c < ncol; c++) {                      \
-                LOOP(UNROW,0,KERN,incx,incy,1);          \
-            }                                            \
-            LOOP(UNROW,0,FINI,incx,incy);                \
-        }                                                \
-    }                                                    \
-                                                         \
-    for (; r < nrow; r++) {                              \
-        LOOP(1,0,INIT,incx,incy);                        \
-        for (c = 0; c < nc; c += UNCOL) {                \
-            LOOP(1,0,KERN,incx,incy,UNCOL);              \
-        }                                                \
-        for (; c < ncol; c++) {                          \
-            LOOP(1,0,KERN,incx,incy,1);                  \
-        }                                                \
-        LOOP(1,0,FINI,incx,incy);                        \
-    }
-
-#define BODY_LOTRI()                                     \
-    nr = ROUNDBY(n, UNROW);                              \
-    if (incx == 1) {                                     \
-        for (r = 0; r < nr; r += UNROW) {                \
-            LOOP(UNROW,0,INIT,1);                        \
-            nc = ROUNDBY(r, UNCOL);                      \
-            for (c = 0; c < nc; c += UNCOL) {            \
-                LOOP(UNROW,0,KERN,1,UNCOL);              \
-            }                                            \
-            for (; c < r; c++) {                         \
-                LOOP(UNROW,0,KERN,1,1);                  \
-            }                                            \
-            LOOP(UNROW,0,FINI,1);                        \
-        }                                                \
-    } else {                                             \
-        for (r = 0; r < nr; r += UNROW) {                \
-            LOOP(UNROW,0,INIT,incx);                     \
-            nc = ROUNDBY(r, UNCOL);                      \
-            for (c = 0; c < nc; c += UNCOL) {            \
-                LOOP(UNROW,0,KERN,incx,UNCOL);           \
-            }                                            \
-            for (; c < r; c++) {                         \
-                LOOP(UNROW,0,KERN,incx,1);               \
-            }                                            \
-            LOOP(UNROW,0,FINI,incx);                     \
-        }                                                \
-    }                                                    \
-                                                         \
-    for (; r < n; r++) {                                 \
-        LOOP(1,0,INIT,incx);                             \
-        nc = ROUNDBY(r, UNCOL);                          \
-        for (c = 0; c < nc; c += UNCOL) {                \
-            LOOP(1,0,KERN,incx,UNCOL);                   \
-        }                                                \
-        for (; c < r; c++) {                             \
-            LOOP(1,0,KERN,incx,1);                       \
-        }                                                \
-        LOOP(1,0,FINI,incx);                             \
-    }
-
-#define BODY_UPTRI()                                     \
-    nr = n - ROUNDBY(n, UNROW);                          \
-    if (incx == 1) {                                     \
-        for (r = n-1; r >= nr; r -= UNROW) {             \
-            LOOP(UNROW,0,INIT,1);                        \
-            nc = n - ROUNDBY(r, UNCOL);                  \
-            for (c = n-1; c >= nc; c -= UNCOL) {         \
-                LOOP(UNROW,0,KERN,1,UNCOL);              \
-            }                                            \
-            for (; c > r; c--) {                         \
-                LOOP(UNROW,0,KERN,1,1);                  \
-            }                                            \
-            LOOP(UNROW,0,FINI,1);                        \
-        }                                                \
-    } else {                                             \
-        for (r = n-1; r >= nr; r -= UNROW) {             \
-            LOOP(UNROW,0,INIT,incx);                     \
-            nc = n - ROUNDBY(r, UNCOL);                  \
-            for (c = n-1; c >= nc; c -= UNCOL) {         \
-                LOOP(UNROW,0,KERN,incx,UNCOL);           \
-            }                                            \
-            for (; c > r; c--) {                         \
-                LOOP(UNROW,0,KERN,incx,1);               \
-            }                                            \
-            LOOP(UNROW,0,FINI,incx);                     \
-        }                                                \
-    }                                                    \
-                                                         \
-    for (; r >= 0; r--) {                                \
-        LOOP(1,0,INIT,incx);                             \
-        nc = n - ROUNDBY(r, UNCOL);                      \
-        for (c = n-1; c >= nc; c -= UNCOL) {             \
-            LOOP(1,0,KERN,incx,UNCOL);                   \
-        }                                                \
-        for (; c > r; c--) {                             \
-            LOOP(1,0,KERN,incx,1);                       \
-        }                                                \
-        LOOP(1,0,FINI,incx);                             \
-    }
-
-#define BODY_LOTRI_XY()                                  \
-    nr = ROUNDBY(n, UNROW);                              \
-    if (incx == 1 && incy == 1) {                        \
-        for (r = 0; r < nr; r += UNROW) {                \
-            LOOP(UNROW,0,INIT,1,1);                      \
-            nc = ROUNDBY(r, UNCOL);                      \
-            for (c = 0; c < nc; c += UNCOL) {            \
-                LOOP(UNROW,0,KERN,1,1,UNCOL);            \
-            }                                            \
-            for (; c < r; c++) {                         \
-                LOOP(UNROW,0,KERN,1,1,1);                \
-            }                                            \
-            LOOP(UNROW,0,FINI,1,1);                      \
-        }                                                \
-    } else {                                             \
-        for (r = 0; r < nr; r += UNROW) {                \
-            LOOP(UNROW,0,INIT,incx,incy);                \
-            nc = ROUNDBY(r, UNCOL);                      \
-            for (c = 0; c < nc; c += UNCOL) {            \
-                LOOP(UNROW,0,KERN,incx,incy,UNCOL);      \
-            }                                            \
-            for (; c < r; c++) {                         \
-                LOOP(UNROW,0,KERN,incx,incy,1);          \
-            }                                            \
-            LOOP(UNROW,0,FINI,incx, incy);               \
-        }                                                \
-    }                                                    \
-                                                         \
-    for (; r < n; r++) {                                 \
-        LOOP(1,0,INIT,incx,incy);                        \
-        nc = ROUNDBY(r, UNCOL);                          \
-        for (c = 0; c < nc; c += UNCOL) {                \
-            LOOP(1,0,KERN,incx,incy,UNCOL);              \
-        }                                                \
-        for (; c < r; c++) {                             \
-            LOOP(1,0,KERN,incx,incy,1);                  \
-        }                                                \
-        LOOP(1,0,FINI,incx,incy);                        \
-    }
-
-#define BODY_UPTRI_XY()                                  \
-    nr = n - ROUNDBY(n, UNROW);                          \
-    if (incx == 1 && incy == 1) {                        \
-        for (r = n-1; r >= nr; r -= UNROW) {             \
-            LOOP(UNROW,0,INIT,1,1);                      \
-            nc = n - ROUNDBY(r, UNCOL);                  \
-            for (c = n-1; c >= nc; c -= UNCOL) {         \
-                LOOP(UNROW,0,KERN,1,1,UNCOL);            \
-            }                                            \
-            for (; c > r; c--) {                         \
-                LOOP(UNROW,0,KERN,1,1,1);                \
-            }                                            \
-            LOOP(UNROW,0,FINI,1,1);                      \
-        }                                                \
-    } else {                                             \
-        for (r = n-1; r >= nr; r -= UNROW) {             \
-            LOOP(UNROW,0,INIT,incx,incy);                \
-            nc = n - ROUNDBY(r, UNCOL);                  \
-            for (c = n-1; c >= nc; c -= UNCOL) {         \
-                LOOP(UNROW,0,KERN,incx,incy,UNCOL);      \
-            }                                            \
-            for (; c > r; c--) {                         \
-                LOOP(UNROW,0,KERN,incx,incy,1);          \
-            }                                            \
-            LOOP(UNROW,0,FINI,incx,incy);                \
-        }                                                \
-    }                                                    \
-                                                         \
-    for (; r >= 0; r--) {                                \
-        LOOP(1,0,INIT,incx,incy);                        \
-        nc = n - ROUNDBY(r, UNCOL);                      \
-        for (c = n-1; c >= nc; c -= UNCOL) {             \
-            LOOP(1,0,KERN,incx,incy,UNCOL);              \
-        }                                                \
-        for (; c > r; c--) {                             \
-            LOOP(1,0,KERN,incx,incy,1);                  \
-        }                                                \
-        LOOP(1,0,FINI,incx,incy);                        \
-    }
-
-// -----------------------------------------------------------------------
-// implementation
-
-#define UNROW 4
-#define UNCOL 4
-
-#define INT   int
-#define FLOAT double
-#define func(name) blas·d##name
-#include "blas2body"
-
-#undef FLOAT
-#undef func
-
-#define FLOAT float
-#define func(name) blas·f##name
-#include "blas2body"
diff --git a/sys/libmath/blas2body b/sys/libmath/blas2body
deleted file mode 100644
index 45baf67..0000000
--- a/sys/libmath/blas2body
+++ /dev/null
@@ -1,256 +0,0 @@
-/* general matrix multiply */
-error
-func(gemv)(uint flag, INT nrow, INT ncol, FLOAT a, FLOAT *m, INT incm, FLOAT *x, INT incx, FLOAT b, FLOAT *y, INT incy)
-{
-    INT r, c, nr, nc;
-    FLOAT *row[UNROW], reg[UNROW];
-#define INIT(I, INCX, INCY) row[I] = m + (r+I)*incm, reg[I] = 0;
-#define TERM(J, I, INCX, INCY)  row[I][c+J] * x[INCX*(c+J)]
-#define KERN(I, INCX, INCY, LENGTH) reg[I] += EXPAND(LENGTH,0,TERM,+,I,INCX,INCY);
-#define FINI(I, INCX, INCY) y[INCY*(r+I)] = b*y[INCY*(r+I)] + a*reg[I];
-
-    if (!flag) {
-        BODY_RECT();
-    } else {
-        func(scale)(ncol, b, y, incy); 
-#undef  KERN
-#undef  FINI
-#undef  INIT
-#undef  TERM
-#define INIT(I, INCX, INCY) row[I] = m + (r+I)*incm, reg[I] = a*x[INCX*(r+I)];
-#define TERM(J, I, INCX, INCY) row[I][c+J] * reg[I]
-#define KERN(I, INCX, INCY, LENGTH) y[INCY*(c+I)] += EXPAND(LENGTH,0,TERM,+,I,INCX,INCY);
-#define FINI(I, INCX, INCY)
-        BODY_RECT();
-    }
-
-    return 0;
-#undef INIT
-#undef TERM
-#undef KERN
-#undef FINI
-}
-
-/* symmetric matrix vector multiply (different layouts) */
-void
-func(symv)(uint upper, INT n, FLOAT a, FLOAT *m, INT incm, FLOAT *x, INT incx, FLOAT b, FLOAT *y, INT incy)
-{
-    INT r, c, nr, nc, i;
-    FLOAT *row[UNROW], reg1[UNROW], reg2[UNROW];
-
-#define INIT(I, INCX, INCY) row[I] = m + (r XX I)*incm, reg1[I] = 0, reg2[I] = 0;
-#define TERM1(J, I, INCX, INCY) row[I][c XX J]*x[INCX*(c XX J)]
-#define TERM2(J, I, INCX, INCY) row[I][c XX J]*x[INCX*((n-c-1) XX J)]
-#define KERN(I, INCX, INCY, REPEAT) reg1[I] += EXPAND(REPEAT,0,TERM1,+,I,INCX,INCY), \
-                                    reg2[I] += EXPAND(REPEAT,0,TERM2,+,I,INCX,INCY);
-#define FINI(I, INCX, INCY) y[INCY*(r+I)] += a*(reg1[I] + row[I][r]*x[INCX*r]), \
-                            y[INCY*(n-r-1+I)] += a*reg2[I];
-
-    func(scale)(n, b, y, incy); 
-#define XX +
-    if (!upper) {
-        BODY_LOTRI_XY();
-    } else {
-#undef  XX
-#define XX -
-        BODY_UPTRI_XY();
-    }
-#undef  XX
-
-#undef INIT
-}
-
-void
-func(spmv)(uint upper, INT n, FLOAT a, FLOAT *m, FLOAT *x, INT incx, FLOAT b, FLOAT *y, INT incy)
-{
-    INT r, c, nr, nc, i;
-    FLOAT *row[UNROW], reg1[UNROW], reg2[UNROW];
-
-#define INIT(I, INCX, INCY) row[I] = m + ((r+I)*(r+I+1))*(1/2), reg1[I] = 0, reg2[I] = 0;
-
-    func(scale)(n, b, y, incy); 
-#define XX +
-    if (!upper) {
-        BODY_LOTRI_XY();
-    } else {
-#undef  XX
-#undef  INIT
-#define INIT(I, INCX, INCY) row[I] = m + ((2*n-r-I)*(r+I+1))*(1/2), reg1[I] = 0, reg2[I] = 0;
-#define XX -
-        BODY_UPTRI_XY();
-    }
-#undef  XX
-
-#undef TERM
-#undef INIT
-#undef KERN
-#undef FINI
-}
-
-/* triangular multiply (different layouts) */
-void
-func(trmv)(uint upper, INT n, FLOAT *m, INT incm, FLOAT *x, INT incx)
-{
-    INT r, c, nr, nc, i;
-    FLOAT *row[UNROW], reg[UNROW];
-#define INIT(I, INCX) row[I] = m + (r XX I)*incm, reg[I] = 0;
-#define TERM(J, I, INCX) row[I][c XX J]*x[INCX*(c XX J)]
-#define KERN(I, INCX, REPEAT) reg[I] += EXPAND(REPEAT,0,TERM,+,I,INCX);
-#define FINI(I, INCX) x[INCX*(r XX I)] = row[I][r XX I]*x[INCX*(r XX I)] + reg[I];
-
-#define XX +
-    if (!upper) {
-        BODY_LOTRI();
-    } else {
-#undef  XX
-#define XX -
-        BODY_UPTRI();
-    }
-#undef  XX
-
-#undef INIT
-}
-
-void
-func(tpmv)(uint upper, INT n, FLOAT *m, FLOAT *x, INT incx)
-{
-    INT r, c, nr, nc, i;
-    FLOAT *row[UNROW], reg[UNROW];
-#define INIT(I, INCX) row[I] = m + ((r+I)*(r+I+1))*(1/2), reg[I] = 0;
-
-#define XX +
-    if (!upper) {
-        BODY_LOTRI();
-    } else {
-#undef  XX
-#undef  INIT
-#define INIT(I, INCX) row[I] = m + ((2*n-r-I)*(r+I+1))*(1/2), reg[I] = 0;
-#define XX -
-        BODY_UPTRI();
-    }
-#undef  XX
-
-#undef INIT
-#undef TERM
-#undef KERN
-#undef FINI
-}
-
-/* triangular solve (different layouts) */
-void
-func(trsv)(uint upper, INT n, FLOAT *m, INT incm, FLOAT *x, INT incx)
-{
-    INT r, c, nr, nc, i;
-    FLOAT *row[UNROW], reg[UNROW];
-#define INIT(I, INCX) row[I] = m + (r XX I)*incm, reg[I] = 0;
-#define TERM(J, I, INCX) row[I][c XX J]*x[c XX J]
-#define KERN(I, INCX, REPEAT) reg[I] += EXPAND(REPEAT,0,TERM,+,I,INCX);
-#define SOLN(J, I, INCX) reg[J] += row[I][r XX I]*x[INCX*(r XX I)]
-#define FINI(I, INCX) x[INCX*(r XX I)] = reg[I] / row[I][r XX I]; EXPAND_TRI(UNROW,INC(I),SOLN,;,I,INCX);
-
-#define XX +
-    if (!upper) {
-        BODY_LOTRI();
-    } else {
-#undef  XX
-#define XX -
-        BODY_UPTRI();
-    }
-#undef  XX
-
-#undef INIT
-}
-
-void
-func(tpsv)(uint upper, INT n, FLOAT *m, FLOAT *x, INT incx)
-{
-    INT r, c, nr, nc, i;
-    FLOAT *row[UNROW], reg[UNROW];
-#define INIT(I, INCX) row[I] = m + ((r+I)*(r+I+1))*(1/2), reg[I] = 0;
-
-#define XX +
-    if (!upper) {
-        BODY_LOTRI();
-    } else {
-#undef  XX
-#undef INIT
-#define INIT(I, INCX) row[I] = m + ((2*n-r-I)*(r+I+1))*(1/2), reg[I] = 0;
-#define XX -
-        BODY_UPTRI();
-    }
-#undef  XX
-
-#undef INIT
-#undef TERM
-#undef KERN
-#undef SOLN
-#undef FINI
-}
-
-/* rank 1 update */
-void
-func(ger)(INT nrow, INT ncol, FLOAT a, FLOAT *x, INT incx, FLOAT *y, INT incy, FLOAT *m, INT incm)
-{
-    INT r, c, nr, nc;
-    FLOAT *row[UNROW], reg[UNROW];
-#define INIT(I, INCX, INCY) row[I] = m + (r+I)*incm, reg[I] = a*x[INCX*(r+I)];
-#define TERM(J, I, INCX, INCY)   row[I][c+J] += reg[I] * y[INCY*(c+J)]
-#define KERN(I, INCX, INCY, LENGTH) EXPAND(LENGTH,0,TERM,;,I,INCX, INCY);
-#define FINI(I, ...) 
-
-    BODY_RECT();
-
-#undef INIT
-#undef TERM
-#undef KERN
-#undef FINI
-}
-
-/* symmetric rank 1 update (different memory layouts) */
-void
-func(syr)(uint upper, INT n, FLOAT a, FLOAT *x, INT incx, FLOAT *m, INT incm)
-{
-    INT r, c, nr, nc;
-    FLOAT *row[UNROW], reg[UNROW];
-#define INIT(I, INCX) row[I] = m + (r XX I)*incm, reg[I] = a*x[INCX*(r XX I)];
-#define TERM(J, I, INCX)   row[I][c XX J] += reg[I] * x[INCX*(c XX J)]
-#define KERN(I, INCX, LENGTH) EXPAND(LENGTH,0,TERM,;,I,INCX);
-#define FINI(I, ...) 
-
-#define XX +
-    if (!upper) {
-        BODY_LOTRI();
-    } else {
-#undef  XX
-#define XX -
-        BODY_UPTRI();
-    }
-#undef  XX
-
-#undef INIT
-}
-
-void
-func(spr)(uint upper, INT n, FLOAT a, FLOAT *x, INT incx, FLOAT *m)
-{
-    INT r, c, nr, nc;
-    FLOAT *row[UNROW], reg[UNROW];
-#define INIT(I, INCX) row[I] = m + ((r+I)*(r+I+1))*(1/2), reg[I] = 0;
-
-#define XX +
-    if (!upper) {
-        BODY_LOTRI();
-    } else {
-#undef  XX
-#undef  INIT
-#define INIT(I, INCX) row[I] = m + ((2*n-r-I)*(r+I+1))*(1/2), reg[I] = 0;
-#define XX -
-        BODY_UPTRI();
-    }
-#undef  XX
-
-#undef INIT
-#undef TERM
-#undef KERN
-#undef FINI
-}
diff --git a/sys/libmath/blas3.c b/sys/libmath/blas3.c
deleted file mode 100644
index b048c95..0000000
--- a/sys/libmath/blas3.c
+++ /dev/null
@@ -1,279 +0,0 @@
-#include <u.h>
-#include <base.h>
-#include <libmath.h>
-
-#define INT   int
-#define FLOAT double
-#define func(name) blas·d##name
-
-#define X(i, j) x[j + incx*(i)]
-#define Y(i, j) y[j + incy*(i)]
-#define Z(i, j) z[j + incz*(i)]
-
-void
-func(gemm)(uint trm, uint trn, INT ni, INT nj, INT nk, FLOAT a, FLOAT *x, INT incx, FLOAT *y, INT incy, FLOAT b, FLOAT *z, INT incz)
-{
-    INT jj, jb, kk, kb, dk, i, j, k, end;
-    FLOAT r0[8], r1[8], r2[8], r3[8], pf;
-
-    for (i = 0; i < ni; i++) {
-        for (j = 0; j < nj; j++) {
-            Z(i,j) *= b;
-        }
-    }
-
-    jb = MIN(256, nj);
-    kb = MIN(48, nk);
-    for (jj = 0; jj < nj; jj += jb) {
-        for (kk = 0; kk < nk; kk += kb) {
-            for (i = 0; i < ni; i += 4) {
-                for (j = jj; j < jj + jb; j += 8) {
-                    r0[0] = Z(i+0, j+0); r0[1] = Z(i+0, j+1); r0[2] = Z(i+0, j+2); r0[3] = Z(i+0, j+3);
-                    r1[0] = Z(i+1, j+0); r1[1] = Z(i+1, j+1); r1[2] = Z(i+1, j+2); r1[3] = Z(i+1, j+3);
-                    r2[0] = Z(i+2, j+0); r2[1] = Z(i+2, j+1); r2[2] = Z(i+2, j+2); r2[3] = Z(i+2, j+3);
-                    r3[0] = Z(i+3, j+0); r3[1] = Z(i+3, j+1); r3[2] = Z(i+3, j+2); r3[3] = Z(i+3, j+3);
-                    end = MIN(nk, kk+kb);
-                    for (k = kk; k < end; k++) {
-                        pf    = a  * X(i, k);
-                        r0[0] += pf * Y(k, j+0); r0[1] += pf * Y(k, j+1); r0[2] += pf * Y(k, j+2); r0[3] += pf * Y(k, j+3);
-
-                        pf    = a * X(i+1, k);
-                        r1[0] += pf * Y(k, j+0); r1[1] += pf * Y(k, j+1); r1[2] += pf * Y(k, j+2); r1[3] += pf * Y(k, j+3);
-
-                        pf    = a * X(i+2, k);
-                        r1[0] += pf * Y(k, j+0); r1[1] += pf * Y(k, j+1); r1[2] += pf * Y(k, j+2); r1[3] += pf * Y(k, j+3);
-
-                        pf    = a * X(i+3, k);
-                        r1[0] += pf * Y(k, j+0); r1[1] += pf * Y(k, j+1); r1[2] += pf * Y(k, j+2); r1[3] += pf * Y(k, j+3);
-                    }
-                    Z(i+0, j+0) = r0[0]; Z(i+0, j+1) = r0[1]; Z(i+0, j+2) = r0[2]; Z(i+0, j+3) = r0[3];
-                    Z(i+1, j+0) = r1[0]; Z(i+1, j+1) = r1[1]; Z(i+1, j+2) = r1[2]; Z(i+1, j+3) = r1[3];
-                    Z(i+2, j+0) = r2[0]; Z(i+2, j+1) = r2[1]; Z(i+2, j+2) = r2[2]; Z(i+2, j+3) = r2[3];
-                    Z(i+3, j+0) = r3[0]; Z(i+3, j+1) = r3[1]; Z(i+3, j+2) = r3[2]; Z(i+3, j+3) = r3[3];
-                }
-            }
-        }
-    }
-}
-
-#if 0
-void
-func(gemm)(uint trm, uint trn, INT ni, INT nj, INT nk, FLOAT a, FLOAT *x, INT incx, FLOAT *y, INT incy, FLOAT b, FLOAT *z, INT incz)
-{
-    int i, j, k;
-    FLOAT w[nj*nk], acc[4][4];
-
-    for (i = 0; i < ni; i++) {
-        for (j = 0; j < nj; j++) {
-            Z(i,j) *= b;
-            W(i,j) = Y(j,i);
-        }
-    }
-
-    for (i = 0; i < ni; i+=4) {
-        for (j = 0; j < nj; j+=4) {
-            memset(acc, 0, sizeof(acc));
-            for (k = 0; k < nk; k+=4) {
-                acc[0][0] += X(i+0,k)*W(j+0,k) + X(i+0,k+1)*W(j+0,k+1) + X(i+0,k+2)*W(j+0,k+2) + X(i+0,k+3)*W(j+0,k+3);
-                acc[0][1] += X(i+0,k)*W(j+1,k) + X(i+0,k+1)*W(j+1,k+1) + X(i+0,k+2)*W(j+1,k+2) + X(i+0,k+3)*W(j+1,k+3);
-                acc[0][2] += X(i+0,k)*W(j+2,k) + X(i+0,k+1)*W(j+2,k+1) + X(i+0,k+2)*W(j+2,k+2) + X(i+0,k+3)*W(j+2,k+3);
-                acc[0][3] += X(i+0,k)*W(j+3,k) + X(i+0,k+1)*W(j+3,k+1) + X(i+0,k+2)*W(j+3,k+2) + X(i+0,k+3)*W(j+3,k+3);
-
-                acc[1][0] += X(i+1,k)*W(j+0,k) + X(i+1,k+1)*W(j+0,k+1) + X(i+1,k+2)*W(j+0,k+2) + X(i+1,k+3)*W(j+0,k+3);
-                acc[1][1] += X(i+1,k)*W(j+1,k) + X(i+1,k+1)*W(j+1,k+1) + X(i+1,k+2)*W(j+1,k+2) + X(i+1,k+3)*W(j+1,k+3);
-                acc[1][2] += X(i+1,k)*W(j+2,k) + X(i+1,k+1)*W(j+2,k+1) + X(i+1,k+2)*W(j+2,k+2) + X(i+1,k+3)*W(j+2,k+3);
-                acc[1][3] += X(i+1,k)*W(j+3,k) + X(i+1,k+1)*W(j+3,k+1) + X(i+1,k+2)*W(j+3,k+2) + X(i+1,k+3)*W(j+3,k+3);
-
-                acc[2][0] += X(i+2,k)*W(j+0,k) + X(i+2,k+1)*W(j+0,k+1) + X(i+2,k+2)*W(j+0,k+2) + X(i+2,k+3)*W(j+0,k+3);
-                acc[2][1] += X(i+2,k)*W(j+1,k) + X(i+2,k+1)*W(j+1,k+1) + X(i+2,k+2)*W(j+1,k+2) + X(i+2,k+3)*W(j+1,k+3);
-                acc[2][2] += X(i+2,k)*W(j+2,k) + X(i+2,k+1)*W(j+2,k+1) + X(i+2,k+2)*W(j+2,k+2) + X(i+2,k+3)*W(j+2,k+3);
-                acc[2][3] += X(i+2,k)*W(j+3,k) + X(i+2,k+1)*W(j+3,k+1) + X(i+2,k+2)*W(j+3,k+2) + X(i+2,k+3)*W(j+3,k+3);
-
-                acc[2][0] += X(i+3,k)*W(j+0,k) + X(i+3,k+1)*W(j+0,k+1) + X(i+3,k+2)*W(j+0,k+2) + X(i+3,k+3)*W(j+0,k+3);
-                acc[2][1] += X(i+3,k)*W(j+1,k) + X(i+3,k+1)*W(j+1,k+1) + X(i+3,k+2)*W(j+1,k+2) + X(i+3,k+3)*W(j+1,k+3);
-                acc[2][2] += X(i+3,k)*W(j+2,k) + X(i+3,k+1)*W(j+2,k+1) + X(i+3,k+2)*W(j+2,k+2) + X(i+3,k+3)*W(j+2,k+3);
-                acc[2][3] += X(i+3,k)*W(j+3,k) + X(i+3,k+1)*W(j+3,k+1) + X(i+3,k+2)*W(j+3,k+2) + X(i+3,k+3)*W(j+3,k+3);
-                // Z(i,j) += X(i,k)*Y(k,j);
-            }
-            Z(i+0,j+1) = a*acc[0][0];
-            Z(i+0,j+2) = a*acc[0][1];
-            Z(i+0,j+3) = a*acc[0][2];
-            Z(i+0,j+4) = a*acc[0][3];
-
-            Z(i+1,j+1) = a*acc[1][0];
-            Z(i+1,j+2) = a*acc[1][1];
-            Z(i+1,j+3) = a*acc[1][2];
-            Z(i+1,j+4) = a*acc[1][3];
-
-            Z(i+2,j+1) = a*acc[2][0];
-            Z(i+2,j+2) = a*acc[2][1];
-            Z(i+2,j+3) = a*acc[2][2];
-            Z(i+2,j+4) = a*acc[2][3];
-
-            Z(i+3,j+1) = a*acc[3][0];
-            Z(i+3,j+2) = a*acc[3][1];
-            Z(i+3,j+3) = a*acc[3][2];
-            Z(i+3,j+4) = a*acc[3][3];
-        }
-    }
-}
-#endif
-
-#if 0
-void
-func(gemm)(uint trm, uint trn, INT ni, INT nj, INT nk, FLOAT a, FLOAT *x, INT incx, FLOAT *y, INT incy, FLOAT b, FLOAT *z, INT incz)
-{
-    int i, j, k, ri, rj, rk;
-    FLOAT reg[4][4], *xrow[4], *yrow[4];
-
-    for (i = 0; i < ni; i++) {
-        for (j = 0; j < nj; j++) {
-            z[j + incz*i] *= b;
-        }
-    }
-
-    for (i = 0; i < ni; i += 4) {
-        xrow[0] = x + incx*(i+0);
-        xrow[1] = x + incx*(i+1);
-        xrow[2] = x + incx*(i+2);
-        xrow[3] = x + incx*(i+3);
-        for (k = 0; k < nk; k+=4) {
-            yrow[0]   = y + incy*(k+0);
-            yrow[1]   = y + incy*(k+1);
-            yrow[2]   = y + incy*(k+2);
-            yrow[3]   = y + incy*(k+3);
-            reg[0][0] = a * xrow[0][k+0]; reg[0][1] = a * xrow[0][k+1]; reg[0][2] = a * xrow[0][k+2]; reg[0][3] = a * xrow[0][k+3];
-            reg[1][0] = a * xrow[1][k+0]; reg[1][1] = a * xrow[1][k+1]; reg[1][2] = a * xrow[1][k+2]; reg[1][3] = a * xrow[1][k+3];
-            reg[2][0] = a * xrow[2][k+0]; reg[2][1] = a * xrow[2][k+1]; reg[2][2] = a * xrow[2][k+2]; reg[2][3] = a * xrow[2][k+3];
-            reg[3][0] = a * xrow[3][k+0]; reg[3][1] = a * xrow[3][k+1]; reg[3][2] = a * xrow[3][k+2]; reg[3][3] = a * xrow[3][k+3];
-            for (j = 0; j < nj; j += 1) {
-                z[j + incz*(i+0)] += (reg[0][0]*yrow[0][j]+reg[0][1]*yrow[1][j]+reg[0][2]*yrow[2][j]+reg[0][3]*yrow[3][j]);
-                z[j + incz*(i+1)] += (reg[1][0]*yrow[0][j]+reg[1][1]*yrow[1][j]+reg[1][2]*yrow[2][j]+reg[1][3]*yrow[3][j]);
-                z[j + incz*(i+2)] += (reg[2][0]*yrow[0][j]+reg[2][1]*yrow[1][j]+reg[2][2]*yrow[2][j]+reg[2][3]*yrow[3][j]);
-                z[j + incz*(i+3)] += (reg[3][0]*yrow[0][j]+reg[3][1]*yrow[1][j]+reg[3][2]*yrow[2][j]+reg[3][3]*yrow[3][j]);
-            }
-        }
-    }
-}
-#endif
-
-#if 0
-void
-func(gemm)(uint trm, uint trn, INT ni, INT nj, INT nk, FLOAT a, FLOAT *x, INT incx, FLOAT *y, INT incy, FLOAT b, FLOAT *z, INT incz)
-{
-    int i, j, k, ri, rj, rk;
-    FLOAT r[4][4], *row[4];
-
-    for (i = 0; i < ni; i++) {
-        for (j = 0; j < nj; j++) {
-            Z(i, j) *= b;
-        }
-    }
-
-    for (i = 0; i < ni; i+=4) {
-        for (j = 0; j < nj; j+=4) {
-            r[0][0] = 0; r[0][1] = 0; r[0][2] = 0; r[0][3] = 0; 
-            r[1][0] = 0; r[1][1] = 0; r[1][2] = 0; r[1][3] = 0; 
-            r[2][0] = 0; r[2][1] = 0; r[2][2] = 0; r[2][3] = 0; 
-            r[3][0] = 0; r[3][1] = 0; r[3][2] = 0; r[3][3] = 0; 
-            row[0]  = &X(i+0, 0);
-            row[1]  = &X(i+1, 0);
-            row[2]  = &X(i+2, 0);
-            row[3]  = &X(i+3, 0);
-            for (k = 0; k < nk; k++) {
-                r[0][0] += row[0][k]*Y(k,0); r[0][1] += row[0][k]*Y(k,1); r[0][2] += row[0][k]*Y(k,2); r[0][3] += row[0][k]*Y(k,3);
-                r[1][0] += row[1][k]*Y(k,0); r[1][1] += row[1][k]*Y(k,1); r[1][2] += row[1][k]*Y(k,2); r[1][3] += row[1][k]*Y(k,3);
-                r[2][0] += row[2][k]*Y(k,0); r[2][1] += row[2][k]*Y(k,1); r[2][2] += row[2][k]*Y(k,2); r[2][3] += row[2][k]*Y(k,3);
-                r[3][0] += row[3][k]*Y(k,0); r[3][1] += row[3][k]*Y(k,1); r[3][2] += row[3][k]*Y(k,2); r[3][3] += row[3][k]*Y(k,3);
-            }
-            Z(i+0, j+0) += r[0][0]; Z(i+0, j+1) += r[0][1]; Z(i+0, j+2) += r[0][2]; Z(i+0, j+3) += r[0][3];
-            Z(i+1, j+0) += r[1][0]; Z(i+1, j+1) += r[1][1]; Z(i+1, j+2) += r[1][2]; Z(i+1, j+3) += r[1][3];
-            Z(i+2, j+0) += r[2][0]; Z(i+2, j+1) += r[2][1]; Z(i+2, j+2) += r[2][2]; Z(i+2, j+3) += r[2][3];
-            Z(i+3, j+0) += r[3][0]; Z(i+3, j+1) += r[3][1]; Z(i+3, j+2) += r[3][2]; Z(i+3, j+3) += r[3][3];
-        }
-    }
-}
-#endif
-
-#if 0
-void
-func(gemm)(uint trm, uint trn, INT ni, INT nj, INT nk, FLOAT a, FLOAT *x, INT incx, FLOAT *y, INT incy, FLOAT b, FLOAT *z, INT incz)
-{
-    int i, j, k, ri, rj, rk;
-    FLOAT *xrow[8], *yrow[8], reg;
-
-    for (i = 0; i < ni; i++) {
-        for (j = 0; j < nj; j++) {
-            z[j + incz*i] *= b;
-        }
-    }
-
-    ri = ni & ~7;
-    rj = nj & ~7;
-    for (i = 0; i < ri; i += 8) {
-        xrow[0] = x + incx*(i+0);
-        xrow[1] = x + incx*(i+1);
-        xrow[2] = x + incx*(i+2);
-        xrow[3] = x + incx*(i+3);
-        xrow[4] = x + incx*(i+4);
-        xrow[5] = x + incx*(i+5);
-        xrow[6] = x + incx*(i+6);
-        xrow[7] = x + incx*(i+7);
-        for (j = 0; j < rj; j += 8) {
-            yrow[0] = y + incy*(j+0);
-            yrow[1] = y + incy*(j+1);
-            yrow[2] = y + incy*(j+2);
-            yrow[3] = y + incy*(j+3);
-            yrow[4] = y + incy*(j+4);
-            yrow[5] = y + incy*(j+5);
-            yrow[6] = y + incy*(j+6);
-            yrow[7] = y + incy*(j+7);
-            for (k = 0; k < nk; k++) {
-                reg = a*(yrow[0][k] + yrow[1][k] + yrow[2][k] + yrow[3][k] + yrow[4][k] + yrow[5][k] + yrow[6][k] + yrow[7][k]);
-                z[k + incz*(i+0)] += xrow[0][k]*reg;
-                z[k + incz*(i+1)] += xrow[1][k]*reg;
-                z[k + incz*(i+2)] += xrow[2][k]*reg;
-                z[k + incz*(i+3)] += xrow[3][k]*reg;
-                z[k + incz*(i+4)] += xrow[4][k]*reg;
-                z[k + incz*(i+5)] += xrow[5][k]*reg;
-                z[k + incz*(i+6)] += xrow[6][k]*reg;
-                z[k + incz*(i+7)] += xrow[7][k]*reg;
-            }
-        }
-        for (; j < nj; j++) {
-            for (k = 0; k < nk; k++) {
-                reg = a*y[k+incy*j];
-                z[k + incz*(i+0)] += xrow[0][k]*reg;
-                z[k + incz*(i+1)] += xrow[1][k]*reg;
-                z[k + incz*(i+2)] += xrow[2][k]*reg;
-                z[k + incz*(i+3)] += xrow[3][k]*reg;
-                z[k + incz*(i+4)] += xrow[4][k]*reg;
-                z[k + incz*(i+5)] += xrow[5][k]*reg;
-                z[k + incz*(i+6)] += xrow[6][k]*reg;
-                z[k + incz*(i+7)] += xrow[7][k]*reg;
-            }
-        }
-    }
-
-    for (; i < ni; i++) {
-        for (j = 0; j < rj; j += 8) {
-            yrow[0] = y + incy*(j+0);
-            yrow[1] = y + incy*(j+1);
-            yrow[2] = y + incy*(j+2);
-            yrow[3] = y + incy*(j+3);
-            yrow[4] = y + incy*(j+4);
-            yrow[5] = y + incy*(j+5);
-            yrow[6] = y + incy*(j+6);
-            yrow[7] = y + incy*(j+7);
-            for (k = 0; k < nk; k++) {
-                z[k + incz*(i)] += a*x[k + incx*i]*(yrow[0][k] + yrow[1][k] + yrow[2][k] + yrow[3][k] + yrow[4][k] + yrow[5][k] + yrow[6][k] + yrow[7][k]);
-            }
-        }
-        for (; j < nj; j++) {
-            for (k = 0; k < nk; k++) {
-                z[k + incz*i] += a*x[k + incx*i]*y[k + incy*j];
-            }
-        }
-    }
-}
-#endif
diff --git a/sys/libmath/lapack.c b/sys/libmath/lapack.c
deleted file mode 100644
index e69de29..0000000
--- a/sys/libmath/lapack.c
+++ /dev/null
diff --git a/sys/libmath/linalg.c b/sys/libmath/linalg.c
deleted file mode 100644
index 8551ff1..0000000
--- a/sys/libmath/linalg.c
+++ /dev/null
@@ -1,63 +0,0 @@
-#include <u.h>
-#include <libn.h>
-#include <libmath.h>
-#include <libmath/blas.h>
-
-// -----------------------------------------------------------------------
-// Vector
-
-void
-linalg·normalize(math·Vector vec)
-{
-    double norm;
-
-    norm = blas·normd(vec.len, vec.data, 1);
-    blas·scaled(vec.len, 1/norm, vec.data, 1);
-}
-// TODO: Write blas wrappers that eat vectors for convenience
-
-// -----------------------------------------------------------------------
-// Matrix
-//
-// NOTE: all matrices are row major oriented
-
-/*
- * linalg·lq
- * computes the LQ decomposition of matrix M: M = LQ
- * L is lower triangular
- * Q is orthogonal -> transp(Q) * Q = I
- *
- * m: matrix to factorize. changes in place
- *     + lower triangle -> L
- *     + upper triangle -> all reflection vectors stored in rows
- * w: working buffer: len = ncols!
- */
-error
-linalg·lq(math·Matrix m, math·Vector w)
-{
-    int i, j, len;
-    double *row, mag;
-    enum {
-        err·nil,
-        err·baddims,
-    };
-
-    if (m.dim[0] > m.dim[1]) {
-        return err·baddims;
-    }
-
-    for (i = 0; i < m.dim[0]; i++, m.data += m.dim[1]) {
-        row = m.data   + i;
-        len = m.dim[0] - i;
-
-        // TODO: Don't want to compute norm twice!!
-        w.data[0] = math·sgn(row[0]) * blas·normd(len, row, 1);
-        blas·axpyd(len, 1.0, row, 1, w.data, 1);
-        mag  = blas·normd(len, w.data, 1);
-        blas·scaled(len, 1/mag, w.data, 1);
-
-        blas·copyd(len - m.dim[0], w.data, 1, m.data + i, 1);
-    }
-
-    return err·nil;
-}
diff --git a/sys/libmath/loop.h b/sys/libmath/loop.h
deleted file mode 100644
index a877d84..0000000
--- a/sys/libmath/loop.h
+++ /dev/null
@@ -1,114 +0,0 @@
-#pragma once
-
-/* increment operator */
-#define INC2(x) INC_##x
-#define INC1(x) INC2(x)
-#define INC(x)  INC1(x)
-
-#define INC_0 1
-#define INC_1 2
-#define INC_2 3
-#define INC_3 4
-#define INC_4 5
-#define INC_5 6
-#define INC_6 7
-#define INC_7 8
-#define INC_8 9
-#define INC_9 10
-#define INC_10 11
-#define INC_11 12
-#define INC_12 13
-#define INC_13 14
-#define INC_14 15
-#define INC_15 16
-
-#define ROUNDBY(x, n) ((x) & ~((n)-1))
-
-/* subtraction tables */
-#define SUB2(x, y) SUB_##x##_##y
-#define SUB1(x, y) SUB2(x, y)
-#define SUB(x, y)  SUB1(x, y)
-#define SUB_8_0 8
-#define SUB_8_1 7
-#define SUB_8_2 6
-#define SUB_8_3 5
-#define SUB_8_4 4
-#define SUB_8_5 3
-#define SUB_8_6 2
-#define SUB_8_7 1
-#define SUB_8_8 0
-#define SUB_7_0 7
-#define SUB_7_1 6
-#define SUB_7_2 5
-#define SUB_7_3 4
-#define SUB_7_4 3
-#define SUB_7_5 2
-#define SUB_7_6 1
-#define SUB_7_7 0
-#define SUB_6_0 6
-#define SUB_6_1 5
-#define SUB_6_2 4
-#define SUB_6_3 3
-#define SUB_6_4 2
-#define SUB_6_5 1
-#define SUB_6_6 0
-#define SUB_5_0 5
-#define SUB_5_1 4
-#define SUB_5_2 3
-#define SUB_5_3 2
-#define SUB_5_4 1
-#define SUB_5_5 0
-#define SUB_4_0 4
-#define SUB_4_1 3
-#define SUB_4_2 2
-#define SUB_4_3 1
-#define SUB_4_4 0
-#define SUB_3_0 3
-#define SUB_3_1 2
-#define SUB_3_2 1
-#define SUB_3_3 0
-#define SUB_2_0 2
-#define SUB_2_1 1
-#define SUB_2_2 0
-#define SUB_1_0 1
-#define SUB_1_1 0
-
-/* rounding operator */
-#define ROUNDBY(x, n) ((x) & ~((n)-1))
-
-/* loop unrolling (vertical) */
-#define LOOP1(I,STMT,...)  STMT(I,__VA_ARGS__) 
-#define LOOP2(I,STMT,...)  STMT(I,__VA_ARGS__) LOOP1(INC(I),STMT,__VA_ARGS__)
-#define LOOP3(I,STMT,...)  STMT(I,__VA_ARGS__) LOOP2(INC(I),STMT,__VA_ARGS__)
-#define LOOP4(I,STMT,...)  STMT(I,__VA_ARGS__) LOOP3(INC(I),STMT,__VA_ARGS__)
-#define LOOP5(I,STMT,...)  STMT(I,__VA_ARGS__) LOOP4(INC(I),STMT,__VA_ARGS__)
-#define LOOP6(I,STMT,...)  STMT(I,__VA_ARGS__) LOOP5(INC(I),STMT,__VA_ARGS__)
-#define LOOP7(I,STMT,...)  STMT(I,__VA_ARGS__) LOOP6(INC(I),STMT,__VA_ARGS__)
-#define LOOP8(I,STMT,...)  STMT(I,__VA_ARGS__) LOOP7(INC(I),STMT,__VA_ARGS__)
-#define LOOP9(I,STMT,...)  STMT(I,__VA_ARGS__) LOOP8(INC(I),STMT,__VA_ARGS__)
-#define LOOP10(I,STMT,...) STMT(I,__VA_ARGS__) LOOP9(INC(I),STMT,__VA_ARGS__)
-#define LOOP11(I,STMT,...) STMT(I,__VA_ARGS__) LOOP10(INC(I),STMT,__VA_ARGS__)
-#define LOOP12(I,STMT,...) STMT(I,__VA_ARGS__) LOOP11(INC(I),STMT,__VA_ARGS__)
-#define LOOP13(I,STMT,...) STMT(I,__VA_ARGS__) LOOP12(INC(I),STMT,__VA_ARGS__)
-#define LOOP14(I,STMT,...) STMT(I,__VA_ARGS__) LOOP13(INC(I),STMT,__VA_ARGS__)
-#define LOOP15(I,STMT,...) STMT(I,__VA_ARGS__) LOOP14(INC(I),STMT,__VA_ARGS__)
-#define LOOP16(I,STMT,...) STMT(I,__VA_ARGS__) LOOP15(INC(I),STMT,__VA_ARGS__)
-
-#define _LOOP_(n,I,STMT,...) LOOP##n(I,STMT,__VA_ARGS__) 
-#define LOOP(n,I,STMT,...) _LOOP_(n,I,STMT,__VA_ARGS__)
-
-/* loop expansion (horizontal) */
-#define EXPAND0(I,TERM,OP,...)
-#define EXPAND1(I,TERM,OP,...) TERM(I,__VA_ARGS__)
-#define EXPAND2(I,TERM,OP,...) TERM(I,__VA_ARGS__) OP EXPAND1(INC(I),TERM,OP,__VA_ARGS__)
-#define EXPAND3(I,TERM,OP,...) TERM(I,__VA_ARGS__) OP EXPAND2(INC(I),TERM,OP,__VA_ARGS__)
-#define EXPAND4(I,TERM,OP,...) TERM(I,__VA_ARGS__) OP EXPAND3(INC(I),TERM,OP,__VA_ARGS__)
-#define EXPAND5(I,TERM,OP,...) TERM(I,__VA_ARGS__) OP EXPAND4(INC(I),TERM,OP,__VA_ARGS__)
-#define EXPAND6(I,TERM,OP,...) TERM(I,__VA_ARGS__) OP EXPAND5(INC(I),TERM,OP,__VA_ARGS__)
-#define EXPAND7(I,TERM,OP,...) TERM(I,__VA_ARGS__) OP EXPAND6(INC(I),TERM,OP,__VA_ARGS__)
-#define EXPAND8(I,TERM,OP,...) TERM(I,__VA_ARGS__) OP EXPAND7(INC(I),TERM,OP,__VA_ARGS__)
-
-#define _EXPAND_(n,I,TERM,OP,...)     EXPAND##n(I,TERM,OP,__VA_ARGS__) 
-#define EXPAND(n,I,TERM,OP,...)      _EXPAND_(n,I,TERM,OP,__VA_ARGS__)
-#define EXPAND_TRI1(n,I,TERM,OP,...)  EXPAND(n,I,TERM,OP,__VA_ARGS__) 
-#define EXPAND_TRI(n,I,TERM,OP,...)   EXPAND_TRI1(SUB(n,I),I,TERM,OP,__VA_ARGS__)
diff --git a/sys/libmath/matrix.c b/sys/libmath/matrix.c
deleted file mode 100644
index e8bca0b..0000000
--- a/sys/libmath/matrix.c
+++ /dev/null
@@ -1,176 +0,0 @@
-#include <u.h>
-#include <libn.h>
-#include <libmath.h>
-
-/* TODO: replace (incrementally) with native C version! */
-#include <vendor/blas/cblas.h>
-#include <vendor/blas/lapacke.h>
-
-// -----------------------------------------------------------------------
-// level 1
-
-error
-la·vecslice(math·Vector *x, int min, int max, int inc)
-{
-    if (max > x->len || min < 0) {
-        errorf("out of bounds: attempted to access vector past length");
-        return 1;
-    }
-    x->len  = (max - min) / inc;
-    x->d   += x->inc * min;
-    x->inc *= inc;
-
-    return 0;
-}
-
-/* simple blas wrappers */
-void
-la·veccopy(math·Vector *dst, math·Vector *src)
-{
-    return cblas_dcopy(src->len, src->d, src->inc, dst->d, dst->inc);
-}
-
-double
-la·vecnorm(math·Vector *x)
-{
-    return cblas_dnrm2(x->len, x->d, x->inc);
-}
-
-void
-la·vecscale(math·Vector *x, double a)
-{
-    return cblas_dscal(x->len, a, x->d, x->inc);
-}
-
-double
-la·vecdot(math·Vector *x, math·Vector *y)
-{
-    return cblas_ddot(x->len, x->d, x->inc, y->d, y->inc);
-}
-
-// -----------------------------------------------------------------------
-// level 2
-
-error
-la·vecmat(math·Vector *x, math·Matrix *M)
-{
-    if (M->dim[1] != x->len) {
-        errorf("incompatible matrix dimensions");
-        return 1;
-    }
-    if (M->state & ~mat·trans)
-        cblas_dgemv(CblasRowMajor,CblasNoTrans,M->dim[0],M->dim[1],1.,M->d,M->inc,x->d,x->inc,0.,x->d,x->inc);
-    else
-        cblas_dgemv(CblasRowMajor,CblasTrans,M->dim[0],M->dim[1],1.,M->d,M->inc,x->d,x->inc,0.,x->d,x->inc);
-
-    return 0;
-}
-
-// -----------------------------------------------------------------------
-// level 3
-
-void
-la·transpose(math·Matrix *X)
-{
-    int tmp;
-    X->state ^= mat·trans;
-    tmp = X->dim[0], X->dim[0] = X->dim[1], X->dim[1] = tmp;
-}
-
-error
-la·matrow(math·Matrix *X, int r, math·Vector *row)
-{
-    if (r < 0 || r >= X->dim[0]) {
-        errorf("out of bounds");
-        return 1;
-    }
-
-    row->len = X->dim[1];
-    row->inc = 1;
-    row->d   = X->d + X->dim[1] * r;
-
-    return 0;
-}
-
-error
-la·matcol(math·Matrix *X, int c, math·Vector *col)
-{
-    if (c < 0 || c >= X->dim[1]) {
-        errorf("out of bounds");
-        return 1;
-    }
-
-    col->len = X->dim[0];
-    col->inc = X->dim[1];
-    col->d   = X->d + c;
-
-    return 0;
-}
-
-error
-la·matslice(math·Matrix *X, int r[3], int c[3])
-{
-    /* TODO */
-    return 0;
-}
-
-error
-la·eig(math·Matrix *X)
-{
-
-}
-
-/* X = A*B */
-error
-la·matmul(math·Matrix *X, math·Matrix *A, math·Matrix *B)
-{
-    if (A->dim[1] != B->dim[0]) {
-        errorf("number of interior dimensions of A '%d' not equal to that of B '%d'", A->dim[1], B->dim[0]);
-        return 1;
-    }
-    if (X->dim[0] != A->dim[0]) {
-        errorf("number of exterior dimensions of X '%d' not equal to that of A '%d'", X->dim[0], A->dim[0]);
-        return 1;
-    }
-    if (X->dim[1] != B->dim[1]) {
-        errorf("number of exterior dimensions of X '%d' not equal to that of B '%d'", X->dim[1], B->dim[1]);
-        return 1;
-    }
-
-    if (X->state & ~mat·trans)
-        if (A->state & ~mat·trans)
-            cblas_dgemm(CblasRowMajor,CblasNoTrans,CblasNoTrans,A->dim[0],B->dim[1],A->dim[1],1.,A->d,A->inc,B->d,B->inc,0.,X->d,X->inc);
-        else
-            cblas_dgemm(CblasRowMajor,CblasNoTrans,CblasTrans,A->dim[0],B->dim[1],A->dim[1],1.,A->d,A->inc,B->d,B->inc,0.,X->d,X->inc);
-    else
-        if (A->state & ~mat·trans)
-            cblas_dgemm(CblasRowMajor,CblasTrans,CblasNoTrans,A->dim[0],B->dim[1],A->dim[1],1.,A->d,A->inc,B->d,B->inc,0.,X->d,X->inc);
-        else
-            cblas_dgemm(CblasRowMajor,CblasTrans,CblasTrans,A->dim[0],B->dim[1],A->dim[1],1.,A->d,A->inc,B->d,B->inc,0.,X->d,X->inc);
-
-    return 0;
-}
-
-/* 
- * solves A*X=B 
- * pass in B via X
- */
-error
-la·solve(math·Matrix *X, math·Matrix *A)
-{
-    error err;
-    int n, *ipv;
-    static int buf[512];
-    if (n = A->dim[0], n < arrlen(buf)) {
-        ipv = buf;
-        n   = 0;
-    } else
-        ipv = malloc(n*sizeof(*ipv));
-
-    /* TODO: utilize more specific regimes if applicable */
-    err = LAPACKE_dgesv(LAPACK_ROW_MAJOR,A->dim[0],X->dim[1],A->d,A->inc,ipv,X->d,X->inc);
-
-    if (n)
-        free(ipv);
-    return err;
-}
diff --git a/sys/libmath/rules.mk b/sys/libmath/rules.mk
deleted file mode 100644
index 83945d7..0000000
--- a/sys/libmath/rules.mk
+++ /dev/null
@@ -1,24 +0,0 @@
-include share/push.mk
-
-# Iterate through subdirectory tree
-
-# Local sources
-SRCS_$(d) := \
-	$(d)/basic.c \
-	$(d)/blas1.c \
-	$(d)/blas2.c \
-	$(d)/blas3.c
-LIBS_$(d) := $(d)/libmath.a
-TSTS_$(d) :=
-
-include share/paths.mk
-
-$(LIBS_$(d)): $(OBJS_$(d))
-	$(ARCHIVE)
-
-$(UNTS_$(d)): TCFLAGS := -D_GNU_SOURCE
-$(UNTS_$(d)): TCLIBS := -lpthread -lm $(LIB_DIR)/libblas.a $(OBJ_DIR)/sys/libn/libn.a $(LIBS_$(d))
-$(UNTS_$(d)): $(TOBJS_$(d)) $(LIBS_$(d)) $(OBJ_DIR)/sys/libn/libn.a 
-	$(LINK)
-
-include share/pop.mk
diff --git a/sys/libmath/test.c b/sys/libmath/test.c
deleted file mode 100644
index 66700f8..0000000
--- a/sys/libmath/test.c
+++ /dev/null
@@ -1,471 +0,0 @@
-#include <u.h>
-#include <base.h>
-/* #include <vendor/blas/cblas.h> */
-
-#include <x86intrin.h>
-
-#include <time.h>
-
-// -----------------------------------------------------------------------
-// Vectors
-
-/* 
- * NOTE: I'm not sure I like stashing the header in _all_ vectors
- *       The only way to fix is to have a library based allocator...      
- */
-typedef struct math·Vec
-{
-    struct {
-        void         *h;
-        mem·Allocator heap;
-    };
-    int     len;
-    double *d;
-} math·Vec;
-
-math·Vec 
-math·makevec(int len, mem·Allocator heap, void *h)
-{
-    math·Vec v;
-    v.len  = len;
-    v.heap = heap;
-    v.h    = h;
-    v.d    = heap.alloc(h, 1, len*sizeof(double));
-    
-    // memset(v.d, 0, len*sizeof(double));
-
-    return v;
-}
-
-error
-math·freevec(math·Vec *v)
-{
-    if (v->h == nil && v->heap.alloc == nil && v->heap.free == nil) {
-        errorf("attempting to free a vector that doesn't own its data");
-        return 1;
-    }
-    v->heap.free(v->h, v->d);
-    v->d = nil;
-    v->len = 0;
-
-    return 0;
-}
-
-math·Vec
-math·copyvec(math·Vec v)
-{
-    math·Vec cpy;
-    cpy.heap = v.heap;
-    cpy.h    = v.h;
-    cpy.len  = v.len;
-    cpy.d    = cpy.heap.alloc(cpy.h, 1, v.len);
-    
-    memcpy(cpy.d, v.d, sizeof(double)*v.len);
-    return cpy;
-}
-
-/*
- * Scale vector
- */
-
-static
-void
-scale_kernel8_avx2(int n, double *x, double a)
-{
-    __m128d a128;
-    __m256d a256;
-    register int i;
-
-    a128 = _mm_load_sd(&a);
-    a256 = _mm256_broadcastsd_pd(a128);
-    for (i = 0; i < n; i += 8) {
-        _mm256_storeu_pd(x+i+0, a256 * _mm256_loadu_pd(x+i+0));
-        _mm256_storeu_pd(x+i+4, a256 * _mm256_loadu_pd(x+i+4));
-    }
-}
-
-static
-void
-scale_kernel8(int n, double *x, double a)
-{
-    register int i;
-    for (i = 0; i < n; i += 8) {
-        x[i+0] *= a;
-        x[i+1] *= a;
-        x[i+2] *= a;
-        x[i+3] *= a;
-        x[i+4] *= a;
-        x[i+5] *= a;
-        x[i+6] *= a;
-        x[i+7] *= a;
-    }
-}
-
-void
-math·scalevec(math·Vec u, double a)
-{
-    int n;
-
-    n = u.len & ~7;
-    scale_kernel8_avx2(n, u.d, a);
-
-    for (; n < u.len; n++) {
-        u.d[n] *= a;
-    }
-}
-
-/*
- * Add scaled vector
- */
-
-static
-void
-daxpy_kernel8_avx2(int n, double *x, double *y, double a)
-{
-    __m128d a128;
-    __m256d a256;
-    register int i;
-
-    a128 = _mm_load_sd(&a);
-    a256 = _mm256_broadcastsd_pd(a128);
-    for (i = 0; i < n; i += 8) {
-        _mm256_storeu_pd(x+i+0, _mm256_loadu_pd(x+i+0) + a256 * _mm256_loadu_pd(y+i+0));
-        _mm256_storeu_pd(x+i+4, _mm256_loadu_pd(x+i+4) + a256 * _mm256_loadu_pd(y+i+4));
-    }
-}
-
-static
-void
-daxpy_kernel8(int n, double *x, double *y, double a)
-{
-    register int i;
-    for (i = 0; i < n; i += 8) {
-        x[i+0] += a*y[i+0];
-        x[i+1] += a*y[i+1];
-        x[i+2] += a*y[i+2];
-        x[i+3] += a*y[i+3];
-        x[i+4] += a*y[i+4];
-        x[i+5] += a*y[i+5];
-        x[i+6] += a*y[i+6];
-        x[i+7] += a*y[i+7];
-    }
-}
-
-/* performs u = u + a*v */
-void
-math·addvec(math·Vec u, math·Vec v, double a)
-{
-    int n;
-
-    n = u.len & ~7;
-    daxpy_kernel8_avx2(n, u.d, v.d, a);
-
-    for (; n < u.len; n++) {
-        u.d[n] += a*v.d[n];
-    }
-}
-
-/*
- * Dot product
- */
-
-static
-double
-dot_kernel8_avx2(int len, double *x, double *y)
-{
-    register int i;
-    __m256d sum[4];
-    __m128d res;
-
-    for (i = 0; i < arrlen(sum); i++) {
-        sum[i] = _mm256_setzero_pd();
-    }
-
-    for (i = 0; i < len; i += 16) {
-        sum[0] += _mm256_loadu_pd(x+i+0)  * _mm256_loadu_pd(y+i+0);
-        sum[1] += _mm256_loadu_pd(x+i+4)  * _mm256_loadu_pd(y+i+4);
-        sum[2] += _mm256_loadu_pd(x+i+8)  * _mm256_loadu_pd(y+i+8);
-        sum[3] += _mm256_loadu_pd(x+i+12) * _mm256_loadu_pd(y+i+12);
-    }
-
-    sum[0] += sum[1] + sum[2] + sum[3];
-
-    res = _mm_add_pd(_mm256_extractf128_pd(sum[0], 0), _mm256_extractf128_pd(sum[0], 1));
-    res = _mm_hadd_pd(res, res);
-
-    return res[0];
-}
-
-static
-double
-dot_kernel8_fma3(int len, double *x, double *y)
-{
-    register int i;
-    __m256d sum[4];
-    __m128d res;
-
-    for (i = 0; i < arrlen(sum); i++) {
-        sum[i] = _mm256_setzero_pd();
-    }
-
-    for (i = 0; i < len; i += 16) {
-        sum[0] = _mm256_fmadd_pd(_mm256_loadu_pd(x+i+0),  _mm256_loadu_pd(y+i+0), sum[0]);
-        sum[1] = _mm256_fmadd_pd(_mm256_loadu_pd(x+i+4),  _mm256_loadu_pd(y+i+4), sum[1]);
-        sum[2] = _mm256_fmadd_pd(_mm256_loadu_pd(x+i+8),  _mm256_loadu_pd(y+i+8), sum[2]);
-        sum[3] = _mm256_fmadd_pd(_mm256_loadu_pd(x+i+12), _mm256_loadu_pd(y+i+12), sum[3]);
-    }
-
-    sum[0] += sum[1] + sum[2] + sum[3];
-
-    res = _mm_add_pd(_mm256_extractf128_pd(sum[0], 0), _mm256_extractf128_pd(sum[0], 1));
-    res = _mm_hadd_pd(res, res);
-
-    return res[0];
-}
-
-static
-double
-dot_kernel8(int len, double *x, double *y)
-{
-    double res;
-    register int i;
-
-    for (i = 0; i < len; i += 8) {
-        res += x[i]   * y[i]   +
-               x[i+1] * y[i+1] +
-               x[i+2] * y[i+2] +
-               x[i+3] * y[i+3] +
-               x[i+4] * y[i+4] +
-               x[i+5] * y[i+5] +
-               x[i+6] * y[i+6] +
-               x[i+7] * y[i+7];
-    }
-
-    return res;
-}
-
-double
-math·dot(math·Vec u, math·Vec v)
-{
-    int i, len;
-    double res;
-
-    len = u.len & ~15; // neat trick
-    res = dot_kernel8_fma3(len, u.d, v.d);
-
-    for (i = len; i < u.len; i++) {
-        res += u.d[i] * v.d[i];
-    }
-
-    return res;
-}
-
-// -----------------------------------------------------------------------
-// Matrix
-
-typedef struct math·Mtx
-{
-    struct {
-        void         *h;
-        mem·Allocator heap;
-    };
-    int dim[2];
-    double  *d;
-} math·Mtx;
-
-math·Mtx
-math·makemtx(int n, int m, mem·Allocator heap, void *h)
-{
-    math·Mtx a;
-    a.dim[0] = n;
-    a.dim[1] = m;
-    a.heap = heap;
-    a.h    = h;
-    a.d    = heap.alloc(h, 1, n*m*sizeof(double));
-    
-    // memset(a.d, 0, n*m*sizeof(double));
-
-    return a;
-}
-
-error
-math·freemtx(math·Vec *m)
-{
-    if (m->h == nil && m->heap.alloc == nil && m->heap.free == nil) {
-        errorf("attempting to free a matrix that doesn't own its data");
-        return 1;
-    }
-    m->heap.free(m->h, m->d);
-    m->d = nil;
-    m->len = 0;
-
-    return 0;
-}
-
-/************************************************
- * multiply matrix to vector
- ***********************************************/
-
-/* 
- * Notation: (number of rows) x (number of columns) _ unroll factor
- *            N => variable we sum over
- */
-static
-void
-mtxvec_kernel4xN_4_avx2(int ncol, double **row, double *x, double *y)
-{
-    int c;
-    __m128d hr;
-    __m256d x256, r256[4];
-
-    for (c = 0; c < 4; c++) {
-        r256[c] = _mm256_setzero_pd();
-    }
-
-    for (c = 0; c < ncol; c += 4) {
-        x256     = _mm256_loadu_pd(x+c);
-        r256[0] += x256 * _mm256_loadu_pd(row[0] + c);
-        r256[1] += x256 * _mm256_loadu_pd(row[1] + c);
-        r256[2] += x256 * _mm256_loadu_pd(row[2] + c);
-        r256[3] += x256 * _mm256_loadu_pd(row[3] + c);
-    }
-
-    for (c = 0; c < 4; c++) {
-        hr   = _mm_add_pd(_mm256_extractf128_pd(r256[c], 0), _mm256_extractf128_pd(r256[c], 1));
-        hr   = _mm_hadd_pd(hr, hr);
-        y[c] = hr[0];
-    }
-}
-
-static
-void
-mtxvec_kernel4xN_4(int ncol, double **row, double *x, double *y)
-{
-    int c;
-    double res[4];
-
-    res[0] = 0.;
-    res[1] = 0.;
-    res[2] = 0.;
-    res[3] = 0.;
-
-    for (c = 0; c < ncol; c += 4) {
-        res[0] += row[0][c+0]*x[c+0] + row[0][c+1]*x[c+1] + row[0][c+2]*x[c+2] + row[0][c+3]*x[c+3];
-        res[1] += row[1][c+0]*x[c+0] + row[1][c+1]*x[c+1] + row[1][c+2]*x[c+2] + row[1][c+3]*x[c+3];
-        res[2] += row[2][c+0]*x[c+0] + row[2][c+1]*x[c+1] + row[2][c+2]*x[c+2] + row[2][c+3]*x[c+3];
-        res[3] += row[3][c+0]*x[c+0] + row[3][c+1]*x[c+1] + row[3][c+2]*x[c+2] + row[3][c+3]*x[c+3];
-    }
-
-    y[0] = res[0];
-    y[1] = res[1];
-    y[2] = res[2];
-    y[3] = res[3];
-}
-
-static
-void
-mtxvec_kernel1xN_4(int ncol, double *row, double *x, double *y)
-{
-    int c;
-    double res;
-
-    res = 0.;
-    for (c = 0; c < ncol; c += 4) {
-        res += row[c+0]*x[c+0] + row[c+1]*x[c+1] + row[c+2]*x[c+2] + row[c+3]*x[c+3];
-    }
-
-    y[0] = res;
-}
-
-// y = a*mx + b*y
-error
-math·mtxvec(math·Mtx m, double a, math·Vec x, double b, math·Vec y)
-{
-    int c, r, nrow, ncol;
-    double *row[4], res[4];
-
-    nrow = m.dim[0] & ~3;
-    ncol = m.dim[1] & ~3;
-    for (r = 0; r < nrow; r += 4) {
-        row[0] = m.d + (r * (m.dim[1]+0));
-        row[1] = m.d + (r * (m.dim[1]+1));
-        row[2] = m.d + (r * (m.dim[1]+2));
-        row[3] = m.d + (r * (m.dim[1]+3));
-
-        mtxvec_kernel4xN_4_avx2(ncol, row, x.d + r, res);
-
-        for (c = ncol; c < m.dim[1]; c++) {
-            res[0] += row[0][c];
-            res[1] += row[1][c];
-            res[2] += row[2][c];
-            res[3] += row[3][c];
-        }
-
-        y.d[r+0] = res[0] + b*y.d[r+0];
-        y.d[r+1] = res[1] + b*y.d[r+1];
-        y.d[r+2] = res[2] + b*y.d[r+2];
-        y.d[r+3] = res[3] + b*y.d[r+3];
-    }
-
-    for (; r < m.dim[0]; r++) {
-        mtxvec_kernel1xN_4(m.dim[0], m.d + (r * m.dim[1]), x.d + r, res);
-        y.d[r] = res[0] + b*y.d[r];
-    }
-
-    return 0;
-}
-
-/************************************************
- * add matrix to vector outerproduct
- ***********************************************/
-
-#define NITER 50
-
-#if 0
-error
-main()
-{
-    int i;
-    clock_t t;
-    double  res;
-
-    math·Mtx m;
-    math·Vec x, y;
-
-    openblas_set_num_threads(1);
-
-    x = math·makevec(1000, mem·sys, nil);
-    y = math·makevec(1000, mem·sys, nil);
-    m = math·makemtx(1000, 1000, mem·sys, nil);
-
-    for (i = 0; i < x.len; i++) {
-        y.d[i] = i;
-    }
-
-    t = clock();
-    for (i = 0; i < NITER; i++) {
-        cblas_dgemv(CblasRowMajor, CblasNoTrans, m.dim[0], m.dim[1], 1.5, m.d, m.dim[1], x.d, 1, 2.5, y.d, 1);
-    }
-    t   = clock() - t;
-    res = math·dot(y, y);
-    printf("the result is %f\n", res);
-    printf("time elapsed (blas): %fms\n", 1000.*t/CLOCKS_PER_SEC);
-
-    for (i = 0; i < x.len; i++) {
-        y.d[i] = i;
-    }
-
-    t = clock();
-    for (i = 0; i < NITER; i++) {
-        math·mtxvec(m, 1.5, x, 2.5, y);
-    }
-    t   = clock() - t;
-    res = math·dot(y, y);
-
-    printf("the dot product is %f\n", res);
-    printf("time elapsed (naive): %fms\n", 1000.*t/CLOCKS_PER_SEC);
-
-
-    return 0;
-}
-#endif
diff --git a/sys/libsre/lex.c b/sys/libsre/lex.c
deleted file mode 100644
index f4c6ac2..0000000
--- a/sys/libsre/lex.c
+++ /dev/null
@@ -1,246 +0,0 @@
-#include "sre.h"
-
-static
-State *
-state(Machine *m, int t)
-{
-    if (m->state >= m->statestk + arrlen(m->statestk))
-        panicf("regexp vm: out of state space");
-
-    m->state->type = t;
-    m->state->l = nil;
-    m->state->r = nil;
-    
-    return m->state++;
-}
-
-static
-int
-poptor(Parser *p)
-{
-    if (p->optor <= p->optorstk) 
-        panicf("regexp parser: opand stack underflow");
-
-    return *--p->optor;
-}
-
-static
-void
-pushtor(Parser *p, int t)
-{
-    if (p->optor >= arrend(p->optorstk))
-        panicf("regexp parser: opand stack overflow");
-
-    *p->optor++ = t;
-}
-
-static
-void
-pushand(Parser *p, State *beg, State *end)
-{
-    if (p->node >= arrend(p->nodestk))
-        panicf("regexp parser: opand stack overflow");
-
-    p->node->beg = beg;
-    p->node->end = end;
-
-    p->node++;
-}
-
-static
-Node *
-popand(Parser *p)
-{
-    if (p->node <= p->nodestk)
-        panicf("regexp parser: opand stack underflow");
-
-    return --p->node;
-}
-
-static
-void
-operateuntil(Parser *p, int prec)
-{
-    Node  *o1, *o2, *t;
-    State *s1, *s2;
-
-    while (prec == Trparen || p->optor[-1] >= prec) {
-        switch (poptor(p)) {
-        case Tor:
-            o1 = popand(p);
-            o2 = popand(p);
-
-            s1 = state(p->mach, Tor);
-            s2 = state(p->mach, Tnop);
-            s1->l = o1->beg;
-            s1->r = o2->beg;
-
-            o1->end->out = s2;
-            o2->end->out = s2;
-
-            pushand(p, s1, s2);
-            break;
-
-        case Tcat:
-            o1 = popand(p);
-            o2 = popand(p);
-
-            o1->end->out = o2->beg;
-            pushand(p, o1->beg, o2->end);
-            break;
-
-        case Tstar:
-            o1 = popand(p);
-            s1 = state(p->mach, Tor);
-            o1->end->out = s1;
-            s1->l = o1->beg;
-            pushand(p, s1, s1);
-            break;
-
-        case Tplus:
-            o1 = popand(p);
-            s1 = state(p->mach, Tor);
-            o1->end->out = s1;
-            s1->l = o1->beg;
-            pushand(p, o1->beg, s1);
-            break;
-
-        case Tqmark:
-            o1 = popand(p);
-            s1 = state(p->mach, Tor);
-            s2 = state(p->mach, Tnop);
-            s1->l = o1->beg;
-            s1->r = s2;
-            o1->end->out = s2;
-            pushand(p, s1, s2);
-            break;
-
-        default:
-            panicf("unsupported regexp operator");
-        }
-    }
-}
-
-static
-void
-operator(Parser *p, int t)
-{
-    operateuntil(p, t);
-    pushtor(p, t);
-    p->wasopand = (t != Tstar && t != Tqmark && t != Tplus && t != Trparen);
-}
-
-static
-void
-operand(Parser *p, int t)
-{
-    State *new;
-    if (p->wasopand)
-        operator(p, Tcat);
-    
-    new = state(p->mach, t);
-    pushand(p, new, new);
-    p->wasopand = true;
-}
-
-#define cinc 20
-int
-lex(Parser *p)
-{
-    int  c, t;
-    byte *class;
-    long n, cap;
-
-    c = *p->re++;
-    switch (c) {
-    case '\\':
-        if (*p->re)
-            if ((c = *p->re++) == '\n')
-                c = '\n';
-        break;
-    case '\0':
-        c = Tend,
-        --p->re;
-        break;
-    case '*':
-        c = Tstar;
-        break;
-    case '?':
-        c = Tqmark;
-        break;
-    case '+':
-        c = Tplus;
-        break;
-    case '|':
-        c = Tor;
-        break;
-    case '.':
-        c = Tany;
-        break;
-    case '(':
-        c = Tlparen;
-        break;
-    case ')':
-        c = Trparen;
-        break;
-    case '^':
-        c = Tbol;
-        break;
-    case '$':
-        c = Teol;
-        break;
-    case '[':
-        goto charclass;
-    default: 
-        ;
-    }
-    return c;
-
-charclass:
-    panicf("to implement");
-}
-
-#undef cinc
-
-static
-State*
-optimize(State *entry)
-{
-    State *curr, *next;
-    for (curr=entry; curr->type != Tend; curr++) {
-        next = curr->out;
-        while (next->type == Tnop) 
-            next = next->out;
-        curr->out = next;
-    }
-
-    return entry;
-}
-
-void
-sre·compile(Machine *mach, byte *regexp)
-{
-    int  tok;
-    Parser p;
-    Node  *prog;
-
-    p = (Parser) {
-        .re   = regexp,
-        .mach = mach,
-        .node = p.nodestk,
-    };
-
-    pushtor(&p, Tstart - 1);
-    while ((tok = lex(&p)) != Tend) {
-        if ((tok & isoptor) == Toperator)
-            operator(&p, tok);
-        else
-            operand(&p, tok);
-    }
-    operateuntil(&p, Tstart);
-    operand(&p, Tend);
-    operateuntil(&p, Tstart);
-
-    prog = popand(&p);
-    mach->entry = optimize(prog->beg);
-}
diff --git a/sys/libsre/sre.h b/sys/libsre/sre.h
deleted file mode 100644
index a7ace1a..0000000
--- a/sys/libsre/sre.h
+++ /dev/null
@@ -1,93 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <libn.h>
-
-enum
-{
-    Toperator = RuneMask + 1,
-    Tstart    = Toperator,
-    Trparen,
-    Tlparen,
-    Tor,
-    Tcat,
-    Tstar,
-    Tplus,
-    Tqmark,
-
-    Tany = Toperator << 1,
-    Tnop,
-    Tbol,
-    Teol,
-    Tcclass,
-    Tnclass,
-    Tend,
-
-    isoptor = Toperator,
-    isopand = Toperator << 1,
-};
-
-typedef struct Class Class;
-typedef struct State State;
-typedef struct Patch Patch;
-typedef struct Node Node;
-
-typedef struct Parser  Parser;
-typedef struct Machine Machine;
-
-struct Class
-{
-    rune *end;
-    rune span[64];
-};
-
-struct State 
-{
-    int type;
-    union {
-        State *l;
-    };
-    union {
-        State *r;
-        State *out;
-    };
-};
-
-struct Patch
-{
-    State *s;
-    Patch *link;
-};
-
-struct Node
-{
-    State *beg;
-    State *end;
-};
-
-struct Parser
-{
-    Machine *mach;
-    byte    *re;
-    int     wasopand : 1;
-    int     *optor, optorstk[1000];
-    Node    *node,  nodestk[1000];
-};
-
-struct Machine
-{
-    /* memory buffers */
-    struct {
-        void *heap;
-        mem·Reallocator;
-    };
-    State *state, statestk[1000];
-
-    struct {
-        int   cap;
-        int   len;
-        Class *c;
-    } class;
-
-    State *entry;
-};
diff --git a/sys/libterm/term.c b/sys/libterm/term.c
deleted file mode 100644
index 11591fc..0000000
--- a/sys/libterm/term.c
+++ /dev/null
@@ -1,489 +0,0 @@
-#include "term.h"
-
-#include <signal.h>
-#include <sys/ioctl.h>
-
-struct ExtraInfo
-{
-    char *enteralt;
-    char *exitalt;
-
-    char *entermouse;
-    char *exitmouse;
-};
-
-static 
-struct ExtraInfo vt200 =
-{
-    .enteralt = "\e[?1049h",
-    .exitalt  = "\e[?1049l",
-
-    .entermouse = "\e[?1049h\e[?1006l",
-    .exitmouse  = "\e[?1002l\e[?1006l",
-};
-
-static Term *sigwinchhead; 
-
-// -----------------------------------------------------------------------
-// database lookup
-
-static
-char*
-tryinfostr(Term *t, enum unibi_string s)
-{
-    char *val = (char*)unibi_get_str(t->info, s);
-    /* TODO: provide fallbacks */
-    return val;
-}
-
-static
-char*
-guessinfostr(Term *t, enum unibi_string s, char *guess)
-{
-    char *val = (char*)unibi_get_str(t->info, s);
-    if (!val)
-        return guess;
-    return val;
-}
-
-static
-char*
-getinfostr(Term *t, enum unibi_string s)
-{
-    char *val = tryinfostr(t, s);
-    if (!val)
-        panicf("required term info string '%s' missing", unibi_name_str(s));
-
-    return val;
-}
-
-static
-char *
-tryextrastr(Term *t, char *name)
-{
-    const char *nm;
-    size_t max = unibi_count_ext_str(t->info);
-    for (size_t i = 0; i < max; i++) {
-        nm = unibi_get_ext_str_name(t->info, i);
-        if (nm && !strcmp(nm, name)) {
-            return (char *)nm;
-        }
-    }
-    return nil;
-}
-
-static
-char *
-guessextrastr(Term *t, char *name, char *guess)
-{
-    char *s;
-    if ((s = tryextrastr(t, name)))
-        return s;
-
-    return guess;
-}
-
-/* formats escape strings and writes to output */
-static void tfmt(Term *t, char *esc, int n, ...);
-static void tclear(Term *t);
-
-// -----------------------------------------------------------------------
-// exported term methods
-
-static
-char *
-ttmpbuf(Term *t, int len)
-{
-    if (t->tmp.len >= len)
-        return t->tmp.b;
-
-    /* TODO: error handling */
-    return (t->tmp.b = realloc(t->tmp.b, len));
-}
-
-void twrite(Term *t, long len, char *s);
-void tlistensigwinch(Term *t);
-
-Term*
-tmake(void)
-{
-    Term *t;
-
-    t = calloc(1, sizeof(*t));
-
-    /* meta data */
-    t->name = getenv("TERM");
-    t->info = unibi_from_term(t->name);
-    if (!t->info)
-        panicf("could not identify terminal");
-
-    t->fd = 1; // stdout
-    tlistensigwinch(t);
-
-    t->mode.mouse     = 0;
-    t->mode.cursorvis = 1;
-    t->mode.altscreen = 0;
-
-    t->cap.colors = unibi_get_num(t->info, unibi_max_colors);
-    t->cap.bce    = unibi_get_bool(t->info, unibi_back_color_erase);
-
-    /* initialize root window (get current size)*/
-    struct winsize ws = { 0 };
-    if (ioctl(t->fd, TIOCGWINSZ, &ws) == 1)
-        goto bad;
-
-    t->root = wmake(nil, 0, 0, ws.ws_col, ws.ws_row, 0);
-
-    t->root->curvis = 1;
-    t->root->blink  = 0;
-
-    t->pen = (Pen){
-        .state = PenNormal,
-        .col   = {.fg = -1, .bg = -1},
-    };
-
-    /* fill in output buffers */
-    t->buf.c   = t->buf.b;
-    t->tmp.b   = nil;
-    t->tmp.len = 0;
-
-    /* get all term info format strings */
-    t->esc.cup    = getinfostr(t, unibi_cursor_address);
-    t->esc.vpa    = tryinfostr(t, unibi_row_address);
-    t->esc.hpa    = tryinfostr(t, unibi_column_address);
-    t->esc.cuu    = getinfostr(t, unibi_parm_up_cursor);
-    t->esc.cuu1   = tryinfostr(t, unibi_cursor_up);
-    t->esc.cud    = getinfostr(t, unibi_parm_down_cursor);
-    t->esc.cud1   = tryinfostr(t, unibi_cursor_down);
-    t->esc.cuf    = getinfostr(t, unibi_parm_right_cursor);
-    t->esc.cuf1   = tryinfostr(t, unibi_cursor_right);
-    t->esc.cub    = getinfostr(t, unibi_parm_left_cursor);
-    t->esc.cub1   = tryinfostr(t, unibi_cursor_left);
-    t->esc.ich    = getinfostr(t, unibi_parm_ich);
-    t->esc.ich1   = tryinfostr(t, unibi_insert_character);
-    t->esc.dch    = getinfostr(t, unibi_parm_dch);
-    t->esc.dch1   = tryinfostr(t, unibi_delete_character);
-    t->esc.il     = getinfostr(t, unibi_parm_insert_line);
-    t->esc.il1    = tryinfostr(t, unibi_insert_line);
-    t->esc.dl     = getinfostr(t, unibi_parm_delete_line);
-    t->esc.dl1    = tryinfostr(t, unibi_delete_line);
-    t->esc.ech    = getinfostr(t, unibi_erase_chars);
-    t->esc.ed2    = getinfostr(t, unibi_clear_screen);
-    t->esc.stbm   = getinfostr(t, unibi_change_scroll_region);
-    t->esc.sgr    = getinfostr(t, unibi_set_attributes);
-    t->esc.sgr0   = getinfostr(t, unibi_exit_attribute_mode);
-    t->esc.sgr_i0 = tryinfostr(t, unibi_exit_italics_mode);
-    t->esc.sgr_i1 = tryinfostr(t, unibi_enter_italics_mode);
-    t->esc.sgr_fg = getinfostr(t, unibi_set_a_foreground);
-    t->esc.sgr_bg = getinfostr(t, unibi_set_a_background);
-    t->esc.sm_csr = getinfostr(t, unibi_cursor_normal);
-    t->esc.rm_csr = getinfostr(t, unibi_cursor_invisible);
-
-    /* extensions to terminfo */
-    t->esc.ext.rgbf = guessextrastr(t, "setrgbf", "\x1b[38;2;%p1%d;%p2%d;%p3%dm");
-    t->esc.ext.rgbb = guessextrastr(t, "setrgbb", "\x1b[48;2;%p1%d;%p2%d;%p3%dm");
-
-    return t;
-
-bad:
-    panicf("failed to initialize terminal instance");
-    free(t);
-    return nil;
-}
-
-void
-tfree(Term *t)
-{
-    if (t->mode.mouse)
-        twrite(t, 0, vt200.exitmouse);
-    if (!t->mode.cursorvis)
-        tfmt(t, t->esc.rm_csr, 0);
-    if (t->mode.altscreen)
-        twrite(t, 0, vt200.exitalt);
-
-    tfmt(t, t->esc.sgr0, 0);
-    tclear(t);
-    free(t);
-}
-
-/* handle resize events */
-void
-tresize(Term *t)
-{
-    if (t->fd == -1)
-        return;
-
-    struct winsize ws = { 0 };
-    if (ioctl(t->fd, TIOCGWINSZ, &ws) == 1)
-        return;
-
-    printf("[%d,%d]\n", ws.ws_col, ws.ws_row);
-    if (t->root->w != ws.ws_col || t->root->h != ws.ws_row)
-        wresize(t->root, ws.ws_col, ws.ws_row);
-}
-
-static
-void
-sigwinch(int num)
-{
-    Term *it;
-    for (it = sigwinchhead; it; it = it->link)
-        tresize(it);
-}
-
-void
-tlistensigwinch(Term *t)
-{
-    sigset_t new, old;
-    Term *it;
-
-    sigemptyset(&new);
-    sigaddset(&new, SIGWINCH);
-    sigprocmask(SIG_BLOCK, &new, &old);
-
-    if (!sigwinchhead) {
-        sigaction(SIGWINCH, &(struct sigaction){ .sa_handler = sigwinch }, nil);
-        sigwinchhead = t;
-    } else {
-        it = sigwinchhead;
-        while (it->link)
-            it = it->link;
-        it->link = t;
-    }
-
-    sigprocmask(SIG_SETMASK, &old, nil);
-}
-
-void
-tflush(Term *t)
-{
-    if (t->fd != -1)
-        write(t->fd, t->buf.b, t->buf.c - t->buf.b);
-
-    t->buf.c = t->buf.b;
-}
-
-void
-twrite(Term *t, long len, char *s)
-{
-    int n;
-    if (!len)
-        len = strlen(s);
-
-loop:
-    n = MIN(len, arrend(t->buf.b) - t->buf.c);
-    memcpy(t->buf.c, s, n);
-    t->buf.c += n;
-    len      -= n;
-    if (len) {
-        tflush(t);
-        goto loop;
-    }
-}
-
-void
-tsetpen(Term *t, Pen new)
-{
-    int c;
-    ushort ic, in;
-    Pen cur = t->pen;
-    if (!memcmp(&new, &cur, sizeof(new)))
-        return;
-
-    /* attributes */
-    tfmt(t, t->esc.sgr, 9,
-        0, /* standout */
-        new.state & PenUnderline,
-        new.state & PenReverse,
-        new.state & PenBlink,
-        new.state & PenDim,
-        new.state & PenBold,
-        new.state & PenInvis,
-        0,   /* protect */
-        0);  /* alt     */
-
-    ic = cur.state & PenItalic;
-    in = new.state & PenItalic;
-    if (ic & ~in)
-        tfmt(t, t->esc.sgr_i0, 0);
-    else if (~ic & in)
-        tfmt(t, t->esc.sgr_i1, 0);
-
-    /* fg/bg color */
-    /* TODO: add a check for if the terminal supports true color */
-    /* TODO: deal w/ negative indices properly */
-    if (new.state & PenRGB) {
-        tfmt(t, t->esc.ext.rgbf, 3, new.rgb.fg.r, new.rgb.fg.g, new.rgb.fg.b);
-        tfmt(t, t->esc.ext.rgbb, 3, new.rgb.bg.r, new.rgb.bg.g, new.rgb.bg.b);
-    } else {
-        tfmt(t, t->esc.sgr_fg, 1, new.col.fg);
-        tfmt(t, t->esc.sgr_bg, 1, new.col.bg);
-    }
-
-    t->pen = new;
-}
-
-static
-void
-tfmt(Term *t, char *esc, int n, ...)
-{
-    int  i;
-    long len;
-    va_list args;
-    unibi_var_t param[9];
-    char buf[64], *c = buf;
-
-    if (!esc)
-        panicf("no terminfo escape string given");
-
-    va_start(args, n);
-    for (i = 0; i < arrlen(param) && i < n; i++) {
-        param[i] = unibi_var_from_num(va_arg(args, int));
-    }
-    va_end(args);
-
-    len = unibi_run(esc, param, c, sizeof(buf));
-    if (len >= arrlen(buf)) {
-        c = ttmpbuf(t, len);
-        unibi_run(esc, param, c, len);
-    }
-
-    twrite(t, len, c);
-}
-
-/* absolute move */
-static
-int
-tgoto(Term *t, int row, int col)
-{
-    if (row != -1 && col != -1)
-        tfmt(t, t->esc.cup, 2, row, col);
-    else if (row != -1) {
-        if (!t->esc.vpa)
-            return 0;
-        tfmt(t, t->esc.vpa, 1, row);
-    } else if (col != -1) {
-        if (col == 0) {
-            twrite(t, 1, "\r");
-            return 1;
-        }
-        if (t->esc.hpa)
-            tfmt(t, t->esc.hpa, 1, col);
-        else if (t->esc.cuf) {
-            twrite(t, 1, "\r");
-            tfmt(t, t->esc.cuf, 1, col);
-        } else
-            return 0;
-    } else
-        return 0; /* unreachable */
-
-    return 1;
-}
-
-/* relative move */
-static
-void
-tjump(Term *t, int down, int right)
-{
-  if (down == 1 && t->esc.cud1)
-    tfmt(t, t->esc.cud1, 0);
-  else if (down == -1 && t->esc.cuu1)
-    tfmt(t, t->esc.cuu1, 0);
-  else if (down > 0)
-    tfmt(t, t->esc.cud, 1, down);
-  else if (down < 0)
-    tfmt(t, t->esc.cuu, 1, -down);
-
-  if (right == 1 && t->esc.cuf1)
-    tfmt(t, t->esc.cuf1, 0);
-  else if (right == -1 && t->esc.cub1)
-    tfmt (t, t->esc.cub1, 0);
-  else if (right > 0)
-    tfmt(t, t->esc.cuf, 1, right);
-  else if( right < 0)
-    tfmt(t, t->esc.cub, 1, -right);
-}
-
-static
-void
-tclear(Term *t)
-{
-    tfmt(t, t->esc.ed2, 0);
-}
-
-void
-tblit(Term *t, Window *win)
-{
-    int r, c, n, j;
-    Row *row;
-    char u[UTFmax+1] = {0};
-
-    j = 0;
-    tgoto(t, win->top, win->left);
-    for (r = 0; r < win->h; r++) {
-        row = win->row + r;
-        if (!row->dirty) {
-            j++;
-            continue;
-        }
-
-        if (j) {
-            tjump(t, j, 0);
-            j = 0;
-        }
-
-        for (c = 0; c < win->w; c++) {
-            tsetpen(t, row->cells[c].pen);
-            n = utf8·runetobyte(u, &row->cells[c].txt);
-            twrite(t, n, u);
-        }
-
-        row->dirty = 0;
-    }
-
-    tflush(t);
-}
-
-// -----------------------------------------------------------------------
-// testing
-
-int
-main()
-{
-    int i;
-    Term   *t;
-    Window *win;
-
-    t   = tmake();
-    win = t->root;
-    tclear(t);
-
-    win->pen = (Pen){
-        .state = PenNormal,
-        .col   = {.fg=-1, .bg=-1},
-    };
-    for (i = 0; i < 2000; i++)
-        wputrune(win, 'a');
-
-    tblit(t, win);
-
-    win->cur.row = 10;
-    win->cur.col = 0;
-
-    win->pen = (Pen){
-        .state=PenNormal|PenRGB,
-        .rgb={.fg={200, 100, 100}, .bg={0, 0, 0} },
-    };
-
-    for (i = 0; i < 500; i++)
-        wputrune(win, 'b');
-
-    tblit(t, win);
-
-    sleep(5);
-    wscroll(win, 10);
-    tblit(t, win);
-    sleep(5);
-
-    tfree(t);
-}
diff --git a/sys/libterm/term.h b/sys/libterm/term.h
deleted file mode 100644
index 6bd2f6b..0000000
--- a/sys/libterm/term.h
+++ /dev/null
@@ -1,270 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <libn.h>
-
-#include <termios.h>
-#include <unibilium.h>
-
-#define iota(x)             1 << (x)
-
-typedef struct RGB8   RGB8;
-typedef struct Pen    Pen;
-
-typedef struct Dot    Dot;
-typedef struct Cell   Cell;
-typedef struct Row    Row;
-typedef struct Buffer Buffer;
-typedef struct Window Window;
-
-typedef struct Node   Node;
-typedef struct Key    Key;
-typedef struct Input  Input;
-
-typedef struct Term   Term;
-
-struct RGB8
-{
-    uint8 r, g, b;
-};
-
-enum
-{
-    PenNormal    = 0,
-    PenBold      = iota(0),
-    PenDim       = iota(1),
-    PenInvis     = iota(2),
-    PenItalic    = iota(3),
-    PenReverse   = iota(4),
-    PenStrike    = iota(5),
-    PenUnderline = iota(6),
-    PenBlink     = iota(7),
-    /* ... */
-    PenRGB       = iota(15),
-};
-
-struct Pen
-{
-    ushort state;
-    union {
-        /* 256 color (legacy) */
-        struct {
-            sshort fg : 8, bg : 8; /* 0 - 255 or COLOUR_DEFAULT */
-        } col;
-        /* true color (modern) */
-        struct {
-            RGB8 fg, bg;
-        } rgb;
-    };
-};
-
-/* outputs */
-struct Cell 
-{
-    rune txt;
-    Pen  pen;
-}; 
-
-struct Row 
-{
-	Cell *cells;
-	uint  dirty : 1;
-};
-
-struct Dot
-{
-    int row, col;
-};
-
-/*
- * scroll.top & scroll.bot are pointers into the viewport.
- *
- *                                     scroll back buffer
- *
- *                      scroll.buf->+----------------+-----+
- *                                  |                |     | ^  \
- *                                  |     before     |     | |  |
- *    current terminal content      |    viewport    |     | |  |
- *                                  |                |     |    |
- *    +----------------+-----+\     |                |     | s   > scroll.above
- *  ^ |                |  i  | \    |                |  i  | c  |
- *  | |                |  n  |  \   |                |  n  | r  |
- *    |                |  v  |   \  |                |  v  | o  |
- *    |                |  i  |    \ |                |  i  | l  /
- *    |    buffer      |  s  |     >|<- scroll.index |  s  | l  \
- *  h |                |  i  |    / |                |  i  |    |
- *    |                |  b  |   /  |     after      |  b  | s   > scroll.below
- *    |                |  l  |  /   |    viewport    |  l  | i  |
- *  v |                |  e  | /    |                |  e  | z  /
- *    +----------------+-----+/     |     unused     |     | e
- *     <-    maxw         ->        |   scroll back  |     |
- *     <-    w       ->             |     buffer     |     | |
- *                                  |                |     | |
- *                                  |                |     | v
- *        scroll.buf + scroll.size->+----------------+-----+
- *                                   <-    maxw           ->
- *                                   <-    w       ->
- */
-
-struct Buffer 
-{
-	int   w, h;        /* dimension of buffer */
-    Pen   pen;         /* default attributes */
-	int   maxw;        /* allocated cells (maximal cols over time) */
-	Row  *row;         /* array of row pointers of size 'h' */
-    struct {
-        Row *buf;
-        Row *top;
-        Row *bot;
-        int size;
-        int index;
-        int above;
-        int below;
-    } scroll;
-    Dot  cur, save;    /* cursor position within buffer */
-};
-
-struct Window
-{
-    struct Buffer;
-    int     top,  left;
-    uchar   curvis : 1;
-    uchar   blink  : 2;
-
-    Window *parent, *child, *link;
-};
-
-/* input */
-struct Key 
-{
-    int   type;
-    int   mods;
-    uchar utf8[UTFmax+1];
-    union {
-        rune pt;
-        int  num;
-        int  sym;
-        char mouse[4];
-    } code;
-};
-
-struct KeyInfo
-{
-    int type;
-    int sym;
-    int modmask;
-    int modset;
-};
-
-struct Input
-{
-    int fd;
-    int flags;
-    int wait; /* in ms */
-
-    /* modifiers */
-    uchar closed  : 1;
-    uchar started : 1;
-    uchar hasold  : 1;
-
-    struct termios oldterm;
-
-    /* buffer */
-    struct {
-        long off;
-        uchar *b, *c, *e, bytes[256];
-    } rbuf;
-    struct {
-        uchar *s, bytes[256];
-    } ebuf;
-
-    /* key data */
-    Node  *keys;
-    struct KeyInfo c0[32];
-};
-
-
-struct Term
-{
-    /* meta data */
-    char       *name;
-    unibi_term *info;
-    struct {
-        uchar  altscreen : 1;
-        uchar  cursorvis : 1;
-        uchar  mouse     : 1;
-    } mode;
-    struct {
-        uchar bce : 1;
-        int   colors;
-    } cap;
-
-    /* input capture */
-    Input input;
-
-    /* output display */
-    Window *root;
-    Pen     pen;
-
-    /* raw text to pty */
-    int fd;
-    struct {
-        char *c, b[512];
-    } buf;
-
-    struct {
-        int len;
-        char *b;
-    } tmp;
-
-    /* info */
-    struct {
-        /* Positioning */
-        char *cup;  // cursor_address
-        char *vpa;  // row_address   == vertical position absolute
-        char *hpa;  // column_address = horizontal position absolute
-
-        /* Moving */
-        char *cuu; char *cuu1; // Cursor Up
-        char *cud; char *cud1; // Cursor Down
-        char *cuf; char *cuf1; // Cursor Forward == Right
-        char *cub; char *cub1; // Cursor Backward == Left
-
-        /* Editing */
-        char *ich; char *ich1; // Insert Character
-        char *dch; char *dch1; // Delete Character
-        char *il;  char *il1;  // Insert Line
-        char *dl;  char *dl1;  // Delete Line
-        char *ech;             // Erase Character
-        char *ed2;             // Erase Data 2 == Clear screen
-        char *stbm;            // Set Top/Bottom Margins
-
-        /* formatting */
-        char *sgr;              // Select Graphic Rendition
-        char *sgr0;             // Exit Attribute Mode
-        char *sgr_i0, *sgr_i1;  // SGR italic off/on
-        char *sgr_fg;           // SGR foreground colour
-        char *sgr_bg;           // SGR background colour
-
-        /* Mode setting/clearing */
-        char *sm_csr; char *rm_csr; // Set/reset mode: Cursor visible
-
-        /* augmentations to terminfo */
-        struct {
-            char *rgbf;  // rgb foreground
-            char *rgbb;  // rgb background
-            char *smxx;  // strikethrough
-            char *smulx; // curly underline
-        } ext;
-    } esc;
-
-    Term *link;
-};
-
-/* functions */
-void    tresize(Term *t);
-
-Window *wmake(Window *root, int top, int left, int w, int h, int scroll);
-void    wresize(Window *root, int w, int h);
-void    wputrune(Window *win, rune r);
-void    wscroll(Window *win, int s);
diff --git a/sys/libterm/window.c b/sys/libterm/window.c
deleted file mode 100644
index 5d36c8b..0000000
--- a/sys/libterm/window.c
+++ /dev/null
@@ -1,408 +0,0 @@
-#include "term.h"
-
-// -----------------------------------------------------------------------
-// buffers
-
-static
-void 
-zero(Row *row, int start, int len)
-{
-    int i;
-	Cell cell = {
-		.txt = L' ',
-        .pen = {
-            .state  = PenNormal,
-            .col.fg = -1,
-            .col.bg = -1,
-        },
-	};
-
-	for (i = start; i < len + start; i++)
-		row->cells[i] = cell;
-	row->dirty = 1;
-}
-
-static
-void 
-roll(Row *start, Row *end, int count)
-{
-	int n = end - start;
-
-    /* enforce circularity */
-	count %= n;
-	if (count < 0)
-		count += n;
-
-	if (count) {
-		char buf[count * sizeof(Row)]; /* XXX: remove VLA */
-		memcpy(buf, start, count * sizeof(Row));
-		memmove(start, start + count, (n - count) * sizeof(Row));
-		memcpy(end - count, buf, count * sizeof(Row));
-
-		for (Row *row = start; row < end; row++)
-			row->dirty = 1;
-	}
-}
-
-/* buffer operations */
-static
-void 
-bclear(Buffer *b)
-{
-    int i;
-	Cell cell = {
-		.txt = L' ',
-        .pen = {
-            .state  = PenNormal,
-            .col.fg = -1,
-            .col.bg = -1,
-        },
-	};
-
-	for (i = 0; i < b->h; i++) {
-		Row *row = b->row + i;
-		for (int j = 0; j < b->w; j++) {
-			row->cells[j] = cell;
-			row->dirty    = 1;
-		}
-	}
-}
-
-static
-void 
-bfini(Buffer *b)
-{
-    int i;
-
-	for (i = 0; i < b->h; i++)
-		free(b->row[i].cells);
-
-	free(b->row);
-
-    if (b->scroll.size) {
-        for (i = 0; i < b->scroll.size; i++)
-            free(b->scroll.buf[i].cells);
-
-        free(b->scroll.buf);
-    }
-}
-
-static
-void 
-bscroll(Buffer *b, int s)
-{
-    Row tmp;
-	int i, ssz = b->scroll.bot - b->scroll.top;
-
-	/* work in quanta of screen size */
-	if (s > ssz) {
-		bscroll(b, ssz);
-		bscroll(b, s - ssz);
-		return;
-	}
-	if (s < -ssz) {
-		bscroll(b, -ssz);
-		bscroll(b, s + ssz);
-		return;
-	}
-
-	b->scroll.above += s;
-    b->scroll.above  = CLAMP(b->scroll.above, 0, b->scroll.size);
-
-	if (s > 0) {
-        if (b->scroll.size) {
-            for (i = 0; i < s; i++) {
-                tmp = b->scroll.top[i];
-                b->scroll.top[i] = b->scroll.buf[b->scroll.index];
-                b->scroll.buf[b->scroll.index] = tmp;
-
-                b->scroll.index++;
-                if (b->scroll.index == b->scroll.size)
-                    b->scroll.index = 0;
-            }
-        } else 
-            for (i = 0; i < s; i++)
-                zero(b->scroll.top+i, 0, b->maxw);
-	}
-
-	roll(b->scroll.top, b->scroll.bot, s);
-
-	if (s < 0) {
-        if (b->scroll.size) {
-            for (i = (-s) - 1; i >= 0; i--) {
-                b->scroll.index--;
-                if (b->scroll.index == -1)
-                    b->scroll.index = b->scroll.size - 1;
-
-                tmp = b->scroll.top[i];
-
-                b->scroll.top[i] = b->scroll.buf[b->scroll.index];
-                b->scroll.buf[b->scroll.index] = tmp;
-                b->scroll.top[i].dirty = 1;
-            }
-        } else
-            for (i = (-s) - 1; i >= 0; i--)
-                zero(b->scroll.top+i, 0, b->maxw);
-	}
-}
-
-static
-void 
-bresize(Buffer *b, int nrow, int ncol)
-{
-    int r, d;
-	Row *row = b->row;
-	Row *cur = row + b->cur.row;
-
-	if (b->h != nrow) {
-        /* scroll if we can */
-		if (cur >= row + nrow)
-			bscroll(b, b->cur.row - nrow + 1);
-		while (b->h > nrow) {
-			free(row[b->h - 1].cells);
-			b->h--;
-		}
-
-		row = realloc(row, sizeof(Row) * nrow);
-	}
-
-	if (b->maxw < ncol) {
-        /* expand each row */
-		for (r = 0; r < b->h; r++) {
-			row[r].cells = realloc(row[r].cells, sizeof(Cell) * ncol);
-			if (b->h < ncol)
-				zero(row + r, b->w, ncol - b->w);
-			row[r].dirty = 1;
-		}
-        /* expand the scroll buffer */
-		Row *sbuf = b->scroll.buf;
-		for (r = 0; r < b->scroll.size; r++) {
-			sbuf[r].cells = realloc(sbuf[r].cells, sizeof(Cell) * ncol);
-			if (b->w < ncol)
-				zero(sbuf + r, b->w, ncol - b->w);
-		}
-		b->maxw = b->w = ncol;
-	} else if (b->w != ncol) {
-		for (r = 0; r < b->h; r++)
-			row[r].dirty = 1;
-		b->w = ncol;
-	}
-
-	d = 0;
-	if (b->h < nrow) {
-		while (b->h < nrow) {
-			row[b->h].cells = calloc(b->maxw, sizeof(Cell));
-			zero(row + b->h, 0, b->maxw);
-			b->h++;
-		}
-
-		/* prepare for backfill */
-		if (cur >= b->scroll.bot - 1) {
-			d = b->row + nrow - cur - 1;
-			if (d > b->scroll.above)
-				d = b->scroll.above;
-		}
-	}
-
-	b->cur.row  += row - b->row;
-	b->scroll.top = row;
-	b->scroll.bot = row + nrow;
-	b->row = row;
-
-	/* perform backfill */
-	if (d > 0) {
-		bscroll(b, -d);
-		b->cur.row += d;
-	}
-}
-
-static
-bool 
-binit(Buffer *b, int cols, int rows, int scroll)
-{
-    int size;
-
-    b->pen.state  = PenNormal;
-    b->pen.col.fg = b->pen.col.bg = -1;
-
-    size = MAX(scroll, 0);
-	if (size && !(b->scroll.buf = calloc(size, sizeof(Row))))
-		return false;
-
-	b->scroll.size = size;
-	bresize(b, rows, cols);
-
-    b->cur  = (Dot){0};
-    b->save = b->cur;
-
-	return true;
-}
-
-static
-void 
-bboundary(Buffer *b, Row **bs, Row **be, Row **as, Row **ae) 
-{
-	if (bs)
-		*bs = nil;
-	if (be)
-		*be = nil;
-	if (as)
-		*as = nil;
-	if (ae)
-		*ae = nil;
-	if (!b->scroll.size)
-		return;
-
-	if (b->scroll.above) {
-		if (bs)
-			*bs = &b->scroll.buf[(b->scroll.index - b->scroll.above + b->scroll.size) % b->scroll.size];
-		if (be)
-			*be = &b->scroll.buf[(b->scroll.index-1 + b->scroll.size) % b->scroll.size];
-	}
-	if (b->scroll.below) {
-		if (as)
-			*as = &b->scroll.buf[b->scroll.index];
-		if (ae)
-			*ae = &b->scroll.buf[(b->scroll.index + b->scroll.below-1) % b->scroll.size];
-	}
-}
-
-static
-Row *
-browfirst(Buffer *b) 
-{
-	Row *bstart;
-	if (!b->scroll.size || !b->scroll.above)
-		return b->row;
-	bboundary(b, &bstart, nil, nil, nil);
-	return bstart;
-}
-
-static
-Row *
-browlast(Buffer *b) 
-{
-	Row *aend;
-	if (!b->scroll.size || !b->scroll.below)
-		return b->row + b->h - 1;
-	bboundary(b, nil, nil, nil, &aend);
-	return aend;
-}
-
-static
-Row *
-brownext(Buffer *b, Row *row)
-{
-	Row *before_start, *before_end, *after_start, *after_end;
-	Row *first = b->row, *last = b->row + b->h - 1;
-
-	if (!row)
-		return nil;
-
-	bboundary(b, &before_start, &before_end, &after_start, &after_end);
-
-	if (row >= first && row < last)
-		return ++row;
-	if (row == last)
-		return after_start;
-	if (row == before_end)
-		return first;
-	if (row == after_end)
-		return nil;
-	if (row == &b->scroll.buf[b->scroll.size - 1])
-		return b->scroll.buf;
-	return ++row;
-}
-
-static
-Row *
-bprevrow(Buffer *b, Row *row)
-{
-	Row *before_start, *before_end, *after_start, *after_end;
-	Row *first = b->row, *last = b->row + b->h - 1;
-
-	if (!row)
-		return nil;
-
-	bboundary(b, &before_start, &before_end, &after_start, &after_end);
-
-	if (row > first && row <= last)
-		return --row;
-	if (row == first)
-		return before_end;
-	if (row == before_start)
-		return nil;
-	if (row == after_start)
-		return last;
-	if (row == b->scroll.buf)
-		return &b->scroll.buf[b->scroll.size - 1];
-	return --row;
-}
-
-// -----------------------------------------------------------------------
-// windows
-
-Window *
-wmake(Window *root, int top, int left, int w, int h, int scroll)
-{
-    Window *child, *it;
-
-    child = calloc(1, sizeof(*child));
-    child->top    = top;
-    child->left   = left;
-    child->parent = root;
-    if (root) {
-        if (root->child) {
-            for (it = root->child; it->link != nil; it = it->link)
-                ;
-            it->link    = child;
-        } else
-            root->child = child;
-
-        child->curvis = root->curvis;
-        child->blink  = root->blink;
-    }
-
-    if (!binit((Buffer*)child, w, h, scroll)) {
-        free(child);
-        return nil;
-    }
-
-    return child;
-}
-
-void
-wfree(Window *win)
-{
-    free(win);
-}
-
-void
-wresize(Window *win, int w, int h)
-{
-    bresize((Buffer*)win, w, h);
-}
-
-/* TODO: more sophisticated damage tracking */
-void
-wputrune(Window *win, rune r)
-{
-    Row  *row  = win->row + win->cur.row;
-    Cell *cell = row->cells + win->cur.col;
-
-    cell->pen = win->pen;
-    cell->txt = r;
-
-    if (win->cur.col++ >= win->w) {
-        win->cur.col = 0;
-        if (win->cur.row++ >= win->h)
-            win->cur.row = win->h-1;
-    }
-    row->dirty = 1;
-}
-
-void
-wscroll(Window *win, int s)
-{
-    bscroll((Buffer*)win, s);
-}
diff --git a/sys/libutf/canfit.c b/sys/libutf/canfit.c
deleted file mode 100644
index 4579ab3..0000000
--- a/sys/libutf/canfit.c
+++ /dev/null
@@ -1,23 +0,0 @@
-#include "internal.h"
-
-/* returns 1 if string of length n is long enough to be decoded */
-int
-utf8·canfit(byte* s, int n)
-{
-    int  i;
-    rune c;
-
-    if(n <= 0)
-        return 0;
-
-    c = *(ubyte*)s;
-    if(c < TByte1)
-        return 1;
-
-    if(c < TByte3)
-        return n >= 2;
-    if(c < TByte4)
-        return n >= 3;
-
-    return n >= UTFmax;
-}
diff --git a/sys/libutf/decode.c b/sys/libutf/decode.c
deleted file mode 100644
index 01797f1..0000000
--- a/sys/libutf/decode.c
+++ /dev/null
@@ -1,98 +0,0 @@
-#include "internal.h"
-
-#define ACCEPT 0
-#define REJECT 12
-
-static uint8 decode[] = {
-    /*
-     * the first part of the table maps bytes to character classes that
-     * to reduce the size of the transition table and create bitmasks
-     */
-     0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,  0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-     0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,  0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-     0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,  0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-     0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,  0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-     1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,  9,9,9,9,9,9,9,9,9,9,9,9,9,9,9,9,
-     7,7,7,7,7,7,7,7,7,7,7,7,7,7,7,7,  7,7,7,7,7,7,7,7,7,7,7,7,7,7,7,7,
-     8,8,2,2,2,2,2,2,2,2,2,2,2,2,2,2,  2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,
-    10,3,3,3,3,3,3,3,3,3,3,3,3,4,3,3, 11,6,6,6,5,8,8,8,8,8,8,8,8,8,8,8,
-
-    /*
-     * the second part is a transition table that maps a combination
-     * of a state of the automaton and a character class to a state
-     */
-     0,12,24,36,60,96,84,12,12,12,48,72, 12,12,12,12,12,12,12,12,12,12,12,12,
-    12, 0,12,12,12,12,12, 0,12, 0,12,12, 12,24,12,12,12,12,12,24,12,24,12,12,
-    12,12,12,12,12,12,12,24,12,12,12,12, 12,24,12,12,12,12,12,12,12,24,12,12,
-    12,12,12,12,12,12,12,36,12,36,12,12, 12,36,12,12,12,12,12,36,12,36,12,12,
-    12,36,12,12,12,12,12,12,12,12,12,12,
-};
-
-int
-utf8·decode(char *s, rune *r)
-{
-    int   n;
-    rune  v;
-    uint8 b, t, x=ACCEPT;
-
-    b = ((uint8 *)s)[0];
-    t = decode[b];
-    v = (0xFF >> t) & b;
-    x = decode[256+x+t];
-
-    for(n=1; x > REJECT && n < UTFmax; n++){
-        b = ((uint8 *)s)[n];
-        t = decode[b];
-        v = (v << 6) | (b & TMask);
-        x = decode[256+x+t];
-    }
-
-    if(x != ACCEPT){
-        *r = RuneErr;
-        return 1;
-    }
-
-    *r = v;
-    return n;
-}
-
-#if 0
-int
-utf8·decode(byte *s, rune *r)
-{
-    int c[UTFmax], i;
-    rune l;
-
-    c[0] = *(ubyte*)(s);
-    if(c[0] < Tx){
-        *r = c[0];
-        return 1;
-    }
-
-    l = c[0];
-    for(i = 1; i < UTFmax; i++){
-        c[i]  = *(ubyte*)(s+i);
-        c[i] ^= Tx;
-        if(c[i] & Testx) goto bad;
-
-        l = (l << Bitx) | c[i];
-        if(c[0] < Tbyte(i + 2)){
-            l &= RuneX(i + 1);
-            if(i == 1){
-                if(c[0] < Tbyte(2) || l <= Rune1)
-                    goto bad;
-            }else if(l <= RuneX(i) || l > RuneMax)
-                goto bad;
-
-            if(i == 2 && SurrogateMin <= l && l <= SurrogateMax)
-                goto bad;
-
-            *r = l;
-            return i + 1;
-        }
-    }
-bad:
-    *r = RuneErr;
-    return 1;
-}
-#endif
diff --git a/sys/libutf/decodeprev.c b/sys/libutf/decodeprev.c
deleted file mode 100644
index 27dced6..0000000
--- a/sys/libutf/decodeprev.c
+++ /dev/null
@@ -1,60 +0,0 @@
-#include "internal.h"
-
-#define ACCEPT 0
-#define REJECT 12
-
-static uint8 decode[] = {
-    /*
-     * the first part of the table maps bytes to character classes that
-     * to reduce the size of the transition table and create bitmasks.
-     */
-         0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,  0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-         0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,  0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-         0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,  0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-         0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,  0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-         1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,  9,9,9,9,9,9,9,9,9,9,9,9,9,9,9,9,
-         7,7,7,7,7,7,7,7,7,7,7,7,7,7,7,7,  7,7,7,7,7,7,7,7,7,7,7,7,7,7,7,7,
-         8,8,2,2,2,2,2,2,2,2,2,2,2,2,2,2,  2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,
-        10,3,3,3,3,3,3,3,3,3,3,3,3,4,3,3, 11,6,6,6,5,8,8,8,8,8,8,8,8,8,8,8,
-    /*
-     * The second part is a transition table that maps a combination
-     * of a state of the automaton and a character class to a state.
-     */
-    //   0  1  2  3  4  5  6  7  8  9 10 11
-         0,24,12,12,12,12,12,24,12,24,12,12,
-         0,24,12,12,12,12,12,24,12,24,12,12,
-        12,36, 0,12,12,12,12,48,12,36,12,12,
-        12,60,12, 0, 0,12,12,72,12,72,12,12,
-        12,60,12, 0,12,12,12,72,12,72, 0,12,
-        12,12,12,12,12, 0, 0,12,12,12,12,12,
-        12,12,12,12,12,12,12,12,12,12,12, 0
-};
-
-int
-utf8·decodeprev(byte *s, rune *r)
-{
-    int   n;
-    rune  v;
-    uint8 b, t, d, x=ACCEPT;
-
-    v=0, n=0, d=0;
-nextbyte:
-    b = ((uint8 *)s)[-n++];
-    t = decode[b];
-    x = decode[256+x+t];
-
-    if(x > REJECT && n < UTFmax){
-        v = v | ((b & TMask) << d);
-        d += 6;
-        goto nextbyte;
-    }
-
-    if(x != ACCEPT)
-        *r = RuneErr;
-    else{
-        v |= (((0xFFu >> t) & b) << d);
-        *r = v;
-    }
-
-    return n;
-}
diff --git a/sys/libutf/encode.c b/sys/libutf/encode.c
deleted file mode 100644
index fa7c93e..0000000
--- a/sys/libutf/encode.c
+++ /dev/null
@@ -1,69 +0,0 @@
-#include "internal.h"
-
-int
-utf8·encode(rune *r, byte *s)
-{
-    rune c;
-
-    c = *r;
-    if(c < Rune1Byte){ // 7 bits
-        s[0] = (uint8)c;
-        return 1;
-    }
-
-    if(c < Rune2Byte){ // 11 bits
-        s[0] = TByte1 | (c >> 6);
-        s[1] = Tx     | (c & TMask);
-        return 2;
-    }
-
-    if(c < Rune3Byte){ // 16 bits
-        s[0] = TByte2 | ((c >> 12));
-        s[1] = Tx     | ((c >> 6) & TMask);
-        s[2] = Tx     | ((c)      & TMask);
-        return 3;
-    }
-
-    // 22 bits
-    if(c > RuneMax || (RuneSurrogateMin <= c && c <= RuneSurrogateMax))
-        c = RuneErr;
-
-    s[0] = TByte3 | ((c >> 18));
-    s[1] = Tx     | ((c >> 12) & TMask);
-    s[2] = Tx     | ((c >> 6)  & TMask);
-    s[3] = Tx     | ((c)       & TMask);
-
-    return 4;
-}
-
-#if 0
-int
-utf8·encode(rune* r, byte* s)
-{
-    int i, j;
-    rune c;
-
-    c = *r;
-    if(c <= Rune1) {
-        s[0] = c;
-        return 1;
-    }
-
-    for(i = 2; i < UTFmax + 1; i++){
-        if(i == 3){
-            if(c > RuneMax)
-                c = RuneErr;
-            if(SurrogateMin <= c && c <= SurrogateMax)
-                c = RuneErr;
-        }
-        if(c <= RuneX(i) || i == UTFmax) {
-            s[0] = Tbyte(i) |  (c >> (i - 1)*Bitx);
-            for(j = 1; j < i; j++)
-                s[j] = Tx | ((c >> (i - j - 1)*Bitx) & Maskx);
-            return i;
-        }
-    }
-
-    return UTFmax;
-}
-#endif
diff --git a/sys/libutf/find.c b/sys/libutf/find.c
deleted file mode 100644
index d75feb8..0000000
--- a/sys/libutf/find.c
+++ /dev/null
@@ -1,31 +0,0 @@
-#include "internal.h"
-
-byte*
-utf8·find(byte* s, rune c)
-{
-    long c1;
-    rune r;
-    int  n;
-
-    if(c < Tx)
-        return strchr(s, c);
-
-    for(;;){
-        c1 = *(ubyte*)s;
-        if(c1 < Tx){
-            if(c1 == 0) return nil;
-            if(c1 == c) return s;
-            s++;
-            continue;
-        }
-
-        n = utf8·decode(s, &r);
-
-        if(r == c)
-            return s;
-
-        s += n;
-    }
-
-    return nil;
-}
diff --git a/sys/libutf/findlast.c b/sys/libutf/findlast.c
deleted file mode 100644
index ab25ab2..0000000
--- a/sys/libutf/findlast.c
+++ /dev/null
@@ -1,32 +0,0 @@
-#include "internal.h"
-
-byte*
-utf8·findlast(byte* s, rune c)
-{
-    long c1;
-    rune r;
-    byte *l;
-
-    if(c < Tx)
-        return strrchr(s, c);
-
-    l = nil;
-    for(;;){
-        c1 = *(ubyte*)s;
-        if(c1 < Tx){
-            if(c1 == 0) return l;
-            if(c1 == c) l = s;
-            s++;
-            continue;
-        }
-
-        c1 = utf8·decode(s, &r);
-
-        if(r == c)
-            l = s;
-
-        s += c1;
-    }
-
-    return nil;
-}
diff --git a/sys/libutf/internal.h b/sys/libutf/internal.h
deleted file mode 100644
index 9719977..0000000
--- a/sys/libutf/internal.h
+++ /dev/null
@@ -1,38 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <base.h>
-#include <libutf.h>
-
-/*
- * NOTE: we use the preprocessor to ensure we have unsigned constants.
- * UTF-8 code:
- * 1 byte:
- * 0xxxxxxx
- * 2 byte:
- * 110xxxxx 10xxxxxx
- * 3 byte:
- * 1110xxxx 10xxxxxx 10xxxxxx
- * 4 byte:
- * 11110xxx 10xxxxxx 10xxxxxx 10xxxxxx
- */
-
-#define Tx     0x80u // 0b10000000 transfer header
-#define TMask  0x3Fu // 0b00111111 transfer mask
-
-#define TByte1 0xC0u // 0b11000000
-#define TByte2 0xE0u // 0b11100000
-#define TByte3 0xF0u // 0b11110000
-#define TByte4 0xF8u // 0b11111000
-
-#define RuneMask  0x1FFFFFu
-
-#define Rune1Byte 0x000080u  // 1 << 8   (1 byte)
-#define Rune2Byte 0x001000u  // 1 << 12  (2 bytes)
-#define Rune3Byte 0x020000u  // 1 << 17  (3 bytes)
-#define Rune4Byte 0x400000u  // 1 << 22  (4 bytes)
-
-
-/* UTF-16 nonsense */
-#define RuneSurrogateMin 0x0D8000
-#define RuneSurrogateMax 0x0D8FFF
diff --git a/sys/libutf/len.c b/sys/libutf/len.c
deleted file mode 100644
index 8fbd679..0000000
--- a/sys/libutf/len.c
+++ /dev/null
@@ -1,21 +0,0 @@
-#include "internal.h"
-
-int
-utf8·len(char *s)
-{
-    int c;
-    long n;
-    rune r;
-
-    n = 0;
-    for(;;){
-        c = *(uchar*)s;
-        if(c < Tx){
-            if(c == 0)
-                return n;
-            s++;
-        }else
-            s += utf8·decode(s, &r);
-        n++;
-    }
-}
diff --git a/sys/libutf/rules.mk b/sys/libutf/rules.mk
deleted file mode 100644
index 53ff8cf..0000000
--- a/sys/libutf/rules.mk
+++ /dev/null
@@ -1,76 +0,0 @@
-include share/push.mk
-
-UNICODE = 14.0.0
-
-SRCS_$(d) := \
-	$(d)/encode.c \
-	$(d)/decode.c \
-	$(d)/decodeprev.c \
-	$(d)/find.c \
-	$(d)/findlast.c \
-	$(d)/canfit.c \
-	$(d)/runelen.c \
-	$(d)/len.c \
-	$(d)/runetype-$(UNICODE).c \
-	$(d)/runewidth-$(UNICODE).c
-
-LIBS_$(d) := $(d)/libutf.a
-
-include share/paths.mk
-
-# ========================================================================
-# table generation
-
-$(d)/vendor/common.o: $(d)/vendor/common.c
-	$(COMPILE)
-
-# rune categories
-$(d)/vendor/UnicodeData-$(UNICODE).txt:
-	@echo "GET	UnicodeData.txt";\
-	curl https://www.unicode.org/Public/$(UNICODE)/ucd/UnicodeData.txt > $@
-
-$(d)/vendor/mkrunetype: $(d)/vendor/mkrunetype.c $(d)/vendor/common.o $(OBJ_DIR)/sys/base/base.a
-	$(COMPLINK)
-
-GENS += $(d)/vendor/mkrunetype
-
-$(d)/runetype-$(UNICODE).c: $(d)/vendor/UnicodeData-$(UNICODE).txt $(d)/vendor/mkrunetype
-	@$(dir $@)vendor/mkrunetype $< > $@
-
-# rune widths
-$(d)/vendor/EastAsianWidth-$(UNICODE).txt:
-	@echo "GET	EastAsianWidth.txt";\
-	curl https://www.unicode.org/Public/$(UNICODE)/ucd/EastAsianWidth.txt > $@
-
-$(d)/vendor/EmojiData-$(UNICODE).txt:
-	@echo "GET	EmojiData.txt";\
-	curl https://www.unicode.org/Public/$(UNICODE)/ucd/emoji/emoji-data.txt > $@
-
-$(d)/vendor/mkrunewidth: $(d)/vendor/mkrunewidth.c $(d)/vendor/common.o $(OBJ_DIR)/sys/base/base.a
-	$(COMPLINK)
-
-GENS += $(d)/vendor/mkrunewidth
-
-$(d)/runewidth-$(UNICODE).c: $(d)/vendor/mkrunewidth $(d)/vendor/UnicodeData-$(UNICODE).txt $(d)/vendor/EastAsianWidth-$(UNICODE).txt $(d)/vendor/EmojiData-$(UNICODE).txt
-	@$(dir $@)vendor/mkrunewidth $(filter-out $<, $^) > $@
-
-# grapheme boundaries
-$(d)/vendor/GraphemeBreakProperty-$(UNICODE).txt:
-	@echo "GET	GraphemeBreakProperty.txt";\
-	curl https://www.unicode.org/Public/$(UNICODE)/ucd/auxiliary/GraphemeBreakProperty.txt > $@
-
-$(d)/vendor/mkgraphemedata: $(d)/vendor/mkgraphemedata.c $(d)/vendor/common.o $(OBJ_DIR)/sys/base/base.a
-	$(COMPLINK)
-
-$(d)/graphemedata-$(UNICODE).c: $(d)/vendor/mkgraphemedata $(d)/vendor/GraphemeBreakProperty-$(UNICODE).txt
-	$^ > $@
-
-GENS += $(d)/vendor/mkgraphemedata
-
-# ========================================================================
-# normal operations
-
-$(LIBS_$(d)): $(OBJS_$(d))
-	$(ARCHIVE)
-
-include share/pop.mk
diff --git a/sys/libutf/runelen.c b/sys/libutf/runelen.c
deleted file mode 100644
index dac7f15..0000000
--- a/sys/libutf/runelen.c
+++ /dev/null
@@ -1,8 +0,0 @@
-#include "internal.h"
-
-int
-utf8·runelen(rune r)
-{
-    byte s[10];
-    return utf8·encode(&r, s);
-}
diff --git a/sys/libutf/vendor/common.c b/sys/libutf/vendor/common.c
deleted file mode 100644
index 5a03a50..0000000
--- a/sys/libutf/vendor/common.c
+++ /dev/null
@@ -1,220 +0,0 @@
-#include "common.h"
-
-// -----------------------------------------------------------------------
-// input functions
-
-int
-parse(io·Stream *io, int nfield, char **field, int len, char *line)
-{
-    int n;
-    if((n=io·readln(io, len, line)) <= 0)
-        return ParseEOF;
-
-    if(n == len)
-        panicf("line too long");
-
-    if(line[n-1] != '\n')
-        panicf("invalid line: expected '\n', found '%c'", line[n]);
-
-    line[n-1] = 0;
-
-    if(line[0] == '#' || line[0] == 0)
-        return ParseSkip;
-
-    /* tokenize line into fields */
-    n = 0;
-    field[n] = line;
-    while(*line){
-        if(*line == ';'){
-            *line = 0;
-            field[++n] = line+1;
-        }
-        line++;
-    }
-
-    if(n != nfield-1)
-        panicf("expected %d number of fields, got %d: %s", nfield, n, line);
-
-    return ParseOK;
-}
-
-int
-codepoint(char *s)
-{
-    int c, b;
-
-    c = 0;
-    while((b=*s++)){
-        c <<= 4;
-        if(b >= '0' && b <= '9')
-            c += b - '0';
-        else if(b >= 'A' && b <= 'F')
-            c += b - 'A' + 10;
-        else
-            panicf("bad codepoint char '%c'", b);
-    }
-
-    return c;
-}
-
-void
-codepointrange(io·Stream *utf8, char *field[NumFields], int *start,  int *stop)
-{
-    int e, c;
-    char *other[NumFields], line[1024];
-
-    // XXX: the stop variable passes in the previous stopping character
-    e = *stop;
-    c = codepoint(field[Fcode]);
-
-    if(c >= NumRunes)
-        panicf("unexpected large codepoint %x", c);
-    if(c <= e)
-        panicf("bad code sequence: %x then %x", e, c);
-    e = c;
-
-    if(strstr(field[Fname], ", First>") != nil){
-        if(!parse(utf8, arrlen(other), other, arrlen(line), line))
-            panicf("range start at end of file");
-        if(strstr(other[Fname], ", Last>") == nil)
-            panicf("range start not followed by range end");
-
-        e = codepoint(other[Fcode]);
-
-        if(e <= c)
-            panicf("bad code sequence: %x then %x", c, e);
-        if(strcmp(field[Fcategory], other[Fcategory]) != 0)
-            panicf("range with mismatched category");
-    }
-
-    *start = c;
-    *stop  = e;
-}
-
-// -----------------------------------------------------------------------
-// output functions
-
-void
-putsearch(void)
-{
-    puts(
-        "#include <u.h>\n"
-        "#include <libutf.h>\n"
-        "\n"
-        "static\n"
-        "rune*\n"
-        "rangesearch(rune c, rune *t, int n, int ne)\n"
-        "{\n"
-        "   rune *p;\n"
-        "   int m;\n"
-        "   while(n > 1) {\n"
-        "   m = n >> 1;\n"
-        "   p = t + m*ne;\n"
-        "   if(c >= p[0]){\n"
-        "       t = p;\n"
-        "       n = n-m;\n"
-        "   }else\n"
-        "       n = m;\n"
-        "   }\n"
-        "   if(n && c >= t[0])\n"
-        "       return t;\n"
-        "   return 0;\n"
-        "}\n"
-    );
-
-}
-
-int
-putrange(char *ident, char *prop, int force)
-{
-    int l, r, start;
-
-    start = 0;
-    for(l = 0; l < NumRunes;) {
-        if(!prop[l]){
-            l++;
-            continue;
-        }
-
-        for(r = l+1; r < NumRunes; r++){
-            if(!prop[r])
-                break;
-            prop[r] = 0;
-        }
-
-        if(force || r > l + 1){
-            if(!start){
-                printf("static rune %s[] = {\n", ident);
-                start = 1;
-            }
-            prop[l] = 0;
-            printf("\t0x%.4x, 0x%.4x,\n", l, r-1);
-        }
-
-        l = r;
-    }
-
-    if(start)
-        printf("};\n\n");
-
-    return start;
-}
-
-int
-putpair(char *ident, char *prop)
-{
-    int l, r, start;
-
-    start = 0;
-    for(l=0; l+2 < NumRunes; ){
-        if(!prop[l]){
-            l++;
-            continue;
-        }
-
-        for(r = l + 2; r < NumRunes; r += 2){
-            if(!prop[r])
-                break;
-            prop[r] = 0;
-        }
-
-        if(r != l + 2){
-            if(!start){
-                printf("static rune %s[] = {\n", ident);
-                start = 1;
-            }
-            prop[l] = 0;
-            printf("\t0x%.4x, 0x%.4x,\n", l, r - 2);
-        }
-
-        l = r;
-    }
-
-    if(start)
-        printf("};\n\n");
-    return start;
-}
-
-int
-putsingle(char *ident, char *prop)
-{
-    int i, start;
-
-    start = 0;
-    for(i = 0; i < NumRunes; i++) {
-        if(!prop[i])
-            continue;
-
-        if(!start){
-            printf("static rune %s[] = {\n", ident);
-            start = 1;
-        }
-        prop[i] = 0;
-        printf("\t0x%.4x,\n", i);
-    }
-
-    if(start)
-        printf("};\n\n");
-
-    return start;
-}
diff --git a/sys/libutf/vendor/common.h b/sys/libutf/vendor/common.h
deleted file mode 100644
index 62f6c5b..0000000
--- a/sys/libutf/vendor/common.h
+++ /dev/null
@@ -1,46 +0,0 @@
-#pragma once
-
-#include <u.h>
-#include <base.h>
-#include <libutf.h>
-
-enum
-{
-    // Fields inside UnicodeData.txt
-    Fcode,
-    Fname,
-    Fcategory,
-    Fcombine,
-    Fbidir,
-    Fdecomp,
-    Fdecimal,
-    Fdigit,
-    Fnumeric,
-    Fmirror,
-    Foldname,
-    Fcomment,
-    Fupper,
-    Flower,
-    Ftitle,
-
-    NumFields,
-    NumRunes = 1 << 21,
-};
-
-/* input functions */
-enum
-{
-    ParseEOF,
-    ParseOK,
-    ParseSkip,
-};
-
-int  parse(io·Stream *io, int nfield, char **field, int len, char *line);
-int  codepoint(char *s);
-void codepointrange(io·Stream *utf8, char *field[NumFields], int *start,  int *stop);
-
-/* output functions */
-void putsearch(void);
-int  putrange(char *ident, char *prop, int force);
-int  putpair(char *ident, char *prop);
-int  putsingle(char *ident, char *prop);
diff --git a/sys/libutf/vendor/mkgraphemedata.c b/sys/libutf/vendor/mkgraphemedata.c
deleted file mode 100644
index ce5a952..0000000
--- a/sys/libutf/vendor/mkgraphemedata.c
+++ /dev/null
@@ -1,24 +0,0 @@
-#include <u.h>
-#include <base.h>
-#include <libutf.h>
-
-// -----------------------------------------------------------------------
-// main point of entry
-
-static
-void
-usage(void)
-{
-    fprintf(stderr, "usage: mkgraphemedata <GraphemeBreakProperty.txt>\n");
-    exit(1);
-}
-
-int
-main(int argc, char *argv[])
-{
-    io·Stream *utf8;
-    char line[1024];
-
-    ARGBEGIN{
-    }ARGEND;
-}
diff --git a/sys/libutf/vendor/mkrunetype.c b/sys/libutf/vendor/mkrunetype.c
deleted file mode 100644
index 9f939f4..0000000
--- a/sys/libutf/vendor/mkrunetype.c
+++ /dev/null
@@ -1,388 +0,0 @@
-#include "common.h"
-
-// -----------------------------------------------------------------------
-// globals
-
-#define OFFSET (1 << 20)
-#define DELTA(mapx, x)  ((1 << 20) + (mapx) - (x))
-
-// TODO: use bitarrays. will reduce executable size 8x
-struct Table
-{
-    /* properties */
-    char isspace[NumRunes];
-    char isalpha[NumRunes];
-    char ismark[NumRunes];
-    char isdigit[NumRunes];
-    char isupper[NumRunes];
-    char islower[NumRunes];
-    char istitle[NumRunes];
-    char ispunct[NumRunes];
-    char issymbl[NumRunes];
-    char iscntrl[NumRunes];
-
-    char combine[NumRunes];
-
-    /* transformations */
-    int  toupper[NumRunes];
-    int  tolower[NumRunes];
-    int  totitle[NumRunes];
-};
-
-static struct Table table;
-
-// -----------------------------------------------------------------------
-// internal functions
-
-static
-int
-isrange(char *label, char *prop, int force)
-{
-    char ident[128];
-    if(snprintf(ident, arrlen(ident), "is%s_range", label) == arrlen(ident))
-        panicf("out of identifier space\n");
-
-    return putrange(ident, prop, force);
-}
-
-static
-int
-ispair(char *label, char *prop)
-{
-    char ident[128];
-    if(snprintf(ident, arrlen(ident), "is%s_pair", label) == arrlen(ident))
-        panicf("out of identifier space\n");
-
-    return putpair(ident, prop);
-}
-
-static
-int
-issingle(char *label, char *prop)
-{
-    char ident[128];
-    if(snprintf(ident, arrlen(ident), "is%s_single", label) == arrlen(ident))
-        panicf("out of identifier space\n");
-
-    return putsingle(ident, prop);
-}
-
-static
-void
-makeis(char *label, char *table, int pairs, int onlyranges)
-{
-    int hasr, hasp=0, hass=0;
-
-    hasr = isrange(label, table, onlyranges);
-    if(!onlyranges && pairs)
-        hasp = ispair(label, table);
-    if(!onlyranges)
-        hass = issingle(label, table);
-
-    printf(
-        "int\n"
-        "utf8·is%s(rune c)\n"
-        "{\n"
-        "    rune *p;\n"
-        "\n",
-        label);
-
-    if(hasr){
-        printf(
-            "   p = rangesearch(c, is%s_range, arrlen(is%s_range)/2, 2);\n"
-            "   if(p && c >= p[0] && c <= p[1])\n"
-            "       return 1;\n",
-            label, label);
-    }
-
-    if(hasp){
-        printf(
-            "   p = rangesearch(c, is%s_pair, arrlen(is%s_pair)/2, 2);\n"
-            "   if(p && c >= p[0] && c <= p[1] && !((c - p[0]) & 1))\n"
-            "       return 1;\n",
-            label, label);
-    }
-
-    if(hass)
-        printf(
-            "   p = rangesearch(c, is%s_single, arrlen(is%s_single), 1);\n"
-            "   if(p && c == p[0])\n"
-            "       return 1;\n",
-            label, label);
-
-    printf(
-        "   return 0;\n"
-        "}\n"
-        "\n");
-}
-
-static
-int
-torange(char *label, int *index, int force)
-{
-    int l, r, d, start = 0;
-
-    for(l = 0; l < NumRunes; ){
-        if(index[l] == l){
-            l++;
-            continue;
-        }
-
-        d = DELTA(index[l], l);
-        if(d != (rune)d)
-            panicf("bad map delta %d", d);
-
-        for(r = l+1; r < NumRunes; r++){
-            if(DELTA(index[r], r) != d)
-                break;
-            index[r] = r;
-        }
-
-        if(force || r != l + 1){
-            if(!start){
-                printf("static rune to%s_range[] = {\n", label);
-                start = 1;
-            }
-            index[l] = l;
-            printf("\t0x%.4x, 0x%.4x, %d,\n", l, r-1, d);
-        }
-        l = r;
-    }
-    if(start)
-        printf("};\n\n");
-
-    return start;
-}
-
-static
-int
-topair(char *label, int *index)
-{
-    int l, r, d, start = 0;
-
-    for(l = 0; l + 2 < NumRunes; ){
-        if(index[l] == l){
-            l++;
-            continue;
-        }
-
-        d = DELTA(index[l], l);
-        if(d != (rune)d)
-            panicf("bad delta %d", d);
-
-        for(r = l+2; r < NumRunes; r += 2){
-            if(DELTA(index[r], r) != d)
-                break;
-            index[r] = r;
-        }
-
-        if(r > l+2){
-            if(!start){
-                printf("static rune to%s_pair[] = {\n", label);
-                start = 1;
-            }
-            index[l] = l;
-            printf("\t0x%.4x, 0x%.4x, %d,\n", l, r-2, d);
-        }
-
-        l = r;
-    }
-    if(start)
-        printf("};\n\n");
-
-    return start;
-}
-
-static
-int
-tosingle(char *label, int *index)
-{
-    int i, d, start = 0;
-
-    for(i=0; i < NumRunes; i++) {
-        if(index[i] == i)
-            continue;
-
-        d = DELTA(index[i], i);
-        if(d != (rune)d)
-            panicf("bad map delta %d", d);
-
-        if(!start){
-            printf("static rune to%s_single[] = {\n", label);
-            start = 1;
-        }
-        index[i] = i;
-        printf("\t0x%.4x, %d,\n", i, d);
-    }
-    if(start)
-        printf("};\n\n");
-
-    return start;
-}
-
-static
-void
-mkto(char *label, int *index, int pairs, int onlyrange)
-{
-    int hasr, hasp=0, hass=0;
-
-    hasr = torange(label, index, !onlyrange);
-    if(!onlyrange && pairs)
-        hasp = topair(label, index);
-    if(!onlyrange)
-        hass = tosingle(label, index);
-
-    printf(
-        "rune\n"
-        "utf8·to%s(rune c)\n"
-        "{\n"
-        "	rune *p;\n"
-        "\n",
-        label);
-
-    if(hasr)
-        printf(
-            "   p = rangesearch(c, to%s_range, arrlen(to%s_range)/3, 3);\n"
-            "   if(p && c >= p[0] && c <= p[1])\n"
-            "       return c + p[2] - %d;\n",
-            label, label, OFFSET);
-
-    if(hasp)
-        printf(
-            "   p = rangesearch(c, to%s_pair, arrlen(to%s_pair)/3, 3);\n"
-            "   if(p && c >= p[0] && c <= p[1] && !((c - p[0]) & 1))\n"
-            "       return c + p[2] - %d;\n",
-            label, label, OFFSET);
-
-    if(hass)
-        printf(
-            "   p = rangesearch(c, to%s_single, arrlen(to%s_single)/2, 2);\n"
-            "   if(p && c == p[0])\n"
-            "       return c + p[1] - %d;\n",
-            label, label, OFFSET);
-
-
-    printf(
-        "   return c;\n"
-        "}\n"
-        "\n"
-    );
-}
-
-// -----------------------------------------------------------------------
-// main point of entry
-
-static
-void
-usage(void)
-{
-    fprintf(stderr, "usage: mkrunetype <UnicodeData.txt>\n");
-    exit(1);
-}
-
-int
-main(int argc, char *argv[])
-{
-    int i, sc, c, ec;
-    io·Stream *utf8;
-    char *prop, *field[NumFields], line[1024];
-
-    ARGBEGIN{
-    }ARGEND;
-
-    if(argc != 1)
-        usage();
-
-    if(!(utf8 = io·open(argv[0], "r")))
-        panicf("can't open %s\n", argv[0]);
-
-    /* by default each character maps to itself */
-    for(i = 0; i < NumRunes; i++) {
-        table.toupper[i] = i;
-        table.tolower[i] = i;
-        table.totitle[i] = i;
-    }
-
-    /* ensure all C local white space characters pass */
-    table.isspace['\t'] = 1;
-    table.isspace['\n'] = 1;
-    table.isspace['\r'] = 1;
-    table.isspace['\f'] = 1;
-    table.isspace['\v'] = 1;
-    table.isspace[0x85] = 1;
-
-    ec = -1;
-    // NOTE: we don't check for comments here: assume UnicodeData.txt doesn't have any
-    while(parse(utf8, arrlen(field), field, arrlen(line), line)){
-        /* parse unicode range */
-        codepointrange(utf8, field, &sc, &ec);
-        prop = field[Fcategory];
-
-        for(c = sc; c <= ec; c++){
-            /* grab properties */
-            switch(prop[0]){
-            case 'L':
-                table.isalpha[c] = 1;
-                switch(prop[1]){
-                case 'u': table.isupper[c] = 1; break;
-                case 'l': table.islower[c] = 1; break;
-                case 't': table.istitle[c] = 1; break;
-                case 'm': break; // modifier letters
-                case 'o': break; // ideograph letters
-                default:
-                    goto badproperty;
-                }
-                break;
-
-            case 'Z':
-                table.isspace[c] = 1;
-                break;
-
-            case 'M':
-                table.ismark[c] = 1;
-                break;
-
-            case 'N':
-                table.isdigit[c] = 1;
-                break;
-
-            case 'P':
-                table.ispunct[c] = 1;
-                break;
-
-            case 'S':
-                table.issymbl[c] = 1;
-                break;
-
-            case 'C':
-                table.iscntrl[c] = 1;
-                break;
-
-            default: badproperty:
-                panicf("unrecognized category '%s'", prop);
-            }
-            /* grab transformations */
-            if(*field[Fupper])
-                table.toupper[c] = codepoint(field[Fupper]);
-            if(*field[Flower])
-                table.tolower[c] = codepoint(field[Flower]);
-            if(*field[Ftitle])
-                table.totitle[c] = codepoint(field[Ftitle]);
-        }
-    }
-    io·close(utf8);
-
-    putsearch();
-
-    makeis("space", table.isspace, 0, 1);
-    makeis("digit", table.isdigit, 0, 1);
-    makeis("alpha", table.isalpha, 0, 0);
-    makeis("upper", table.isupper, 1, 0);
-    makeis("lower", table.islower, 1, 0);
-    makeis("title", table.istitle, 1, 0);
-    makeis("punct", table.ispunct, 1, 0);
-
-    mkto("upper", table.toupper, 1, 0);
-    mkto("lower", table.tolower, 1, 0);
-    mkto("title", table.totitle, 1, 0);
-}
diff --git a/sys/libutf/vendor/mkrunewidth.c b/sys/libutf/vendor/mkrunewidth.c
deleted file mode 100644
index 14e6973..0000000
--- a/sys/libutf/vendor/mkrunewidth.c
+++ /dev/null
@@ -1,325 +0,0 @@
-#include "common.h"
-
-/*
- * inspired by design choices in utf8proc/charwidths.jl
- * all widths default to 1 unless they fall within the categories:
- *      1. Mn 2. Mc 3. Me 4. Zl
- *      5. Zp 6. Cc 7. Cf 8. Cs
- * these default to zero width
- */
-enum
-{
-    /* width ? */
-    WidthNeutral,   /* (N) practially treated like narrow but unclear ... */
-    WidthAmbiguous, /* (A) sometimes wide and sometimes not... */
-    /* width 1 */
-    WidthHalf,      /* (H) = to narrow (compatability equivalent)  */
-    WidthNarrow,    /* (Na) ASCII width */
-    /* width 2 */
-    WidthWide,      /* (W) 2x width */
-    WidthFull,      /* (F) = to wide (compatability equivalent) */
-};
-
-struct Table
-{
-    char width[3][NumRunes];
-};
-
-static struct Table table;
-
-// -----------------------------------------------------------------------
-// internal functions
-
-static
-void
-parse_category(char *path)
-{
-    int sc, c, ec, w;
-    io·Stream *utf8;
-    char *prop, *field[NumFields], line[1024];
-
-    if(!(utf8 = io·open(path, "r")))
-        panicf("can't open %s\n", path);
-
-    // NOTE: we don't check for comments here
-    ec = -1;
-    while(parse(utf8, arrlen(field), field, arrlen(line), line)){
-        codepointrange(utf8, field, &sc, &ec);
-
-        prop = field[Fcategory];
-
-        switch(prop[0]){
-        case 'M':
-            switch(prop[1]){
-            case 'n': case 'c': case 'e':
-                w = 0;
-                break;
-            default:
-                w = 1;
-                break;
-            }
-            break;
-        case 'Z':
-            switch(prop[1]){
-                case 'l': case 'p':
-                    w = 0;
-                    break;
-                default:
-                    w = 1;
-                    break;
-            }
-            break;
-        case 'C':
-            switch(prop[1]){
-                case 'c': case 'f': case 's':
-                    w = 0;
-                    break;
-                default:
-                    w = 1;
-                    break;
-            }
-        default:
-            w = 1;
-        }
-
-        for(c = sc; c <= ec; c++)
-            table.width[w][c] = 1;
-    }
-
-    io·close(utf8);
-}
-
-static
-void
-coderange(char *field, int *l, int *r)
-{
-    char *s;
-
-    if(!(s = strstr(field, "..")))
-        *l=*r=codepoint(field);
-    else{
-        *s++ = 0, *s++ = 0;
-        *l=codepoint(field);
-        *r=codepoint(s);
-    }
-}
-
-static
-void
-parse_eawidths(char *path)
-{
-    int at, w;
-    int l, c, r;
-    io·Stream *utf8;
-    char *field[2], line[1024];
-
-    utf8 = io·open(path, "r");
-    while((at=parse(utf8, arrlen(field), field, arrlen(line), line)) != ParseEOF){
-        if(at == ParseSkip)
-            continue;
-
-        switch(field[1][0]){
-        case 'A': continue;
-        case 'N':
-            if(field[1][1] != 'a')
-                continue;
-        /* fallthrough */
-        case 'H': w = 1; break;
-
-        case 'W': /* fallthrough */
-        case 'F': w = 2; break;
-
-        default:
-            panicf("malformed east asian width class: %s\n", field[1]);
-        }
-
-        coderange(field[0], &l, &r);
-
-        for(c=l; c <= r; c++){
-            /* ensure it only exists in one table */
-            table.width[w][c]       = 1;
-            table.width[(w+1)%3][c] = 0;
-            table.width[(w+2)%3][c] = 0;
-        }
-    }
-    io·close(utf8);
-}
-
-static
-void
-parse_emoji(char *path)
-{
-    int at, w;
-    int l, c, r;
-    io·Stream *utf8;
-    char *s, *field[2], line[1024];
-
-    utf8 = io·open(path, "r");
-    while((at=parse(utf8, arrlen(field), field, arrlen(line), line)) != ParseEOF){
-        if(at == ParseSkip)
-            continue;
-
-        /* only override emoji presentation */
-        if(!strstr(field[1], "Emoji_Presentation"))
-            continue;
-
-        /* trim trailing space */
-        for(s=field[0]; *s; s++){
-            if(*s == ' ')
-                *s = 0;
-        }
-
-        coderange(field[0], &l, &r);
-
-        for(c=l; c <= r; c++){
-            table.width[0][c] = 0;
-            table.width[1][c] = 0;
-            table.width[2][c] = 1;
-        }
-    }
-
-    io·close(utf8);
-}
-
-/* output functions */
-static
-void
-maketable(char *label, char *table, int pairs, int onlyranges)
-{
-    int r, p=0, s=0;
-    char ident[3][128];
-
-    enum
-    {
-        Irange,
-        Ipair,
-        Isingle,
-    };
-
-    /* ranges */
-    if(snprintf(ident[Irange], arrlen(ident[Irange]), "%s_range", label) == arrlen(ident[Irange]))
-        panicf("out of identifier space\n");
-    r = putrange(ident[Irange], table, onlyranges);
-
-    if(!onlyranges && pairs){
-        if(snprintf(ident[Ipair], arrlen(ident[Ipair]), "%s_pair", label) == arrlen(ident[Ipair]))
-            panicf("out of identifier space\n");
-        p = putpair(ident[Ipair], table);
-    }
-    if(!onlyranges){
-        if(snprintf(ident[Isingle], arrlen(ident[Isingle]), "%s_single", label) == arrlen(ident[Isingle]))
-            panicf("out of identifier space\n");
-
-        s = putsingle(ident[Isingle], table);
-    }
-
-    printf(
-        "static int\n"
-        "is%s(rune c)\n"
-        "{\n"
-        "    rune *p;\n"
-        "\n",
-        label);
-
-    if(r){
-        printf(
-            "   p = rangesearch(c, %s, arrlen(%s)/2, 2);\n"
-            "   if(p && c >= p[0] && c <= p[1])\n"
-            "       return 1;\n",
-            ident[Irange], ident[Irange]);
-    }
-
-    if(p){
-        printf(
-            "   p = rangesearch(c, %s, arrlen(%s)/2, 2);\n"
-            "   if(p && c >= p[0] && c <= p[1] && !((c - p[0]) & 1))\n"
-            "       return 1;\n",
-            ident[Ipair], ident[Ipair]);
-    }
-
-    if(s)
-        printf(
-            "   p = rangesearch(c, %s, arrlen(%s), 1);\n"
-            "   if(p && c == p[0])\n"
-            "       return 1;\n",
-            ident[Isingle], ident[Isingle]);
-
-    printf(
-        "   return 0;\n"
-        "}\n"
-        "\n");
-}
-
-// -----------------------------------------------------------------------
-// main point of entry
-
-static
-void
-usage(void)
-{
-    fprintf(stderr, "usage: mkrunewidth <UnicodeData.txt> <EastAsianWidth.txt> <EmojiData.txt>\n");
-    exit(1);
-}
-
-#define SETW0(c) \
-    table.width[0][(c)] = 1, \
-    table.width[1][(c)] = 0, \
-    table.width[2][(c)] = 0;
-
-#define SETW1(c) \
-    table.width[0][(c)] = 0, \
-    table.width[1][(c)] = 1, \
-    table.width[2][(c)] = 0;
-
-#define SETW2(c) \
-    table.width[0][(c)] = 0, \
-    table.width[1][(c)] = 0, \
-    table.width[2][(c)] = 1;
-
-
-int
-main(int argc, char *argv[])
-{
-    int c;
-
-    ARGBEGIN{
-    }ARGEND;
-
-    if(argc != 3)
-        usage();
-
-    parse_category(*argv++);
-    parse_eawidths(*argv++);
-    parse_emoji(*argv);
-
-    /* overrides */
-    SETW0(0x2028);
-    SETW0(0x2029);
-
-    SETW1(0x00AD);
-
-    /* simple checking */
-    for(c=0; c<NumRunes; c++){
-        if(table.width[0][c] + table.width[1][c] + table.width[2][c] > 1)
-            panicf("improper table state");
-    }
-
-    putsearch();
-
-    maketable("width0", table.width[0], 1, 0);
-    maketable("width1", table.width[1], 1, 0);
-    maketable("width2", table.width[2], 1, 0);
-
-    puts(
-        "\n"
-        "int\n"
-        "utf8·runewidth(rune c)\n"
-        "{\n"
-        "   if(iswidth1(c))\n"
-        "       return 1;\n"
-        "   if(iswidth2(c))\n"
-        "       return 2;\n"
-        "   return 0;\n"
-        "}"
-    );
-}
diff --git a/sys/nixos/rules.mk b/sys/nixos/rules.mk
deleted file mode 100644
index e69de29..0000000
--- a/sys/nixos/rules.mk
+++ /dev/null
diff --git a/sys/rules.mk b/sys/rules.mk
deleted file mode 100644
index 6d1dfa5..0000000
--- a/sys/rules.mk
+++ /dev/null
@@ -1,41 +0,0 @@
-include share/push.mk
-
-# Iterate through subdirectory tree
-
-DIR := $(d)/cmd
-include $(DIR)/rules.mk
-
-DIR := $(d)/base
-include $(DIR)/rules.mk
-
-DIR := $(d)/libutf
-include $(DIR)/rules.mk
-
-DIR := $(d)/libfmt
-include $(DIR)/rules.mk
-
-DIR := $(d)/libmath
-include $(DIR)/rules.mk
-
-DIR := $(d)/libbio
-include $(DIR)/rules.mk
-
-# DIR := $(d)/libc
-# include $(DIR)/rules.mk
-
-# DIR := $(d)/libdraw
-# include $(DIR)/rules.mk
-
-# DIR := $(d)/libimage
-# include $(DIR)/rules.mk
-
-# DIR := $(d)/libfont
-# include $(DIR)/rules.mk
-
-# DIR := $(d)/libterm
-# include $(DIR)/rules.mk
-
-# DIR := $(d)/libsre
-# include $(DIR)/rules.mk
-
-include share/pop.mk